Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

הערה: המחקר נערך בהתאם להמלצת המדריך לטיפול ושימוש בחי מעבדה של המכון הלאומי לבריאות. פרוטוקול בבעלי חיים אושרה על ידי אוניברסיטת ויסקונסין-מדיסון, טיפול בבעלי חיים מוסדיים ועדת שימוש. פרוטוקול תרבות astrocyte ראשי המוצג כאן היא אמץ הפרוטוקולים שהוצגו על ידי ג&#39;אנג Y 19 et al. ו ג&#39;נגיס P 20 et al. עם כמה שינויים. 1. בהיפוקמפוס Dissection ו astrocyte תרבות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> יש להכין את כל ריאגנטים החומרים הדרושים כולל מספריים כירורגיות, מלקחיים בסדר חלקה, מלקחיים קצה שטוח, מגבות נייר, שקית פסולת, אתנול 70% ו -2 מנות לנתח (קוטר 3.5 ס&quot;מ) על קרח מלא עם 2 תמיסת מלח מאוזן של מ&quot;ל האנק (HBSS) כל . ודא של ציוד הכירורגים הם סטריליים (חיטוי) לפני ההליך ולהשתמש בכל חומר אחר (astrocyte ציפוי בינוני: DMEM + 5% סוס סרום +1% פניצילין, סטרפטומיצין, סוס בסרום, HBSS, 0.25% טריפסין, coverslips זכוכית, צלחות פטרי, 15/50 צינורות מ&quot;ל, צלוחיות T25, וכו &#39;) כמו מראש סטרילית. </li><li style=";text-align:right;direction:rtl"> צמד בעדינות ולרסס את הראש והצוואר של גור עכבר עם אתנול 70% ו לערוף באמצעות מספרי סטרילי חד [איור 1 (1)]. </li><li style=";text-align:right;direction:rtl"> בצע חתך קו אמצע מן אחורי אל קדמי גולגולת עם מספריים קטנים לאורך הקרקפת כדי לחשוף את המוח [איור 1 (2-3)]. </li><li style=";text-align:right;direction:rtl"> חותכים את הגולגולת בקפידה מהצוואר אל האף עם מספריים קטנים. ואז לחתוך קדמי גולגולת כדי נורה חוש הריח ונחות המוחון לנתק את הגולגולת מבסיס הגולגולת. </li><li style=";text-align:right;direction:rtl"> לעשות חתך קטן בבסיס הגולגולת לחתוך לאורך קו האמצע. שימוש במלקחיים שטוח טיפ סטרילי לקלף את הגולגולת. סור גזע המוח בעזרת מלקחיים מעוקלים. סר המוח של הגולגולת ומקום לתוך צלחת לנתח הראשונה [איור 1 (4-9)] 21. </li><li style=";text-align:right;direction:rtl"> בעזרת מלקחיים מעוקל, להעיף את המוח כך את פני השטח הגחון של המוח הוא פונה כלפי מעלה ולאחר מכן נפרד בשתי ההמיספרות עם להב כירורגי סטרילי חד [איור 1 (10,11)] </li><li style=";text-align:right;direction:rtl"> לקלף בחזרה את אונות מוח ובזהירות להסיר את רקמת המוח תיכונה ו התלמוס הבולטת עם מלקחיים שטוחים מעוקלים סטרילי לחשוף את ההיפוקמפוס, מבנה קטן, סוסון ים בצורה באונת הרקתית המדיאלי [איור 1 (12-14)]. </li><li style=";text-align:right;direction:rtl"> הסר את שתי האונות בהיפוקמפוס [איור 1 (15,16)] ובזהירות לנתח את קרומי המוח מן האונות ידי משיכת עם מלקחיים בסדר. צעד זה ימנע זיהום של התרבות astrocyte הסופית על ידי תאי קרום המוח ו פיברובלסטים. </li><li style=";text-align:right;direction:rtl"> מעביר את האונות בהיפוקמפוס המוכנות לתוך התבשיל השני מלא HBSS ולהחזיר אותו על קרח [איור 1 (17,18)]. ברכה בשתי אונות בהיפוקמפוס מתוך עכבר אחת (P0 - P2) להכנת היפופוטםתרבויות astrocyte campal. זה נותן את הצפיפות הנכונה astrocyte. לרכך אונות בהיפוקמפוס באמצעות סכין כירורגית סטרילית חד (כ 4 פעמים). </li><li style=";text-align:right;direction:rtl"> לשאוב HBSS מצלחת באמצעות קצה סטרילי מחוברת פיפטה 1 מ&quot;ל ולהוסיף 3 מ&quot;ל של טריפסין 0.25%, לערבב, להעביר צינור חרוטי 15 מ&quot;ל סטרילי דגירה הרקמה ב 37 מעלות צלזיוס במשך 20 דקות עם רעד עדין. </li><li style=";text-align:right;direction:rtl"> צינור צנטריפוגה XG ב 300 במשך 5 דקות. לשאוב supernatant בזהירות בעזרת פיפטה זכוכית סטרילית מצורפת קו ריק. הוסף 10 מ&quot;ל astrocyte ציפוי בינוני ו triturate (20 - 30 פעמים) באמצעות פיפטה מזכוכית אש מלוטש עד פיסות הרקמה homogenize. </li><li style=";text-align:right;direction:rtl"> צינור צנטריפוגה XG ב 300 במשך 5 דקות. לשאוב supernatant ולהוסיף 2 מיליליטר של תקשורת ציפוי astrocyte prewarmed הטריה. Pass תאים דרך מסנן רשת 70 מיקרומטר (מסננת תא) לתוך צינור 50 מיליליטר חרוטים חדש. </li><li style=";text-align:right;direction:rtl"> פלייט ההשעיה התא כולו על בקבוקון Poly-D- ליזין / Laminin מצופה תרבות T25 סטרילי המכיל 3 מ&quot;ל שלastrocyte ציפוי התקשורת, ואז דגירה את הבקבוק ב 37 מעלות צלזיוס CO 2 באינקובטור 5%. </li><li style=";text-align:right;direction:rtl"> לשאוב התקשורת כולה דיי אני n-גופית (DIV) 1, DIV 3 ו DIV 7, ולהחליף עם 2 מ&quot;ל של התקשורת ציפוי astrocyte טריים. שים את התקדמות מפגש astrocytic תחת מיקרוסקופ אור בכל פעם תוך החלפת מדיה ציפוי astrocyte. הערה: בשלב DIV 1, כל האסטרוציטים קיימא מחוברים אל פני השטח של הבקבוק התרבות תאים מתים או גוססים הכוללים נוירונים מרחפים supernatant. בשעה DIV 3, תאים המצורפת להתחיל לחלק ליצירת שכבת התאים astrocytic. בהעדר התנאים התומכים, התרבות היא כמעט נטולה כל צמיחה עצבית. בשעת DIV 7, שכבת astrocyte הם כ -80 - 90% ומחוברים וכמה microglia וכן תאי מבשר oligodendrocyte נמצאת על גבי שכבת astrocytic. </li><li style=";text-align:right;direction:rtl"> לשאוב את המדיום ציפוי מהבקבוק, להוסיף 2 מ&quot;ל של מדיום ציפוי astrocyte prewarmed טריים, ולשטוףnd להסיר שוב ב -11 DIV, כאשר האסטרוציטים הם ומחובר ומוכנים תת culturing. </li><li style=";text-align:right;direction:rtl"> הוסף 2 מ&quot;ל של טריפסין 0.25%, בעדינות לסובב את הבקבוק כמה פעמים טריפסין לשאוב באמצעות pipet זכוכית סטרילית. </li><li style=";text-align:right;direction:rtl"> הוסף 2 מ&quot;ל של טריפסין 0.25% ולתת את הבקבוק לשבת למכסה המנוע בתרבית רקמה עבור 4 - 5 דקות ב RT. </li><li style=";text-align:right;direction:rtl"> הסר את טריפסין ולשמור את הבקבוק על 37 מעלות צלזיוס חממה 5% CO 2 למשך 10 דקות. הוסף 5 מ&quot;ל prewarmed astrocyte ציפוי בינוני ולנתק את שכבת astrocytic ידי הקשה על הבקבוק על כף היד שלך (3 - 4 פעמים) ואחריו טחינה דקה ועדינה להשיג ניתוק מוחלט לאסוף את האסטרוציטים צינור חרוטי 15 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> צינור צנטריפוגה XG ב 300 במשך 5 דקות, לשאוב supernatant, ולהוסיף 1 בינוני astrocyte ציפוי טרי מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> הוסף 10 μL של השעית תא hemocytometer ולספור את התאים באזור gridded המרכזי הגדול (1 מ&quot;מ 2) באמצעות מיקרוסקופ לעומת שלב הפוך (אובייקטיבי 10X). מולtiply ידי 10 4 להעריך את מספר התאים לכל מ&quot;ל. בקבוק T25 אחת יניב ~ 1 x 10 תאים 6 סך ניתק. זרע ~ 1 x 10 5 תאים 2 astrocyte מ&quot;ל בינוני ציפוי על coverslip זכוכית 12 מ&quot;מ קוטר Poly-D- ליזין precoated בבאר של תרבות צלחת 24 גם. </li><li style=";text-align:right;direction:rtl"> לדגור על 37 מעלות צלזיוס חממה 2 5% CO. בצע OGD / REOX ב DIV 12 - 14 (סעיף 2). </li><li style=";text-align:right;direction:rtl"> פנק את תרבויות astrocyte ב DIV 3 עם 5 המ&quot;מ L- לאוצין מהתיל אסתר (LME) hydrochloride עד DIV 11 אם תרבויות בהיפוקמפוס נטולות microglia הן רצויות. לאחר דגירת LME, תרבויות בכפופות רועד (300 סל&quot;ד עבור 1 ח) כדי להסיר זיהום microglia. הערה: LME הוא סוכן ציטוטוקסי microglial כי כבר נעשה שימוש נרחב כשיטה לחסל מתרבים microglia 22. </li></ol> 2. OGD / REOX טיפול <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תקשורת לשאוב coverslip המכילה תרבות astrocyte חסידה (DIV 12 - 14) ולשטוף 3 פעמיםעל ידי בעדינות לסובב את המנה תרבות 24 גם מחזיק את coverslip כמה פעמים עם 1 מ&quot;ל איזוטוני OGD פתרון (pH 7.4) המכיל (מ&quot;מ): 0 גלוקוז, 21 NaHCO 3, 120 NaCl, 5.36 KCl, 0.33 Na 2 HPO 4, 0.44 KH 2 PO 4, 1.27 CaCl 2, ו- 0.81 MgSO 4. </li><li style=";text-align:right;direction:rtl"> להוסיף 0.2 מ&quot;ל פתרון OGD כדי גם כדי לכסות את coverslip ו דגירה עבור 2 שעות באינקובטור היפוקסי המכיל 94% N 2, 1% O 2, ו 5% CO 2. לערבב בעדינות עם שייקר מסלולית (50 סל&quot;ד) עבור היפוקסיה 30 דקות של הראשון כדי להקל חילוף הגזים. </li><li style=";text-align:right;direction:rtl"> דגירה לתאי קבוצת normoxic עבור 2 שעות ב 5% CO 2 ו אוויר אטמוספרי חיץ זהה הפתרון OGD למעט תוספת של גלוקוז 5.5 מ&quot;מ. </li><li style=";text-align:right;direction:rtl"> לקבלת REOX, פתרון OGD לשאוב ולהוסיף 2 מ&quot;ל של astrocyte ציפוי בינוני. מדגירים 5% CO 2 ו אוויר אטמוספרי ב 37 מעלות צלזיוס במשך 5 שעות. </li></ol> 3. Immunocytochemical מכתים &lt;/ P&gt; <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לשאוב התקשורת והתרבות בעזרת פיפטה זכוכית סטרילית המצורפת קו ואקום ובמהירות לשטוף coverslip פעם על ידי הוספת 1mL של 0.1 M טריס בופר (TBS) (154 mM NaCl, 16 Base מ&quot;מ Trizma, 84 mM Tris-HCl, pH 7.4) אל הבאר. לשאוב ולהוסיף 2 מ&quot;ל של paraformaldehyde 4% (PFA) ב 1x בופר פוספט (PBS). דגירה במשך 15 דקות ב RT. </li><li style=";text-align:right;direction:rtl"> לשאוב ולהוסיף 1 מ&quot;ל של 0.1 M TBS, ואז למקם על שייקר נדנדה למשך 2 דקות. חזור 3 פעמים. הוסף 1 מ&quot;ל פתרון לחסימת (סרום עיזים 10%, 10 מ&quot;ג / מ&quot;ל ​​BSA, 0.025% Triton X-100 ב 0.1 M TBS) דגירה במשך 30 דקות ב 37 מעלות צלזיוס על שייקר נדנדה. </li><li style=";text-align:right;direction:rtl"> לשאוב פתרון חסימת ולהוסיף נוגדנים נגד GFAP חד שבטיים העכבר העיקרי (0.2 מ&quot;ל של דילול 1: 500 בחסימת פתרון) ארנב polyclonal אנטי-S100B (1: 500) או ארנבת polyclonal אנטי HIF1α (1: 200) למשך 60 דקות ב 37 ° C על שייקר נדנדה. </li><li style=";text-align:right;direction:rtl"> לחילופין, האסטרוציטים כמה מודגרת עם אנטי IBA1 polyclonal ארנב (1: 200) ועכבר monאנטי MAP2 oclonal לגשת טוהר התרבות. </li><li style=";text-align:right;direction:rtl"> לשאוב העיקרי נוגדן ולשטוף coverslip על ידי הוספת 1 מ&quot;ל של 0.1 M TBS והצבת על שייקר נדנדה למשך 2 דקות ואז לשאוב. חזור פעמיים. </li><li style=";text-align:right;direction:rtl"> להוסיף 0.2 מ&quot;ל של דילול 1: 200 של נוגדנים משני עז נגד ארנב 488 מצומדות ואנטי עכבר 568 מצומדות בחסימת פתרון עבור 60 דקות ב 37 מעלות צלזיוס על שייקר נדנדה. </li><li style=";text-align:right;direction:rtl"> לשאוב משני נוגדן ולשטוף coverslip על ידי הוספת 1 מ&quot;ל של 0.1 M TBS ומניחים על שייקר נדנדה למשך 2 דקות ואז לשאוב. חזור פעמיים. </li><li style=";text-align:right;direction:rtl"> הסר coverslip מבאר ויבש ידי הצבת בשקופית ניצב על יבש שקופיות. coverslip הר בשקופית חדשה על ידי היפוך על טיפה אחת של Vectashield hardset הרכבה בינונית עם DAPI (1.5 ng / μL). </li><li style=";text-align:right;direction:rtl"> coverslips תמונה על מיקרוסקופ confocal או באמצעות 20X אובייקטיבי שמן יבש או 60X. לרכוש תמונות (512 x 512) עבור DAPI (לשעבר ננומטר 405/450 ננומטר em) ו fluorochrome 488 מתויג נוגדן GFAP (לשעבר ננומטר 488/515 ננומטרem). שמור פרמטרי רכישה קבועים בתוך 20X ו 60X קבוצות. </li></ol> 4. קביעת מין באמצעות PCR <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הבוהן הגור חום או קטעי האצבע על 95 מעלות צלזיוס למשך 45 דקות ב 50 מ&quot;מ NaOH ולנטרל עם נפח שווה של 1 M טריס, pH 6.8. </li><li style=";text-align:right;direction:rtl"> הוסף 1 μL של פתרון ה- DNA חילוץ 19 μL של התערובת הבאה: 5 pmoles של פריימרים עבור הגנים Myog ו Sry, מאגר התגובה 1x, 0.2 מ&quot;מ כל deoxynucleotide ו -8 פולימראז תקי U. </li><li style=";text-align:right;direction:rtl"> השתמש רצפים פריימרים; Sry 5&#39;TCATGAGACTGCCAACCACAG3 &#39;, 5&#39;CATGACCACCACCACCACCAA3&#39; ו Myog 5&#39;TTACGTCCATCGTGGACAGC3 &#39;, 5&#39;TGGGCTGGGTGTTAGTCTTA3&#39; 23. </li><li style=";text-align:right;direction:rtl"> בצע את פרוטוקול ה- PCR הבא: 95 מעלות צלזיוס במשך 3 דקות ולאחר מכן 30 מחזורים של denaturation על 95 מעלות צלזיוס למשך 15 שניות, חישול ב 58 מעלות צלזיוס למשך 15 שניות, ואת ההתארכות ב 72 מעלות צלזיוס במשך 1 דקות. בעקבות 30 זה מחזורי, התגובה מסכמת עם התארכות C סופית 72 מעלות במשך 1 דקות. </li><li style=";text-align:right;direction:rtl"> PC הנפרדמוצרי R electrophoretically על ג&#39;ל agarose ethidium ברומיד-המכיל 2% ולדמיין תחת תאורת UV. (איור 2 א). זהירות! Ethidium ברומיד הוא קרצינוגן פוטנציאליים חייב להיות מטופל בזהירות מסולק כראוי על פי התקנות של המוסד. </li></ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

אף אחד מהמחברים יש מתחרים או אינטרסים מנוגדים.

על מנת ללמוד את ההבדלים בין המינים במאפייני ותפקוד של האסטרוציטים בתנאים פיזיולוגיים ופתולוגיים, הכנת האסטרוציטים העיקרי חרמנית תרבית תאים הוא כלי חשוב לנצל. במחקר הנוכחי אנו מדווחים יעילים שיטה לשחזור לתרבות אוכלוסיה הומוגנית מועשר של האסטרוציטים בהיפוקמפוס חרמ?...

האסטרוציטים הם אחד משחקני המפתח החשובים ביותר במערכת העצבים המרכזית (CNS). הגוף של ראיות הולכות ומצטברות עולה כי התפקידים של האסטרוציטים הם יותר מאשר לספק תמיכה העצבית. למעשה, את התפקידים של האסטרוציטים בתנאים פיסיולוגיים יכול להיות מאוד מורכב, כמו הדרכת הגירה של אקסונים פיתוח 1, ויסות זרימת הדם CNS 2, שמירה על הומאוסטזיס pH של נוזל ביניים הסינפטי 3, והשתתפות מחסום דם מוח 4 ו -5 בשידור סינפטי. בתנאים פתולוגיים, האסטרוציטים להגיב על פשע עם תהליך הנקרא astrogliosis תגובתי שבו מורפולוגיה, מספר, מיקום, טופוגרפיה (ביחס המרחק בין עלבון) ותפקוד של האסטרוציטים עשויה להשתנות בצורה הטרוגנית 6,7. Astrogliosis לראות הבאים אנצפלופתיה איסכמית בילוד היפוקסי אולי תורם תחלואה ותמותה של ילודים <sעד&gt; 8. מחקרים קליניים וניסויים שנערכו לאחרונה מראים כי חומרת פגיעה מוחית שנראית מין תלוי וכי התינוקות ממין הזכר רגישים יותר להשפעות של היפוקסיה / איסכמיה (HI) פגיעה המוחית -related, וכתוצאה מכך הם מסוגלים נוירולוגים חמורים יותר לעומת נקבות עם נזק מוחי דומה 9-11. למרות הלוקליזציה של הפגיעה תלוי גיל ההריון ואת המשך וחומרת העלבון, ההיפוקמפוס הוא אחד האזורים שיבוצעו הנפוצים ביותר במערכת העצבים המרכזית לאחר תקופת הכהונה בילוד HI, וגדילת astrogliosis בהיפוקמפוס אושר על ידי עד-רגולציה של חלבון חומציים גליה fibrillary (GFAP) 3 ד לאחר HI בילוד 7,10,12,13. הבדלים בין מינים בתפקוד astrocyte הוצגו בשני בילודים ומכרסמים מבוגרים לאחר איסכמיה מוחית 14,15. בנוסף, הרגישות astrocytic זכר לאיסכמיה חוץ גופית הוצגה על ידי cel גדלl למוות בהשוואה האסטרוציטים קליפת המוח הנשי בתרבות 16. ההבדלים בין המינים להתחיל ב-ברחם ולהמשיך עד מוות 17. בעשור האחרון, את החשיבות של כולל המינים בתנאי ניסוי בתרבות התא ב- vivo מחקרים כבר הדגש של המכון לרפואה NIH לחפש ידע בסיסי ב ההבדלים בין המינים לראות בתנאים פיזיולוגיים ופתולוגיים 17,18 . פיתוח שיטות אמינות לבודדים ולשמור אוכלוסיות של האסטרוציטים בהיפוקמפוס חרמנית חיוני להבין את הבסיס התאי של הבדלים בין מיני ההשלכות פתולוגית של HI בילוד. המחקר הנוכחי נועד לספק את הטכניקות להכין תרבויות astrocyte מועשר מין ספציפי בהיפוקמפוס מעכברים היילוד על מנת להעריך את התפקידים של האסטרוציטים GFAP-immunoreactive הבאים חמצן / מניעת גלוקוז (OGD) ו reoxygenation (REOX), גרימתHI בסביבת תרבית תאים. טכניקה זו יכולה לשמש כדי לבחון כל שערה נוגע האסטרוציטים בהיפוקמפוס אצל זכרים ונקבות בילוד בתנאי normoxic ו איסכמי.

<table><tbody><tr><td>&lt;strong&gt;&lt;em&gt;Astrocyte culture media&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM, high glucose</td><td>cellgro</td><td>10-013-CV</td><td></td></tr><tr><td>Horse Serum</td><td>Gibco</td><td>26050-070</td><td>Final Concentration: 10%</td></tr><tr><td>Penicillin-Streptomycin</td><td>Cellgro&amp;nbsp;</td><td>30-002-CI</td><td>Final Concentration: 1%</td></tr><tr><td>L-Leucine methyl ester hydrochloride</td><td>Aldrich</td><td>L1002-25G</td><td>Final Concentration: 5 mM</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Solution for brain tissue digestion&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HBSS</td><td>Life Technologies</td><td>14170-088</td><td></td></tr><tr><td>Trypsin</td><td>cellgro</td><td>25-050-CI</td><td>Final Concentration: 0.25%</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Other&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>70% (vol/vol) ethanol</td><td>Roth</td><td>9065.2</td><td></td></tr><tr><td>Poly-D-Lysine (PDL) 12 mm round coverslips&amp;nbsp;</td><td>Corning</td><td>354087</td><td></td></tr><tr><td>Water</td><td>Sigma</td><td>W3500</td><td>Cell-culture grade</td></tr><tr><td>PBS</td><td>cellgro</td><td>21-040-CV</td><td>Cell-culture grade</td></tr><tr><td>0.05% Trypsin-EDTA&amp;nbsp;</td><td>Life Technologies</td><td>25300-062</td><td></td></tr><tr><td>70 &amp;mu;m Sterile cell strainer&amp;nbsp;</td><td>Fisher scientific</td><td>22363548</td><td></td></tr><tr><td>3.5 cm Petri dish</td><td>BD Falcon</td><td>353001</td><td></td></tr><tr><td>15 mL Falcon tube</td><td>BD Falcon</td><td>352096</td><td></td></tr><tr><td>50 mL Falcon tube</td><td>BD Falcon</td><td>352070</td><td></td></tr><tr><td>Forceps, fine&amp;nbsp;</td><td>Dumont</td><td>2-1032; 2-1033</td><td># 3c; # 5</td></tr><tr><td>Forceps, flat tip</td><td>KLS Martin</td><td>12-120-11</td><td></td></tr><tr><td>13 cm surgical scissors</td><td>Aesculap</td><td>BC-140-R</td><td></td></tr><tr><td>Confocal Microscope</td><td>Nikon</td><td>A1RSi&amp;nbsp;</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5805000.017</td><td>5804R</td></tr><tr><td>Orbital Shaker</td><td>Thermo Scientific</td><td>SHKE 4450-1CE</td><td>MaxQ 4450&amp;nbsp;</td></tr><tr><td>Anti-IBA1</td><td>Wako</td><td>019-19741</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-MAP2</td><td>Sigma</td><td>M2320</td><td>Mouse monoclonal</td></tr><tr><td>Anti-HIF1alpha</td><td>abcam</td><td>ab179483</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-S100B</td><td>Sigma</td><td>HPA015768</td><td>Rabbit polyclonal</td></tr><tr><td>Anti-GFAP (cocktail)</td><td>Biolegend</td><td>837602</td><td></td></tr><tr><td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td><td>Vector Labs</td><td>PK-6101</td><td>Contains 4 Reagents&amp;nbsp;</td></tr><tr><td>Goat Anti Rabbit Alexa-Fluor 488</td><td>Invitrogen</td><td>A11070</td><td></td></tr><tr><td>Goat Anti Mouse Alexa-Fluor 568</td><td>Invitrogen</td><td>A11004</td><td></td></tr></tbody></table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

Astrogliosis הבא היפוקסיה / איסכמיה (HI) פגיעה מוחית -related ממלא תפקיד בתחלואה ותמותה מוגברות בילודים. מחקרים קליניים שנערכו לאחרונה מראים כי חומרת פגיעה מוחית להיראות מין תלותי, וכי התינוקות ממין הזכר רגישים יותר להשפעות של פגיעה מוחית הקשורה HI, וכתוצאה מכך הם מסוגלים נוירולוגים חמורים יותר לעומת נשים עם ניזק מוחי דומה. פיתוח שיטות אמינות לבודד ולשמור אוכלוסיות מועשרות של האסטרוציטים בהיפוקמפוס חרמנית חיוני להבין את הבסיס התאי של הבדלים בין מיני ההשלכות פתולוגית של HI בילוד. במחקר זה, אנו מתארים שיטה ליצירת תרבויות astrocyte מסוימת בהיפוקמפוס מין כי הם נתון מודל של איסכמיה חוץ גופית, מניעת גלוקוז חמצן, ואחריו reoxygenation. astrogliosis תגובתי לאחר נבדק על ידי immunostaiנינג עבור חלבון חומציים גליה fibrillary (GFAP) ו S100B. שיטה זו מספקת כלי שימושי כדי ללמוד את התפקיד של זכר האסטרוציטים בהיפוקמפוס הנקבה הבא HI בילוד, בנפרד.

הבנת התפקידים של פונקציות astrocyte חרמנית בתנאים פיסיולוגיים או pathophysiological כבר הובהר מאוד על ידי culturing תאים אלה בתנאים במבחנה. ההיבט החשוב של ביצוע culturing חרמנית הוא לקבוע את מינו של גור העכבר לפני השימוש בו. אנחנו נקבע את מינו של העכבר גנטי על ידי PCR ?...

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

האסטרוציטים הם אחד משחקני המפתח החשובים ביותר במערכת העצבים המרכזית (CNS). כאן אנו מדווחים על שיטה מעשית של פרוטוקול תרבות astrocyte בהיפוקמפוס חרמנית על מנת ללמוד את המנגנונים העומדים בבסיס תפקוד astrocyte גורים הילוד זכר ונקבה לאחר חוץ גופית איסכמיה.

הבדלים בין המינים עכבר בהיפוקמפוס האסטרוציטים לאחר<em&gt; In-Vitro</em&gt; איסכמיה

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Research

JoVE Journal

Neuroscience

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

13.3K Views.  University of Wisconsin.  האסטרוציטים הם אחד משחקני המפתח החשובים ביותר במערכת העצבים המרכזית (CNS). כאן אנו מדווחים על שיטה מעשית של פרוטוקול תרבות astrocyte בהיפוקמפוס חרמנית על מנת ללמוד את המנגנונים העומדים בבסיס תפקוד astrocyte גורים הילוד זכר ונקבה לאחר חוץ גופית ?...

Video: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

בידוד ותרבות של האסטרוציטים עכבר קליפתיים

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Assessment of Dendritic Arborization in the Dentate Gyrus of the Hippocampal Region in Mice

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity and extent of dendritic arborization correlates well with the synaptic plasticity in these cells. A reliable method for assessment of dendritic arborization is needed to characterize the deleterious effects of neurological disorders on these structures and to determine the effects of therapeutic interventions. However, quantification of these structures has proven to be a formidable task given their complex and dynamic nature. Fortunately, sophisticated imaging techniques can be paired with conventional staining methods to assess the state of dendritic arborization, providing a more reliable and expeditious means of assessment. Below is an example of how these imaging techniques were paired with staining methods to characterize the dendritic arborization in wild type mice. These complementary imaging methods can be used to qualitatively and quantitatively assess dendritic arborization that span a rather wide area within the hippocampal region.

We describe two methods for visualization and quantification of dendritic arborization in the hippocampus of mouse models: real-time and extended depth of field imaging. While the former method allows sophisticated topographical tracing and quantification of the extent of branching, the latter allows speedy visualization of the dendritic tree.

הערכה של דנדריטים arborization ברכס המשונן של האזור בהיפוקמפוס של עכברים

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity ...

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of oxygen and glucose, which causes energy failure and neuronal death. After an ischemic stroke insult, astrocytes become reactive and proliferate around the injury site as it develops. Under this scenario, it is difficult to study the specific contribution of astrocytes to the brain region exposed to ischemia. Therefore, this article introduces a methodology to study primary astrocyte reactivity and proliferation under an in vitro model of an ischemia-like environment, called oxygen glucose deprivation (OGD). Astrocytes were isolated from 1-4 day-old neonatal rats and the number of non-specific astrocytic cells was assessed using astrocyte selective marker Glial Fibrillary Acidic Protein (GFAP) and nuclear staining. The period in which astrocytes are subjected to the OGD condition can be customized, as well as the percentage of oxygen they are exposed to. This flexibility allows scientists to characterize the duration of the ischemic-like condition in different groups of cells in vitro. This article discusses the timeframes of OGD that induce astrocyte reactivity, hypertrophic morphology, and proliferation as measured by immunofluorescence using Proliferating Cell Nuclear Antigen (PCNA). Besides proliferation, astrocytes undergo energy and oxidative stress, and respond to OGD by releasing soluble factors into the cell medium. This medium can be collected and used to analyze the effects of molecules released by astrocytes in primary neuronal cultures without cell-to-cell interaction. In summary, this primary cell culture model can be efficiently used to understand the role of isolated astrocytes upon injury.

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex event in which the specific contribution of astrocytes to the affected brain region exposed to oxygen glucose deprivation (OGD) is difficult to study. This article introduces a methodology to obtain isolated astrocytes and study their reactivity and proliferation under OGD conditions.

ניטור אסטרוציט תגובתיות התפשטות במבחנה בתנאים כמו איסכמי

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of ...

Neurobehavioral Assessments in a Mouse Model of Neonatal Hypoxic-ischemic Brain Injury

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI brain injury by studying neurobehavioral functions in these mice compared to non-operated (i.e., normal) mice. During the study, Rice-Vannucci&#39;s method was used to induce neonatal HI brain damage in postnatal day 7-10 (P7-10) mice. The HI operation was performed on the pups by unilateral carotid artery ligation and exposure to hypoxia (8% O2 and 92% N2 for 90 min). One week after the operation, the damaged brains were evaluated with the naked eye through the semi-transparent skull and were categorized into subgroups based on the absence (&#34;no cortical injury&#34; group) or presence (&#34;cortical injury&#34; group) of cortical injury, such as a lesion in the right hemisphere. On week 6, the following neurobehavioral tests were performed to evaluate the cognitive and motor functions: passive avoidance task (PAT), ladder walking test, and grip strength test. These behavioral tests are helpful in determining the effects of neonatal HI brain injury and are used in other mouse models of neurodegenerative diseases. In this study, neonatal HI brain injury mice showed motor deficits that corresponded to right hemisphere damage. The behavioral test results are relevant to the deficits observed in human neonatal HI patients, such as cerebral palsy or neonatal stroke patients. In this study, a mouse model of neonatal HI brain injury was established and showed different degrees of motor deficits and cognitive impairment compared to non-operated mice. This work provides basic information on the HI mouse model. MRI images demonstrate the different phenotypes, separated according to the severity of brain damage by motor and cognitive tests.

We performed unilateral carotid artery occlusion on postnatal day 7-10 CD-1 mouse pups to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of HI brain injury. We studied neurobehavioral functions in these mice compared to non-operated normal mice.

Neurobehavioral הערכות במודל של עכברים של פגיעה מוחית לפציעה Hypoxic-איסכמי Neonatal

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI ...

Ex Vivo Pressurized Hippocampal Capillary-Parenchymal Arteriole Preparation for Functional Study

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and cardiac arrest are remarkably sexually dimorphic diseases, and both induce cerebral ischemia. However, progress in understanding the vascular cognitive impairment, and then developing sex-specific treatments, has been partly limited by challenges in investigating the brain microcirculation from mouse models in functional studies. Here, we present an approach to examine the capillary-to-arteriole signaling in an ex vivo hippocampal capillary-parenchymal arteriole (HiCaPA) preparation from mouse brain. We describe how to isolate, cannulate, and pressurize the microcirculation to measure arteriolar diameter in response to capillary stimulation. We show which appropriate functional controls can be used to validate the HiCaPA preparation integrity and display typical results, including testing potassium as a neurovascular coupling agent and the effect of the recently characterized inhibitor of the Kir2 inward rectifying potassium channel family, ML133. Further, we compare the responses in preparations obtained from male and female mice. While these data reflect functional investigations, our approach can also be used in molecular biology, immunochemistry, and electrophysiology studies.

The present manuscript details how to isolate hippocampal arterioles and capillaries from the mouse brain and how to pressurize them for pressure myography, immunofluorescence, biochemistry, and molecular studies.

Vivo לשעבר היפוקמאלקפיאל Arteriole הכנה למחקר פונקציונלי

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and ...

A Cell Culture Model for Studying the Role of Neuron-Glia Interactions in Ischemia

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent neuronal loss. Numerous evidence suggests that the interaction between glial and neuronal cells exert beneficial effects after an ischemic event. Therefore, to explore potential protective mechanisms, it is important to develop models that allow studying neuron-glia interactions in an ischemic environment. Herein we present a simple approach to isolate astrocytes and neurons from the rat embryonic cortex, and that by using specific culture media, allows the establishment of neuron- or astrocyte-enriched cultures or neuron-glia cultures with high yield and reproducibility.
To study the crosstalk between astrocytes and neurons, we propose an approach based on a co-culture system in which neurons cultured in coverslips are maintained in contact with a monolayer of astrocytes plated in multiwell plates. The two cultures are maintained apart by small paraffin spheres. This approach allows the independent manipulation and the application of specific treatments to each cell type, which represents an advantage in many studies.
To simulate what occurs during an ischemic stroke, the cultures are subjected to an oxygen and glucose deprivation protocol. This protocol represents a useful tool to study the role of neuron-glia interactions in ischemic stroke.

Here, we present a simple approach using specific culture media that allows the establishment of neuron- and astrocyte-enriched cultures, or neuron-glia cultures from the embryonic cortex, with high yield and reproducibility.

מודל תרבות תא לחקר התפקיד של אינטראקציות נוירון-גליה באיסכמיה

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent ...

Analysis of Astrocyte Territory Volume and Tiling in Thick Free-Floating Tissue Sections

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the brain. Through these interactions, astrocytes actively regulate many critical brain functions, including synapse formation, neurotransmission, and ion homeostasis. In the rodent brain, astrocytes grow in size and complexity during the first three postnatal weeks and establish distinct, non-overlapping territories to tile the brain. This protocol provides an established method for analyzing astrocyte territory volume and astrocyte tiling using free-floating tissue sections from the mouse brain. First, this protocol describes the steps for tissue collection, cryosectioning, and immunostaining of free-floating tissue sections. Second, this protocol describes image acquisition and analysis of astrocyte territory volume and territory overlap volume, using commercially available image analysis software. Lastly, this manuscript discusses the advantages, important considerations, common pitfalls, and limitations of these methods. This protocol requires brain tissue with sparse or mosaic fluorescent labeling of astrocytes, and is designed to be used with common lab equipment, confocal microscopy, and commercially available image analysis software.

This protocol describes methods for sectioning, staining, and imaging free-floating tissue sections of the mouse brain, followed by a detailed description of the analysis of astrocyte territory volume and astrocyte territory overlap or tiling.

ניתוח נפח טריטוריית אסטרוציטים וריצוף בקטעי רקמה עבים שצפים בחופשיות

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the ...

חסימה של עורק אמצעי דיסטלי לפיתוח מודל עכבר שבץ איסכמי

Induction of Acute Ischemic Stroke in Mice Using the Distal Middle Artery Occlusion Technique

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic stroke patients are eligible to receive intravascular thrombolysis or mechanical thrombectomy therapy within the optimal time window. Among those stroke survivors, around two-thirds suffer neurological dysfunctions over an extended period. Establishing a stable and repeatable experimental ischemic stroke model is extremely significant for further investigating the pathophysiological mechanisms and developing effective therapeutic strategies for ischemic stroke. The middle cerebral artery (MCA) represents the predominant location of ischemic stroke in humans, with the MCA occlusion serving as the frequently employed model of focal cerebral ischemia. In this protocol, we describe the methodology of establishing the distal MCA occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6 mice. Since the occlusion site is located at the cortical branch of MCA, this model generates a moderate infarcted lesion restricted to the cortex. Neurological behavioral and histopathological characterization have demonstrated visible motor dysfunction, neuron degeneration, and pronounced activation of microglia and astrocytes in this model. Thus, this dMCAO mouse model provides a valuable tool for investigating the ischemiastroke and worth of popularization.

זרקור על המחבר: ביסוס מודל חסימה דיסטלי אמין של MCA בעכברים לחקר שבץ מוחי

Here, we present a protocol to establish a distal middle cerebral artery occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6J mice and evaluate the subsequent neurological behavior and histopathological features.

השראת שבץ איסכמי חריף בעכברים באמצעות טכניקת חסימת העורק האמצעי הדיסטלי

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic ...

הבדלים בין המינים עכבר בהיפוקמפוס האסטרוציטים לאחר

Summary

Explore More Videos

Chapters in this video

בידוד ותרבות של האסטרוציטים עכבר קליפתיים

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

הערכה של דנדריטים arborization ברכס המשונן של האזור בהיפוקמפוס של עכברים

ניטור אסטרוציט תגובתיות התפשטות במבחנה בתנאים כמו איסכמי

Neurobehavioral הערכות במודל של עכברים של פגיעה מוחית לפציעה Hypoxic-איסכמי Neonatal

Vivo לשעבר היפוקמאלקפיאל Arteriole הכנה למחקר פונקציונלי

מודל תרבות תא לחקר התפקיד של אינטראקציות נוירון-גליה באיסכמיה

ניתוח נפח טריטוריית אסטרוציטים וריצוף בקטעי רקמה עבים שצפים בחופשיות

השראת שבץ איסכמי חריף בעכברים באמצעות טכניקת חסימת העורק האמצעי הדיסטלי

השראת שבץ איסכמי חריף בעכברים באמצעות טכניקת חסימת העורק האמצעי הדיסטלי