We are grateful to the technical support from Ms. Hong Xian Hsing, Mr. Min Jeng Li, and Mr. Eric C. P. Wu. We express our appreciation to Miranda Loney for English editing.

<ol>
	<li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> Cold Spring Harb Protoc. 3, 1-2 (2008).</li><li>Knox, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Freeze-sectioning+of+plant+tissues.">Freeze-sectioning of plant tissues.</a> Stain Technol. 45, 265-272 (1970).</li><li>Ruan, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+cryosection+method+for+polyethylene+glycol+hydrogels+used+in+tissue+engineering.">An improved cryosection method for polyethylene glycol hydrogels used in tissue engineering.</a> Tissue Eng.: Part C Methods. 19, 794-801 (2013).</li><li>Prychid, C. J., Rudall, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+oxalate+crystals+in+monocotyledons:+A+review+of+their+structure+and+systematics.">Calcium oxalate crystals in monocotyledons: A review of their structure and systematics.</a> Ann Bot. 84, 725-739 (1999).</li><li>Prychid, C. J., Rudall, P. J., Gregory, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematics+and+biology+of+silica+bodies+in+monocotyledons.">Systematics and biology of silica bodies in monocotyledons.</a> Bot. Rev. 69 (4), 377-440 (2004).</li><li>Arnott, H. J., Pautard, F. G. E., Steinfink, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+calcium+oxalate+monohydrate.">Structure of calcium oxalate monohydrate.</a> Nature. 208, 1197-1198 (1965).</li><li>Mitani, N., Yamaji, N., Ma, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+maize+silicon+influx+transporters.">Identification of maize silicon influx transporters.</a> Plant Cell Physiol. 50, 5-12 (2009).</li><li>Hayasaka, T., Fujii, H., Ishiguro, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+silicon+in+preventing+appressorial+penetration+by+the+rice+blast+fungus.">The role of silicon in preventing appressorial penetration by the rice blast fungus.</a> Phytopathology. 98, 1038-1044 (2008).</li><li>Ma, J. F., Yamaji, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+uptake+and+accumulation+in+higher+plants.">Silicon uptake and accumulation in higher plants.</a> Trends Plant Sci. 11, 392-397 (2006).</li><li>Chen, W., Tang, C., YL, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ploidy+doubling+by+in+vitro+culture+of+excised+protocorms+or+protocorm-like+bodies+in+Phalaenopsis+species.">Ploidy doubling by in vitro culture of excised protocorms or protocorm-like bodies in Phalaenopsis species.</a> Plant Cell Tiss Org. 98, 229-239 (2009).</li><li>Javelle, M., Marco, C. F., Timmermans, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Situ+Hybridization+for+the+Precise+Localization+of+Transcripts+in+Plants.">In Situ Hybridization for the Precise Localization of Transcripts in Plants.</a> J. Vis. Exp. (57), e3328 (2011).</li><li>Park, D. J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+Protocols.">PCR Protocols.</a> Methods in Molecular Biology. 687, (2011).</li><li>Lin, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+annotation,+expression+profiling,+and+protein+interaction+studies+of+the+core+cell-cycle+genes+in+Phalaenopsis+aphrodite.">Genome-wide annotation, expression profiling, and protein interaction studies of the core cell-cycle genes in Phalaenopsis aphrodite.</a> Plant Mol Biol. 84, 203-226 (2014).</li><li>Lee, Y. -. I., Yeung, E. C., Lee, N., Chung, M. -. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryology+of+Phalaenopsis+amabilis+var.+formosa:+embryo+development.">Embryology of Phalaenopsis amabilis var. formosa: embryo development.</a> Bot Stud. 49, 139-146 (2008).</li><li>Endo, M., Ikusima, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diurnal+rhythm+and+characteristics+of+photosynthesis+and+respiration+in+the+leaf+and+root+of+a+Phalaenopsis+plant.">Diurnal rhythm and characteristics of photosynthesis and respiration in the leaf and root of a Phalaenopsis plant.</a> Plant Cell Physiol. 30, 43-47 (1989).</li><li>Guo, W. J., Lee, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+leaf+and+plant+age,+and+day/night+temperature+on+net+CO2+uptake+in+Phalaenopsis+amabilis+var.+formosa.">Effect of leaf and plant age, and day/night temperature on net CO2 uptake in Phalaenopsis amabilis var. formosa.</a> J. Amer. Soc. Hort. Sci. 131, 320-326 (2006).</li><li>Lewin, J., Reimann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+and+plant+growth.">Silicon and plant growth.</a> Ann. Rev. of Plant Physiol. 20, 289-304 (1969).</li><li>Kaufman, P. B., Simpson, T. L., Valcani, B. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silica+in+shoots+of+higher+plants.">Silica in shoots of higher plants.</a> Silicon and siliceous structures in biological systems. , 409-449 (1981).</li><li>Lundgren, M. R., Osborne, C. P., Christin, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deconstructing+Kranz+anatomy+to+understand+C4+evolution.">Deconstructing Kranz anatomy to understand C4 evolution.</a> J Exp Bot. 65, 3357-3369 (2014).</li><li>Liu, W. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anatomical+and+transcriptional+dynamics+of+maize+embryonic+leaves+during+seed+germination.">Anatomical and transcriptional dynamics of maize embryonic leaves during seed germination.</a> Proc Natl Acad Sci U S A. 110, 3979-3984 (2013).</li><li>Driscoll, S. P., Prins, A., Olmos, E., Kunert, K. J., Foyer, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specification+of+adaxial+and+abaxial+stomata,+epidermal+structure+and+photosynthesis+to+CO2+enrichment+in+maize+leaves.">Specification of adaxial and abaxial stomata, epidermal structure and photosynthesis to CO2 enrichment in maize leaves.</a> J Exp Bot. 57, 381-390 (2006).</li><li>Karlgren, A., Carlsson, J., Gyllenstrand, N., Lagercrantz, U., Sundstr&#246;m, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-radioactive+in+situ+Hybridization+Protocol+Applicable+for+Norway+Spruce+and+a+Range+of+Plant+Species.">Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species.</a> J. Vis. Exp. (26), (2009).</li><li>Hejatko, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+technique+for+mRNA+detection+in+whole+mount+Arabidopsis+samples.">In situ hybridization technique for mRNA detection in whole mount Arabidopsis samples.</a> Nat Protoc. 1, 1939-1946 (2006).</li><li>Javelle, M., Timmermans, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+localization+of+small+RNAs+in+plants+by+using+LNA+probes.">In situ localization of small RNAs in plants by using LNA probes.</a> Nat Protoc. 7, 533-541 (2012).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+analysis+of+gene+expression+in+plants.">In situ analysis of gene expression in plants.</a> Methods Mol Biol. 513, 229-242 (2009).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+method+for+systematic,+high+resolution+in+situ+analysis+of+mRNA+distribution+in+plants.">A streamlined method for systematic, high resolution in situ analysis of mRNA distribution in plants.</a> Plant Methods. 1, 8 (2005).</li></ol>

No conflicts of interest declared.

יש צמחי תאים קירות תא נוקשים, סיבים קשים, קריסטלים, ואת תכולת מים גבוהה כי לגרום לבעיות קריעת רקמות במהלך חתך רקמות צמח. למרות חתך מבוסס פרפין משמש לעתים קרובות עבור רקמות צמח, את הגבישים אנדוגני לעתים קרובות לקרוע את רקמת הצמח במהלך החתך (איור 1). בגלל תכולת מי מטבעם הגבוה בתוך בתאי הצמח, חתך מבוסס cryostat לעתים קרובות גורם לתאי שבור וחתכי רקמות סדוקים. במחקר הנוכחי, פרוטוקול פרפין הטבעה ו cryosection בשילוב בשם Hybrid-Cut פותח וקטעי רקמה באיכות טובות התקבלו. פרוטוקול זה פותר את הבעיה קשורה תכולת מים גבוהה על ידי החדרת הטבעת פרפין, ומצמצם את אפקט הקריעה על ידי הקשחת פראפין תחת בטמפרטורה נמוכה במהלך החתך (איור 3). לכן, פרוטוקול שונה זו יש יתרון על פני משני sectio פרפין המבוססנינג או Cryosectioning עבור שמירה על שלמות רקמות הצמח. כתב יד זה מדגים כי השיטה ההיברידית-Cut משמר שלמות רקמות ברקמות רבות של סחלב Phalaenopsis כגון ניצן השחי, זרע, ו PLB, וכו &#39;המכילות רמות גבוהות של גבישים (איורים 3-4). יתר על כן, פרוטוקול זה ניתן פלח כגון איברי רבייה ועלים של אורז, תירס, חיטה המכילים סיליקה גבוהה (איורים 5-6). יש להניח, פרוטוקול זה ניתן להחיל את וודי צמחים המכילים סיבים תזונתיים גבוהים. באופן כללי, רקמת תיקון ביסודיות חשובה מאוד על Cut ההיברידי. מצאנו כי חומצת פורמלדהיד-חומצי-אלכוהול (FAA) מקבע עדיף PFA כדי לשמור על שלמות הרקמה של רקמות סרבניות מסוימות כגון בלוטות axially, שורשים, וכו &#39;עם זאת, PFA עובד טוב יותר מאשר ה- FAA בשימור שלמות RNA. לכן PFA מומלץ לתקןמדגם עבור כלאה באתרו (שאני עורך) עבודה. הפרוטוקול המתואר כאן נועד לניסוי RNA שאני עורך. לכן, כל ריאגנטים הוכנו כדי למנוע השפלה RNA על ידי ביטול זיהום RNase ידי טיפול DEPC. אם סעיף Hybrid-Cut הוא ללימודי אנטומיים, אוסמוזה ההפוכה רגילים (RO) מי חיץ הנגזרות שלה או ריאגנטים כשרים. צמצום דגימת גודל ועובי כדי פחות מ -3 מ&quot;מ מועיל עבור חדירה. יתר על כן, זמן טבילה גובר התייבשות וחדירה נחוץ רקמות מרקם קשות. הגבלת פרוטוקול זה עלולה עקב בעיות שנגרמות על ידי קיבעון לקוי, התייבשות, וחדירה של דגימה. לכן, התאים זמן עיבוד בכל צעד קריטי לייצר בלוק פרפין באיכות טובה. בדרך כלל, רקמה קשה צריכה עוד זמן עיבוד מאשר רקמה רכה. בנוסף, הראינו כי Hybrid-Cut עבד בהצלחה wi שילובשאני עורך ה לספק פריסה המרחבית של התמלילים שנבחרו (איור 7). לסיכום, פרוטוקול זה שימושי לחקר אנטומיה של צמח ומספק מפת RNA ספציפי רקמות של הגנים הנבחרים. בנוסף הוא עשוי להיות מיושם על מחקרים מולקולריים אחרים כגון תיוג סוף מסוף deoxynucleotidyl transferase dUTP ניק (TUNEL) assay, הקרינה הכלאה באתרו (FISH), וטכניקות immunostaining. לסיכום, פרוטוקול חתך רקמות משופר זו הוא גם שימושי ומועיל לחוקרים בקהילות צמח.

שיטת החתך מבוסס פרפין היא טכניקה בשימוש נרחבת עבור מחקרים אנטומיים. שימור האנטומיה רקמות שלמות חשוב ללימודי מורפולוגיים וביולוגיים. הטכניקה חתכה-מוטבע פרפין יש יתרון משום-הטבעת פרפין שומרת מורפולוגיה תאים ורקמות. בנוסף, בלוקי פרפין ניתן לאחסן בנוחות לתקופות זמן ארוכות. עם זאת, חתך-מוטבע פרפין אינו מתאים רקמות הצמח המכיל גבישי תאיים. קריסטלים בתוך התאים לעתים קרובות לקרוע סרטים פרפין שלמות רקמות נזק במהלך חתך. בניגוד חתך פרפין, cryosectioning הוא מהיר יחסית וחתכים ניתן להשיג ללא קיבוע, התייבשות סדרתי או הטבעה חדירה 1 בינוני. Cryosections תואם יישומים רבים כגון אימונוהיסטוכימיה, כלאה באתרו, ואנזים היסטוכימיה. היתרון השני של cryosectioning הואהשיטה זו אינה עוברת תהליכי denaturation פוטנציאל כגון טמפרטורה גבוהה טיפולים כימיים, כך מולקולות הסלולר נשמרות היטב בתוך קטעי הרקמה 2. Cryosectioning מעדיף בדרך כלל מעל מבוססי פרפין חתך ללימודים ברקמות בעלי חיים. עם זאת, cryosectioning הוא לא הבחירה הראשונה בצמחים כי טמפרטורה מקפיאה לפעמים גורם להיווצרות גבישי קרח המשפיעים על איכות שלמות סעיף. למרות ויסות האוסמוטי כגון פתרונות סוכרוז, פוליאתילן גליקול (PEG), או גליצרול 3 דווחה להפחית היווצרות קרח קריסטל בתנאי הקפאה, השיפור רחוק מלהיות אופטימלי. כדי להסתגל לסביבות שונות, צמחים שונים יש לעתים קרובות תאי מרקם צמח רקמות ברורים התפתחו כדי ליצור קירות תא נוקשים, סיבים קשים, וקריסטלים 4,5. לדוגמא, גבישים אוקסלט מסיסים וגופים סיליקה הם די נפוציםצמחים 6. גופי סיליקט / דווחו גבישים כדי לסייע לשמור על אדריכלות צמח, תְמִירוּת, ולמנוע מחלות או מזיקים בצמחי דגנים 7-9. הסחלבים בעציץ וחותך-הפרח בשוק הסחלב פורח וזה ענף צומח. אפרודיטה Phalaenopsis (סחלב עש) היא אחד צמחי נוי יצוא החשובים ביותר בטייוואן. במאמצים משמעותיים נעשו כדי להבין את השינויים מורפולוגיים פיסיולוגיים של התהליכים הפורחים סחלבי Phalaenopsis. קוצים פרחוניים של סחלבי Phalaenopsis יזומים מן ניצני בית השחי בבסיס עלה. לאחר תקופה של טמפרטורת סביבה מגניבה (כ אחת וחצי חודשים), בלוטות בית השחי להגדלה, לשבור תרדמת, ו לבלוט מהבסיס עלה להתפתח קוצים פרחוניים צעירים. כדי להבין את פיזיולוגיים, הסלולר, ותהליכים מולקולריים חניכת ספייק, זה הכרחי כדי לפתח טכניקת אנטומיים חזקה כדי visuaרקמות או סמנים Lize מבעוד מועד. עם זאת, הנוכחות של גבישים בכל מקום ברקמות סחלב, במיוחד ניצני בית השחי, עושה עבודה אנטומיים קשה. כאן אנו בקשנו לשפר שלמות סעיף של רקמות צמח סרבניות כי כבר ראו עד כה מאתגר מבחינה טכנית. כאן אנו מציגים פרוטוקול משופר בשם Hybrid-Cut. זוהי שיטת חתך מבוסס פרפין כי מתבצעת באמצעות cryostat. הטבעת פרפין פותר תכולת מים גבוהה ברקמות צמח. חתך מתחת לטמפרטורה נמוכה מקשה את בלוק פרפין, מפחית קריסטל קורע בעיה, ומשפר שלמות רקמות משמעותית. פרוטוקול זה משפר שלמות רקמות משמעותית עבור דגימות צמח סרבניות.

<table><tbody><tr><td>Embedding Center model EC780-1</td><td>CSA</td><td></td><td></td></tr><tr><td>Microtome model RM2255</td><td>Leica</td><td></td><td></td></tr><tr><td>Cryostat model CM 1950</td><td>Leica</td><td></td><td></td></tr><tr><td>Axio Scope A1 microscope&amp;nbsp;</td><td>Zeiss</td><td></td><td></td></tr><tr><td>Murashige &amp;amp; Skoog medium including vitamins</td><td>Duchefa Biochemia</td><td>M0222.0050</td><td></td></tr><tr><td>RNase free surface decontaminant</td><td>Apex</td><td>10-228</td><td></td></tr><tr><td>Diethyl pyrocarbonate (DEPC)</td><td>Bio Basic Inc.&amp;nbsp;</td><td>D801154</td><td></td></tr><tr><td>Sodium chloride (NaCl)</td><td>MDBio, Inc.</td><td>101-7647-14-5</td><td></td></tr><tr><td>Potassium chloride, crystal (KCl)</td><td>J.T. Baker</td><td>7447-40-7</td><td></td></tr><tr><td>Sodium phosphate dibasic (Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>7558-79-4</td><td></td></tr><tr><td>Potassium phosphate monobasic (KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>7778-77-0</td><td></td></tr><tr><td>Paraformaldehyde (PFA)</td><td>Sigma-Aldrich</td><td>16005</td><td></td></tr><tr><td>Sodium hydroxide (NaOH)</td><td>Showa</td><td>19430160</td><td></td></tr><tr><td>Sulfuric acid (H&lt;sub&gt;2&lt;/sub&gt;SO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Sigma-Aldrich</td><td>7664-93-9</td><td></td></tr><tr><td>Glutaraldehyde solution</td><td>Sigma-Aldrich</td><td>111-30-8</td><td></td></tr><tr><td>Polyoxyethylene 20 sorbitan monolaurate (Tween 20)</td><td>J.T. Baker</td><td>9005-64-5</td><td></td></tr><tr><td>Octyl Phenol Ethoxylate (Triton X100)</td><td>J.T. Baker</td><td>9002-93-1</td><td></td></tr><tr><td>Glass scintillation vials</td><td>Newastar</td><td>DG60805-00020</td><td></td></tr><tr><td>Desiccator vacuum</td><td>Violet Bioscience Inc.</td><td>TS-402030</td><td></td></tr><tr><td>Rotary vane pump RZ2.5</td><td>Vacuubrand</td><td>36149406</td><td></td></tr><tr><td>Ethanol</td><td>J.T. Baker</td><td>64-17-5</td><td></td></tr><tr><td>Sub-X&amp;nbsp;</td><td>Leica Surgipath</td><td>3803670</td><td>Xylene substitute</td></tr><tr><td>Paraplast Plus&amp;nbsp;</td><td>Leica Surgipath</td><td>39602004</td><td>Tissue embedding paraffin</td></tr><tr><td>SUPERFROST micro slide glass</td><td>Matsunami</td><td>S7441</td><td></td></tr><tr><td>FSC 22 Clear&amp;nbsp;</td><td>Leica Surgipath</td><td>3801480</td><td>Optimal Cutting Temperature compound (OCT)&amp;nbsp;</td></tr><tr><td>Xylenes, Purified</td><td>Leica Surgipath</td><td>3803665</td><td></td></tr><tr><td>Hematoxylin</td><td>Merck</td><td>HX305311</td><td></td></tr><tr><td>Hydrochloric acid (HCl)</td><td>Sigma-Aldrich</td><td>7647-01-0</td><td></td></tr><tr><td>Micromount</td><td>Leica Surgipath</td><td>3801731</td><td>Mounting medium</td></tr><tr><td>pGEM T-easy vector</td><td>Promega</td><td>A1360</td><td></td></tr><tr><td>Proteinase K</td><td>Roche</td><td>3115879001</td><td></td></tr><tr><td>SP6/T7 DIG RNA Labeling Kit</td><td>Roche</td><td>11175025910</td><td></td></tr><tr><td>NBT/BCIP stock solution</td><td>Roche</td><td>11681451001</td><td></td></tr></tbody></table>

hybrid-cut: an improved sectioning method for recalcitrant plant tissue samples

סעיף צמח שמירה על שלמות חיונית ללימוד מבנים אנטומיים מפורטים על הסלולר, הרקמות, או אפילו ברמת איברים. עם זאת, תאים ולשתול יש קירות תא נוקשים, סיבים קשים וקריסטלים (סידן אוקסלט, סיליקה, וכו &#39;), ואת תכולת מים גבוהה כי לעתים קרובות לשבש שלמות רקמות במהלך חתך רקמות הצמח. מחקר זה קובע שיטת חתך רקמות פשוט חותך-היברידיות. פרוטוקול זה משנה טכניקת חתך מבוסס פרפין משפר את שלמות סעיפי רקמות מצמחים שונים. רקמות צמח היו מוטבעות פרפין לפני החתך בתוך cryostat ב C -16 °. חתך מתחת לטמפרטורה נמוכה מוקשה האבנית פרפין, קריעה מופחתת מגרדת, שלמות רקמות השתפרה משמעותית. פרוטוקול זה יושם בהצלחה לרקמות סחלב Phalaenopsis עשירי סידן אוקסלט וכן רקמות סרבניות כגון orga רבייהns ועלים של אורז, תירס, חיטה. בנוסף, באיכות גבוהה של קטעי רקמה מן-Cut היברידי יכול לשמש בשילוב עם הכלאה באתרו (שאני עורך) כדי לספק דפוסי הביטוי המרחבי של הגנים של עניין. לסיכום, פרוטוקול זה שימושי במיוחד עבור רקמות צמח סרבניות המכילות תוכן קריסטל או סיליקה גבוה. איכות טובה סעיפי רקמות לאפשר מחקרים ביולוגיים מורפולוגיים אחרים.

Hybrid-Cut משפרת את שלמות סעיפי רקמות הבנת האנטומיה של המבנה הפרחוני הרבייה חשובה על חקירת המנגנון הבסיסי של חניכת פרחי סחלבים. עם זאת, הצטברות של גבישי אוקסלט תאיים סחלבים Phalaenopsis עושה מחקרים כאלה משימה מאתגרת. כדי לעקוף את הבעיות הקשורות קריעה הנגרמת על ידי גבישים במהלך תהליך חתך (איור 1), פיתחנו מערכת והענקנו Hybrid-Cut. פרוטוקול זה משלב טכניקות הטבעת פרפין מסורתיות cryosection. ראשון בדקנו Hybrid-חותך ניצני בית השחי של סחלב Phalaenopsis כי הם ידועים לשמצה קשיחה רקמות ותוכן קריסטל גבוה. רקמת ניצן השחי נקבעה 4% PFA (ראה פרוטוקול, צעד 1.3). לאחר התייבשות אתנול סדרה ואני שעוות פרפיןnfiltration, באיבו בבית השחי ננעץ בלוק פרפין. הבלוק היה מטופח עד לגודל מתאים לפני החתך (איור 2 א). כמות קטנה של אוקטובר יושמה אז למרכז הבמה cryostat (איור 2 ב). בלוק פרפין אז דבק הבמה באמצעות OCT. הבמה הייתה מודגרות cryostat במשך 10 דקות כדי לאפשר התמצקות מלאה של אוקטובר לפני חתך (איור 2 ג) ולאחר מכן cryosection בוצעה בתוך -16 תא ° C (איור 2 ד). לשם השוואה, בלוק פרפין המכיל ניצן השחי של סחלב Phalaenopsis היה נתון חתך microtome קבוע. כפי שניתן לראות בתרשים 1 א &#39;, קריעה חמורה של סרטי פרפין נצפתה לאחר חתך microtome. שלמות רקמות המבנה התאי נפגע גם (איור 1B). Hybrid-Cut, ומצד שני,סעיפי רקמות ללא פגע פיק (איור 3 א) עם שלמות מבנית השתמרה (האיור 3B). יישום של Hybrid-גזור רקמות שונות של פ אַפְרוֹדִיטָה כדי להמשיך לבדוק רמת המוכנות של-Cut היברידי, בדקנו רקמות שונות של סחלבים Phalaenopsis. היא לעתים קרובות קשה להשיג חלקים של זרעים עם שלמות רקמות טובה בגלל מעטת הזרע הקשוחה. שימוש בפרוטוקול זה, מבנים מפורטים של זרעים נשתמרו לאחר החתך (איור 4 א). כפי שניתן לראות בתרשים 4A, גופים חלבון, מוצרי אחסון משותף 14, ניתן היה לזהות בבירור. Hybrid-Cut גם עבד בהצלחה והראה המבנים המפורטים של meristem פסגת לירות של protocorm הישן של חודש אחד (המבנה ניבט מזרע) (איור 4 ב) וprotocorm כמו- גופים (PLBs, איור 4C). הגבישים תאיים נצפו קטעי PLB. סחלבים Phalaenopsis יש עלים עבים ועסיסיים, והם מבצעים מטבוליזם של חומצת הטבוריתיים (CAM) -type הפוטוסינתזה 15. הסעיף הרוחבי של להב עלה הראה תאי mesophyll גדולים חבילות וסקולרית המכיל עצה ואת השיפה (איור 4D). פתחי הפיוניות מעטים נצפו על פני העלה abaxial בשעות היום (4D איור). למעשה, צמחי CAM התפתחו על מנת למקסם רווח פחמן אך בו זמנית להקטין את איבוד מים על ידי פתיחת stomates שלהם בלילה בתנאים צחיחים 15,16. Meristem פסגת שורש פ אפרודיטה מוצגת באיור 4E. תאי קצה השורש הופיעו להכיל מספר לא מבוטל של גבישים, אשר מאוד השתמרו היטב לאחר החתך (4E איור). סעיפים אורכים של קוצים פרחוניים צעירים היוו אינפורמטיון על הארכיטקטורה של primordials הפרחוני הצעיר (איור 4F). יתר על כן, עלי גביע, עלי כותרת, שפית, ו pollinia ניתן היה לזהות בבירור ממדור האורך של ניצני פרחים צעירים שסיימו בידול זה 5 מ&quot;מ ניצן של פרח (איור 4G). שים לב כי גבישים שנצברו עליי הגביע של בלוטות פרחוניות צעירות. בקיצור, פרוטוקול זה עובד באופן עקבי כדי לשמור על שלמות רקמות מייצר מורפולוגיה שלמה המאפשר מחקרים הסלולר אנטומיים והאפשריים. Hybrid-Cut שומר שלמות רקמות ב פלח גם בדקנו Hybrid-גזור על פלחה כגון אורז, חיטה ותירס המכילים תוכן סיליקה גבוהה 17,18. כפי שניתן לראות בתרשים 5, על שלמות רקמות סעיפים הרוחביים של אורז, חיטה, תירס ועלים שופרה באופן משמעותי על ידי Hy<html> Brid-Cut השיטה. העצה, השיפה, תאי mesophyll, stomates, ותאי bulliform שולט מתגלגל של הלהב עלה כדי למנוע אובדן מים זוהו בבירור ממקטעים של עלים אורזים. האנטומיה קרנץ, תאי mesophyll, וצרורות כלי דם של עלה התירס 19,20 זוהו בבירור. זה היה מסקרן למצוא צפיפות גבוהה של stomates משני צדדי adaxial ו abaxial עלי תירס (איור 5). יחס הפיוניות adaxial ו abaxial של 0.7 תירס דווח בעבר 21. בנוסף, פרוטוקול זה גם עבד בהצלחה לספק את מורפולוגיה התא המפורטת של spikelets מאורז, חיטה, תירס (איור 6). Spikelets ידוע מכיל סיליקה 9 בשפע. בדרך כלל, דבר גורם קושי בקיום חתך רקמות. ב הכלאה באתרה = &quot;1&quot;&gt; הגנום וגישות transcriptomic משמשים כדי ויסמנו את הפונקציות של גנים. מתן פריסה המרחבית של תמלילי הגנים של עניין בהקשרים התפתחותיים או סביבתיים חשוב להוסיף תובנה חדשה הפונקציות האפשריות של הגנים. In-situ כלאה (שאני עורך) פותח כדי למקם דפוסי ביטוי גנים ברמת הרקמה 11, 22-25. בנוסף, שאני עורך יכול לספק הסלולר, ובמקרים מסוימים משנה הסלולר, ברזולוציה של הפצת mRNA באורגניזמים רב-תאי 26. במהלך שאני עורך, רנ&quot;א שלם רקמות הוא חיוני כדי להשיג מידע מרחבים אמין על התמליל שנבחר. בדקנו שאני עורך באמצעות פרוטוקול היברידי-Cut הגן אקטין (PATC157348) שובט באמצעות פריימרים 5&#39;-GGCAGAGTATGATGAATCTGGTCC-3 &#39;ו 5&#39;- AGGACAGAAGTTCGGCTGGC -3&#39; כדי לקבל amplicon 242 נ&quot;ב PCR B1 Cyclin:.. 1 (PATC146999) גן ספציפי רצף קידוד פריימרים באמצעות 5&#39;-TCGTAGCAAGGTTGCTTGTG-3 &#39;ו 5&#39;- ATGAGCATGGCGCTAATACC-3&#39; כדי לקבל 327 נ&quot;ב amplicon PCR. אחרי שאני עורך, אקטין Cyclin B1: ביטוי גנים 1 היה פיקוח ב ניצני בית השחי צעירים בוגרים (איור 7). גני שניהם באו לידי ביטוי בתאי meristematic של 2 nd ו -3 ניצני rd השחי, עם זוהו אותות חזקים ב 3 rd ניצני בית השחי. תוצאות אלו הראו כי Hybrid-Cut לשמור האנטומיה טובה ולספק דפוס ביטוי גנים מרחבית. <img alt="איור 1" src="/files/ftp_upload/54754/54754fig1.jpg" /> איור 1: סעיף פרפין מסורתי גורם קריעה חמורה של רקמות בלוק פרפין המכיל ניצן השחי של סחלב Phalaenopsis היה נתון חתך microtome קבוע.. קריעה חמורה של סרטי פרפין נצפתה לאחר חתך microtome מסורתי (א) </strong&gt;. שלמות רקמות המבנה התאי נפגע גם (B). החיצים מראים את הקריעה החמורה של פרוסת הרקמות. ראש החץ מציג את הגופות קריסטל. סרגל קנה מידה -100 מיקרומטר. <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig1large.jpg" target="_blank">לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/54754/54754fig2.jpg" /> איור 2:. Hybrid-Cut חתך שיטת רקמת ניצן השחי נקבעה PFA והרקמות היו מיובשות, הסתננו עם שעוות פרפין, ומוטבעי בלוק פרפין. בלוק פרפין היה גזוז לגודל מתאים (א). מתחם חיתוך טמפרטורה אופטימלית (אוקטובר) היה מוחל על מרכז הבמה cryostat (B). בלוק פרפין מצורף ב- OCT על במת cryostat. תחת בטמפרטורה נמוכה, בלוק פרפין<html> ששקדו על הבמה cryostat באמצעות אוקטובר (C). בחתכי רקמה היו מחולקים בתא cryostat ב -16 ° C (D). ברים סולם מייצגים 0.5 ס&quot;מ (א), 1 ס&quot;מ (BD). <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig2large.jpg" target="_blank">נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/54754/54754fig3.jpg" /> איור 3: Hybrid-Cut משפר Integrity סעיף בלוק פרפין המכיל ניצן השחי של סחלב Phalaenopsis היה נתון-Cut ההיברידי חתך (א) ואת השיטה ההיברידית-Cut פיק קטעים עם שלמות רקמות מצוינת (B).. ראש החץ מראה את גופות קריסטל אנדוגני משובצות ברקמת ניצן השחי. סרגל קנה מידה -100 מיקרומטר.r קבל = &quot;_ blank&quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 4" src="/files/ftp_upload/54754/54754fig4.jpg" /> איור 4: יישום של Hybrid-חותך סעיפי רקמות שונים של סחלב Phalaenopsis סחלב שונה. רקמות היו מחולקות בשיטת Hybrid-Cut, כגון חתך לאורך של זרע סחלב בשלב הבוגר (א), סעיף אורך של protocorm (B), חתך לאורך של גופי protocorm דמוי (PLB) (ג), סעיף רוחבי של להב עלה (D), חתך לאורך של השורש (E), חתך לאורך של ספייק פרח הצעיר (F), וסעיף אורך של ניצני פרחים צעירים (G). סעיפי רקמות הוכתמו על ידי hematoxylin. SC, קליפת הזרע; PB, גוף חלבון; M,meristem; MP, אמא PLB; עקור, בת PLB; מודעות, משטח עלה adaxial; Ab, משטח עלה abaxial; St, הפיוניות; MC, תא mesophyll; VB, צרור וסקולרית; RC, כובע שורש; FB, ניצן של פרח; Se, עָלֶה גָבִיעַ; Pe, עלה כותרת; La, שפית; פו, pollinia; Ro, rostellum; Ca, יבלת. ראשי חץ להראות גבישים. ברי סולם מייצגים 20 מיקרומטר (AE) ו -200 מיקרומטר (FG). <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig4large.jpg" target="_blank">נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/54754/54754fig5.jpg" /> איור 5:. Hybrid-Cut שומר Integrity רקמת העלה ב פלחה מספר השוואה של רקמת העלה בשיטת פרפין המסורתית (בחלונית הימנית) ואת הטכניקה Hybrid-Cut שפותחה במחקר זה (פאנל הימני). תמונות להראות עלו סעיפים רוחביים של אורז, חיטה, תירס. MC, תא mesophyll; Ph, השיפה; St, הפיוניות; לפנה&quot;ס, bu<html> תא lliform. חצים מראים הקריעה של פרוסת רקמה. ראשי חץ להראות גופות סיליקה. העיגולים מקווקוים הכחולים עולים האנטומיה קרנץ ב תירס C4. סולם bars 20 מיקרומטר. <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig5large.jpg" target="_blank">לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 6" src="/files/ftp_upload/54754/54754fig6.jpg" /> איור 6:. Hybrid-Cut שומר שלמות רקמות Spikelet ב פלחה כמה השוואת שלמות רקמות סעיפים spikelet בין פרפין המסורתי ושיטות Hybrid-Cut. חצים מראים הקריעה של פרוסת רקמה. ראשי חץ עולה גופים סיליקה. ברי סולם 20 מיקרומטר (אורז), ו -200 מיקרומטר (חיטה ותירס). <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig6large.jpg" target="_blank">נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> אף אוזן גרון &quot;FO: keep-together.within-page =&quot; 1 &quot;&gt; <img alt="איור 7" src="/files/ftp_upload/54754/54754fig7.jpg" /> איור 7: באתרו הכלאה של אקטין CyclinB1; 1 דפוסי הביטוי של ובלוטות באד של סחלב Phalaenopsis בחתכי רקמה של ניצן 2 nd ניצנים בית השחי ו -3 rd השחי הוכנו תוך שימוש בשיטת Hybrid-Cut.. סך של 40 ng של אקטין CyclinB1; 1 חללית DIG שכותרתו שמש הכלאה. חללית התחושה שמשה כביקורת שלילית. החצים מצביעים על meristem הרבייה של ניצן השחי. סולם bars 100 מיקרומטר. <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig7large.jpg" target="_blank">לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples at JoVE.com

Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

-Cut ההיברידי: שיטת חתך משופרת עבור דוגמאות רקמות צמח סרבן

Maintaining plant section integrity is essential for studying detailed anatomical structures at the cellular, tissue, or even organ level. However, some ...

hybrid-cut-an-improved-sectioning-method-for-recalcitrant-plant

Research

JoVE Journal

Biology

18.8K Views.  Academia Sinica. This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

Video: Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

Thin Sectioning of Slice Preparations for Immunohistochemistry

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been preserved, freshly removed, or excised but kept viable, as in slice preparations of brain tissue.  Subsequent microscopic studies of this material can be challenging, as the tissue samples may be difficult to handle.  Demonstrated here is a method for obtaining thin cryostat sections of tissue with a thickness that may range from 0.2-5.0 mm.  We routinely cut 400 micron thick Vibratome brain slices serially into 5-10 micron coronal cryostat sections.  The slices are typically first used for electrophysiology experiments and then require microscopic analysis of the cytoarchitecture of the region from which the recordings were observed.  We have constructed a simple device that allows controlled and reproducible preparation and positioning of the tissue slice.  This device consists of a cylinder 5 cm in length with a diameter of 1.2 cm, which serves as a freezing stage for the slice.  A ring snugly slides over the cylinder providing walls around the slice allowing the tissue to be immersed in freezing compound (e.g., OCT).  This is then quickly frozen with crushed dry ice and the resulting  wafer  can be position easily for cryostat sectioning.  Thin sections can be thaw-mounted onto coated slides to allow further studies to be performed, such as various staining methods, in situ hybridization, or immunohistochemistry, as demonstrated here.

The present method allows reproducible cryostat sectioning of small, difficult-to-manage, tissue pieces, such as biopsies and brain slices. We utilize a simple aluminum freezing stage to facilitate handling of tissue and a standard cryostat to routinely produce 5-10 micron serial sections from 400 micron thick brain slices.

חתך דק של ההכנות פורסים עבור אימונוהיסטוכימיה

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been ...

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

The high-throughput expression analysis technologies available today give scientists an overflow of expression profiles but their resolution in terms of tissue specific expression is limited because of problems in dissecting individual tissues. Expression data needs to be confirmed and complemented with expression patterns using e.g. in situ hybridization, a technique used to localize cell specific mRNA expression. The in situ hybridization method is laborious, time-consuming and often requires extensive optimization depending on species and tissue. In situ experiments are relatively more difficult to perform in woody species such as the conifer Norway spruce (Picea abies). Here we present a modified DIG in situ hybridization protocol, which is fast and applicable on a wide range of plant species including P. abies. With just a few adjustments, including altered RNase treatment and proteinase K concentration, we could use the protocol to study tissue specific expression of homologous genes in male reproductive organs of one gymnosperm and two angiosperm species; P. abies, Arabidopsis thaliana and Brassica napus. The protocol worked equally well for the species and genes studied. AtAP3 and BnAP3 were observed in second and third whorl floral organs in A. thaliana and B. napus and DAL13 in microsporophylls of male cones from P. abies. For P. abies the proteinase K concentration, used to permeablize the tissues, had to be increased to 3 g/ml instead of 1 g/ml, possibly due to more compact tissues and higher levels of phenolics and polysaccharides. For all species the RNase treatment was removed due to reduced signal strength without a corresponding increase in specificity. By comparing tissue specific expression patterns of homologous genes from both flowering plants and a coniferous tree we demonstrate that the DIG in situ protocol presented here, with only minute adjustments, can be applied to a wide range of plant species. Hence, the protocol avoids both extensive species specific optimization and the laborious use of radioactively labeled probes in favor of DIG labeled probes. We have chosen to illustrate the technically demanding steps of the protocol in our film.
Anna Karlgren and Jenny Carlsson contributed equally to this study.
Corresponding authors: Anna Karlgren at Anna.Karlgren@ebc.uu.se and Jens F. Sundstr&#246;m at Jens.Sundstrom@vbsg.slu.se

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

We describe a modified DIG in situ hybridization protocol, which is fast and applicable on a wide range of plant species including Norway spruce. With just a few adjustments, including altered RNase treatment and proteinase K concentration, the protocol may be used in studies of different tissues and species.

Non-רדיואקטיבי באתרו הכלאה פרוטוקול ישים עבור נורווגיה Spruce ומגוון של מיני צמחים

The high-throughput expression analysis technologies available today give scientists an overflow of expression profiles but their resolution in terms of ...

Multimodal Hierarchical Imaging of Serial Sections for Finding Specific Cellular Targets within Large Volumes

Targeting specific cells at ultrastructural resolution within a mixed cell population or a tissue can be achieved by hierarchical imaging using a combination of light and electron microscopy. Samples embedded in resin are sectioned into arrays consisting of ribbons of hundreds of ultrathin sections and deposited on pieces of silicon wafer or conductively coated coverslips. Arrays are imaged at low resolution using a digital consumer like smartphone camera or light microscope (LM) for a rapid large area overview, or a wide field fluorescence microscope (fluorescence light microscopy (FLM)) after labeling with fluorophores. After post-staining with heavy metals, arrays are imaged in a scanning electron microscope (SEM). Selection of targets is possible from 3D reconstructions generated by FLM or from 3D reconstructions made from the SEM image stacks at intermediate resolution if no fluorescent markers are available. For ultrastructural analysis, selected targets are finally recorded in the SEM at high-resolution (a few nanometer image pixels). A ribbon-handling tool that can be retrofitted to any ultramicrotome is demonstrated. It helps with array production and substrate removal from the sectioning knife boat. A software platform that allows automated imaging of arrays in the SEM is discussed. Compared to other methods generating large volume EM data, such as serial block-face SEM (SBF-SEM) or focused ion beam SEM (FIB-SEM), this approach has two major advantages: (1) The resin-embedded sample is conserved, albeit in a sliced-up version. It can be stained in different ways and imaged with different resolutions. (2) As the sections can be post-stained, it is not necessary to use samples strongly block-stained with heavy metals to introduce contrast for SEM imaging or render the tissue blocks conductive. This makes the method applicable to a wide variety of materials and biological questions. Particularly prefixed materials e.g., from biopsy banks and pathology labs, can directly be embedded and reconstructed in 3D.

This protocol targets specific cells in tissue for imaging at nanoscale resolution using a scanning electron microscope (SEM). Large numbers of serial sections from resin-embedded biological material are first imaged in a light microscope to identify the target and then in a hierarchical manner in the SEM.

הדמיה הירארכי עם מודאלים מרובים סעיפים טורי למציאת מטרות תאיות ספציפיים בתוך כמויות גדולות

Targeting specific cells at ultrastructural resolution within a mixed cell population or a tissue can be achieved by hierarchical imaging using a ...

Developmental Biology

Preparation of Non-human Primate Brain Tissue for Pre-embedding Immunohistochemistry and Electron Microscopy

Despite all the technological advances at the light microscopy&#160;level, electron microscopy remains the only tool in neuroscience to examine and characterize ultrastructural and morphological details of neurons, such as synaptic contacts. Good preservation of brain tissue for electron microscopy can be obtained by rigorous cryo-fixation methods, but these techniques are rather costly and limit the use of immunolabeling, which is crucial to understand the connectivity of identified neuronal systems. Freeze-substitution methods have been developed to allow the combination of cryo-fixation with immunolabeling. However, the reproducibility of these methodological approaches usually relies on costly freezing devices. Moreover, achieving reliable results with this technique is very time-consuming and skill-challenging. Hence, the traditional chemically fixed brain, particularly with acrolein fixative, remains a time-efficient and low-cost method to combine electron microscopy with immunohistochemistry. Here, we provide a reliable experimental protocol using chemical acrolein fixation that leads to the preservation of primate brain tissue and is compatible with pre-embedding immunohistochemistry and transmission electron microscopic examination.

Here, we provide an easy, low-cost, and time-efficient protocol to chemically fix primate brain tissue with acrolein fixative, allowing for long-term preservation that is compatible with pre-embedding immunohistochemistry for transmission electron microscopy.

הכנה של רקמת מוח הפרימאטים לא-אנושית עבור טרום הטבעת אימונוהיסטוכימיה ו מיקרוסקופי אלקטרונים

Despite all the technological advances at the light microscopy&#160;level, electron microscopy remains the only tool in neuroscience to examine and ...

Neuroscience

The Cutting and Floating Method for Paraffin-embedded Tissue for Sectioning

Sectioning of the paraffin-embedded tissue is widely used in histology and pathology. However, it is tedious. To improve this method, several commercial companies have devised complex section transfer systems using fluid water. To simplify this technology, we created a simple method using homemade equipment that combines cutting and floating within a simple thermostatic chamber; therefore, the sections automatically enter the water bath on the water surface. The hippocampus from adult mouse brains, adult mouse kidneys, embryonic mouse brains, and adult zebrafish eyes were cut using both conventional paraffin sectioning and the presented method for comparison. Statistical analysis shows that our improved method saved time and produced higher quality sections. In addition, paraffin sectioning of a whole specimen in a short time is easy for junior operators.

Here, we present a protocol to improve paraffin sectioning. This method combines cutting and floating using a simple thermostatic chamber to avoid the transfer process required by the conventional method. As a result, the efficiency and the number of intact paraffin sections were greatly improved.

חיתוך ושיטת צף בשביל לרקמות פרפין-מוטבע על חלוקתה

Sectioning of the paraffin-embedded tissue is widely used in histology and pathology. However, it is tedious. To improve this method, several commercial ...

Sampling Strategies and Processing of Biobank Tissue Samples from Porcine Biomedical Models

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of genetically modified pig models, and the often-limited number of available animals of these models, establishment of (biobank) collections of adequately processed tissue samples suited for a broad spectrum of subsequent analyses methods, including analyses not specified at the time point of sampling, represent meaningful approaches to take full advantage of the translational value of the model. With respect to the peculiarities of porcine anatomy, comprehensive guidelines have recently been established for standardized generation of representative, high-quality samples from different porcine organs and tissues. These guidelines are essential prerequisites for the reproducibility of results and their comparability between different studies and investigators. The recording of basic data, such as organ weights and volumes, the determination of the sampling locations and of the numbers of tissue samples to be generated, as well as their orientation, size, processing and trimming directions, are relevant factors determining the generalizability and usability of the specimen for molecular, qualitative, and quantitative morphological analyses. Here, an illustrative, practical, step-by-step demonstration of the most important techniques for generation of representative, multi-purpose biobank specimen from porcine tissues is presented. The methods described here include determination of organ/tissue volumes and densities, the application of a volume-weighted systematic random sampling procedure for parenchymal organs by point-counting, determination of the extent of tissue shrinkage related to histological embedding of samples, and generation of randomly oriented samples for quantitative stereological analyses, such as isotropic uniform random (IUR) sections generated by the &#34;Orientator&#34; and &#34;Isector&#34; methods, and vertical uniform random (VUR) sections.

The practical application and performance of methods for generation of representative tissue samples of porcine animal models for a broad spectrum of downstream analyses in biobank projects are demonstrated, including volumetry, systematic random sampling, and differential processing of tissue samples for qualitative and quantitative morphologic and molecular analyses types.

אסטרטגיות דגימה ועיבוד של דגימות רקמה Biobank של מודלים ביו חזירי

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of ...

Medicine

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix containing polysaccharides that include cellulose microfibrils that form both crystalline structures and cellulose chains of amorphous organization. The orientation of the cellulose fibers and their concentrations dictate the mechanical properties of the cell. Several methods are used to determine the levels of crystalline cellulose, each bringing both advantages and limitations. Some can distinguish the proportion of crystalline regions within the total cellulose. However, they are limited to whole-organ analyses that are deficient in spatiotemporal information. Others relying on live imaging, are limited by the use of imprecise dyes. Here, we report a sensitive polarized light-based system for specific quantification of relative light retardance, representing crystalline cellulose accumulation in cross sections of Arabidopsis thaliana roots. In this method, the cellular resolution and anatomical data are maintained, enabling direct comparisons between the different tissues composing the growing root. This approach opens a new analytical dimension, shedding light on the link between cell wall composition, cellular behavior and whole-organ growth.

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Crystalline cellulose is an important constituent of the plant cell wall. However, its quantification at a cellular resolution is technically challenging. Here, we report the use of polarized light technology and root cross sections to obtain information of cell wall composition at a spatiotemporal resolution.

כימות רזולוציה גבוהות של הצטברות צלולוזת גבישים ב<em&gt; ארבידופסיס</em&gt; שורשי לפקח סלולארי רקמות ספציפיות קיר שינויים

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix ...

Laser-Capture Microdissection RNA-Sequencing for Spatial and Temporal Tissue-Specific Gene Expression Analysis in Plants

The development of a complex multicellular organism is governed by distinct cell types that have different transcriptional profiles. To identify transcriptional regulatory networks that govern developmental processes it is necessary to measure the spatial and temporal gene expression profiles of these individual cell types. Therefore, insight into the spatio-temporal control of gene expression is essential to gain understanding of how biological and developmental processes are regulated. Here, we describe a laser-capture microdissection (LCM) method to isolate small number of cells from three barley embryo organs over a time-course during germination followed by transcript profiling. The method consists of tissue fixation, tissue processing, paraffin embedding, sectioning, LCM and RNA extraction followed by real-time PCR or RNA-seq. This method has enabled us to obtain spatial and temporal profiles of seed organ transcriptomes from varying numbers of cells (tens to hundreds), providing much greater tissue-specificity than typical bulk-tissue analyses. From these data we were able to define and compare transcriptional regulatory networks as well as predict candidate regulatory transcription factors for individual tissues. The method should be applicable to other plant tissues with minimal optimization.

Presented here is a protocol for laser-capture microdissection (LCM) of plant tissues. LCM is a microscopic technique for isolating areas of tissue in a contamination-free manner. The procedure includes tissue fixation, paraffin embedding, sectioning, LCM and RNA extraction. RNA is used in the downstream tissue-specific, temporally resolved analysis of transcriptomes.

לכידת לייזר מיקרודיסציה RNA-רצף לניתוח ביטוי גנים ספציפי רקמה מרחבית וזמנית בצמחים

The development of a complex multicellular organism is governed by distinct cell types that have different transcriptional profiles. To identify ...

A Simple Dry Sectioning Method for Obtaining Whole-Seed-Sized Resin Section and Its Applications

The morphology, size and quantity of cells, starch granules&#160;and protein bodies in seed determine the weight and quality of seed. They are significantly different among different regions of seed. In order to view the morphologies of cells, starch granules and protein bodies clearly, and quantitatively analyze their morphology parameters accurately, the whole-seed-sized section is needed. Though the whole-seed-sized paraffin section can investigate the accumulation of storage materials in seeds, it is very difficult to quantitatively analyze the morphology parameters of cells and storage materials due to the low resolution of the thick section. The thin resin section has high resolution, but the routine resin sectioning method is not suitable to prepare the whole-seed-sized section of mature seeds with a large volume and high starch content. In this study, we present a simple dry sectioning method for preparing the whole-seed-sized resin section. The technique can prepare the cross and longitudinal whole-seed-sized sections of developing, mature, germinated, and cooked seeds embedded in LR White resin, even for large seeds with high starch content. The whole-seed-sized section can be stained with fluorescent brightener 28, iodine, and Coomassie brilliant blue R250 to specifically exhibit the morphology of cells, starch granules, and protein bodies clearly, respectively. The image obtained can also be analyzed quantitatively to show the morphology parameters of cells, starch granules, and protein bodies in different regions of seed.

This technique allows for the fast and simple preparation of whole-seed-sized resin section for the observation and analysis of cells, starch granules, and protein bodies in different regions of the seed.

שיטת מקטע יבש פשוטה לקבלת מקטע שרב בגודל זרע שלם ויישומיו

The morphology, size and quantity of cells, starch granules&#160;and protein bodies in seed determine the weight and quality of seed. They are ...

Microscopy Techniques for Interpreting Fungal Colonization in Mycoheterotrophic Plants Tissues and Symbiotic Germination of Seeds

Structural botany is an indispensable perspective to fully understand the ecology, physiology, development, and evolution of plants. When researching mycoheterotrophic plants (i.e., plants that obtain carbon from fungi), remarkable aspects of their structural adaptations, the patterns of tissue colonization by fungi, and the morphoanatomy of subterranean organs can enlighten their developmental strategies and their relationships with hyphae, the source of nutrients. Another important role of symbiotic fungi is related to the germination of orchid seeds; all Orchidaceae species are mycoheterotrophic during germination and seedling stage (initial mycoheterotrophy), even the ones that photosynthesize in adult stages. Due to the lack of nutritional reserves in orchid seeds, fungal symbionts are essential to provide substrates and enable germination. Analyzing germination stages by structural perspectives can also answer important questions regarding the fungi interaction with the seeds. Different imaging techniques can be applied to unveil fungi endophytes in plant tissues, as are proposed in this article. Freehand and thin sections of plant organs can be stained and then observed using light microscopy. A fluorochrome conjugated to wheat germ agglutinin can be applied to the fungi and co-incubated with Calcofluor White to highlight plant cell walls in confocal microscopy. In addition, the methodologies of scanning and transmission electron microscopy are detailed for mycoheterotrophic orchids, and the possibilities of applying such protocols in related plants is explored. Symbiotic germination of orchid seeds (i.e., in the presence of mycorrhizal fungi) is described in the protocol in detail, along with possibilities of preparing the structures obtained from different stages of germination for analyses with light, confocal, and electron microscopy.

This protocol aims to provide detailed procedures for collecting, fixing, and maintaining mycoheterotrophic plant samples, applying different microscopy techniques such as scanning and transmission electron microscopy, light, confocal, and fluorescence microscopy to study fungal colonization in plants tissues and seeds germinated with mycorrhizal fungi.

טכניקות מיקרוסקופיה לפענוח התיישבות פטרייתית ברקמות צמחים מיקוהטרוטרופיים ונביטה סימביוטית של זרעים

Structural botany is an indispensable perspective to fully understand the ecology, physiology, development, and evolution of plants. When researching ...