We are grateful to the technical support from Ms. Hong Xian Hsing, Mr. Min Jeng Li, and Mr. Eric C. P. Wu. We express our appreciation to Miranda Loney for English editing.

1. 고정 및 포함 <ol><li> 시약 준비 <ol><li> 배 인산 완충 용액 (PBS) <ol><li> 80g의 NaCl, 2 g의 KCl, 14.4 g이 나 HPO 4, 2.4 g의 KH 2 PO 4 800 ml의 증류수 (DDH 2 O)를 추가하고 HCl로 7.4 pH를 조정합니다. 1 L의 총 부피에 O DDH 2를 추가하고 1,000 μl를 디 에틸 피로 카보네이트 (DEPC)를 추가하고 격렬하게 흔들어. 스토어 PBS 하룻밤 20 분 다음 날 121 ° C의 실내 온도와 오토 클레이브에서. </li></ol></li><li> 1X PBS <ol><li> , HPO 4 0.01 M 나트륨 (2)의 최종 농도를 얻기 위해 DDH 2 O 1:10 비로 0.002 M KH 2 PO 4, 0.003 M KCl을, 0.13 M 염화나트륨을 재고 PBS 배 희석. </li></ol></li><li> 파라 포름 알데히드 (PFA) 고정액 주의 : 파라 포름 알데히드는 독성이있다. 흄 후드를 준비합니다. 장갑을 착용 할 것. <ol><li> 250 ml의 PFA의 정착액을 준비하려면 (100)를 가열ml의 1 배 ~ 70 PBS - 80 ° C 및 NaOH를 1,750 μl를 추가합니다. 이어서, 파라 포름 알데히드 10 g을 추가하고 용해 될 때까지 잘 혼합한다. 얼음에 솔루션을 배치 한 후 H 2 7.2로 pH를 조정 SO 4 - 냉각 후 (260 100 ㎖ 270 μL). </li><li> , 1X PBS 250 ml의에 볼륨을 조정 0.25 %의 최종 농도 625 μL 글루 타르 알데히드를 추가합니다. 정착액의 침투를 용이하게하기 위해 250 μL 트리톤 X-100 및 250 ㎕의 트윈 20을 추가합니다. 주 : PFA 정착액이 그 고정 능력을 손실하지 않고 한 달 동안 4 ℃에서 저장 될 수있다. </li></ol></li><li> DEPC 처리 된 물과 에탄올의 다양한 농도 (30 %, 50 %, 70 %, 85 %, 95 %)을 준비한다. </li></ol></li><li> 식물 시료 채취 <ol><li> 겨드랑이 싹 <ol><li> 네 잎 단계에서 성숙 호 접 난초 식물을 사용합니다. 조심스럽게 손을 사용하여 주맥 다음 잎을 찢어하여 잎을 제거 할 수 있습니다. </li><li> caref에 날카로운 메스를 사용하여ully monopodial 줄기에 세 번째 또는 네 번째 잎의 기지에서 겨드랑이 싹을 제거합니다. </li></ol></li><li> 종자 샘플 <ol><li> 수분 후 사개월에서 성숙한 난초 씨앗 포드를 수확. 메스로 종 씨앗 포드를 잘라. 부드럽게 개방 씨앗 포드를 흔들어 필터 종이에 마른 씨앗을 놓습니다. </li></ol></li><li> Protocorm <ol><li> 1 / 2 배 무라 시게 및 스쿡 한천 플레이트에 성숙한 난초 씨앗을 뿌리고, 그리고 조직 문화 12 시간 빛 기간 룸과 25 ° C의 일정한 온도에서 성장합니다. 파종 후 7 주에 녹색 protocorm 샘플. </li></ol></li><li> Protocorm 같은 기관 (PLBs) <ol><li> 단계 1.2.3.1에서와 동일한 성장 조건에 따라 이전에 10 곳 바와 같이 T2는 한천 플레이트 재생에 난초 PLBs 성장. 8mm - (5)의 높이에서 10 PLBs를 수집합니다. </li></ol></li><li> 잎 샘플 <ol><li> 단계에 설명 된대로 성숙한 접 난초 식물의 잎 조직을 수집1.2.1.1. </li><li> 두 번째 새로 개발 된 잎에서 잎 조직 (7mm 길이 X 5mm 폭)의 작은 조각을 잘라 날카로운 메스를 사용합니다. </li></ol></li><li> 루트 샘플 <ol><li> 단계 1.2.1.1에서 설명 된 것과 동일한 설비를 사용하여 날카로운 메스를 사용하여 루트 팁 조직 1cm 길이를 해부. </li></ol></li><li> 젊은 스파이크 <ol><li> 길이 10cm 스토킹 꽃의 끝 부분에서 젊은 스파이크 조직을 잘라 날카로운 메스를 사용합니다. </li></ol></li><li> 꽃 봉오리 <ol><li> 난초 꽃 줄기의 직경 5mm의 작은 꽃 봉오리를 절제. 꽃 봉오리 조직 종 (두께 3mm)의 일부를 잘라. </li></ol></li><li> 잎 조직과 곡물의 이삭 조직 <ol><li> 쌀, 밀, 옥수수 식물의 첫 번째 새로 개발 된 잎에서 1cm 길이 잎 블레이드 조직을 잘라. </li><li> 식물에서 10 이삭 (쌀, 밀, 옥수수) 개화 전에 일일를 수집합니다. </li></ol></li></ol></li><li> 정착<ol><li> 15 mL의 빙냉 PFA 고정 제를 함유하는 유리 섬광 바이알로 전송하여 즉시 식물 시료를 고정. </li><li> 4 ° C 차가운 방에서 식물 샘플을 진공 (~ 720mm 수은)을 적용합니다. 15 진공 상태에서 - 20 분 (작은 거품이 샘플에서 분리되어야한다). 조직의 대부분이 진공의 릴리스 이후에 가라 앉을 때까지이 단계를 반복합니다. 밤새 진공을 잡고 다음날 천천히 진공을 놓습니다. </li></ol></li><li> 탈수 참고 : 침투 단계를 고정에서 같은 병을 사용합니다. 부어 또는 이전 단계에서 솔루션을 배수하고 유리 병에 새로운 솔루션의 15 ㎖로 대체 피펫을 사용합니다. 조직의 질감에 따라, 이러한 긴 시간 동안 난초 겨드랑이 새싹, 씨앗, protocorm 및 PLB, 쌀, 밀 이삭, 옥수수 등 열심히 조직을 치료; 이러한 짧은 시간 동안 난초 꽃 봉오리, 젊은 스파이크, 잎과 뿌리, 쌀, 밀 잎, 옥수수와 같은 부드러운 조직을 취급합니다. <oL&gt; <li> 고정 후, 얼음에 10 분 동안 PBS 1X (15) 용액에 샘플을 담가. <ol><li> 다음 실온에서 15 ml의 에탄올 시리즈 샘플 탈수 : 30 % 에탄올에서 30 분, 50 % 에탄올, 30 분, 70 % 에탄올로 1 시간 동안, 단단한 조직을 54 분, 더 부드러운 조직을 30 분 동안 85 % 에탄올, 더 열심히 조직 54 분, 부드러운 조직에 대한 30 분, 세게 조직 54 분, 부드러운 조직을 30 분 동안 두 번 100 % 에탄올 95 % 에탄올. 주 : 식물 시료는 여러 달 동안 4 ℃에서 70 % 에탄올에 저장 될 수있다. </li></ol></li></ol></li><li> 파라핀 침투 <ol><li> 다음과 같이 실온에서 단단한 조직을 54 분으로 각각 연약한 조직을 30 분 동안 15 ml의 에탄올 및 크실렌 대체 혼합물 샘플을 침투 : 에탄올 / 크실렌 대용품 (2 : 1, V / V), 에탄올 / 크실렌 대체물 (1 : 1, V / V), 에탄올 / 크실렌 대체물 (1 : 2, V / V), 회 순수 크실렌 대체물. 주의 : 크실렌 독성이다. 흄 후드에서이 단계를 수행합니다. </리&gt; <li> 밤새 어렵게 조직에 대해, 60 ° C의 오븐에서 15 ml의 크실렌 대체물 파라핀 혼합물을 유리 병에 시료 침투 및 소프 조직 60 분 동안 다음과 같이 크실렌 대체물 / 파라핀 (2 : 1, V / V) 크실렌 대체물 / 파라핀 (1 : 1, V / V) 및 크실렌 대체물 / 파라핀 (1 : 2, V / V). </li><li> 하루에 두 번 15 ml의 순수한 파라핀 샘플을 침투 오븐에서 60 ° C에서 품어. </li><li> 단계를 반복 다음날 1.5.3. </li></ol></li><li> 조직 삽입 <ol><li> 파라핀 블록에 조직을 삽입하기 전에 파라핀 저수지의 왁스를 녹여 사전에 조직을 포함 센터 1 시간의 전원을 켭니다. </li><li> 62 ° C에서 온난화 트레이의 금형 (기본 3.3 cm 길이 × 2 cm 폭의 크기)를 따뜻하게하고, 몰드베이스로 약 13 ml의 녹은 왁스를 붓는다. </li><li> 가온 집게 금형에 섹션 1.5.4에서 하나의 조직 샘플을 전송하고 원하는 위치로 방향. </li><li> 금형 이동왁스가 응고 될 때까지 조심스럽게 냉각 판에, 떠나. </li></ol></li></ol> 2. 조직 단면 <ol><li> 파라핀 절편 방법 <ol><li> (섹션 1.6.2에 같은 크기) 금형의 상단에 매립 카세트를 배치하여 왁스베이스를 확인 녹은 왁스를 작성하고 왁스가 응고 된 후 몰드를 제거합니다. 참고 : 삽입 카세트 샘플 파라핀 블록을 고정하는 왁스 기반을 형성 할 것이다. </li><li> 적절한 모양과 크기로 파라핀 블록을 손질하고 평평한 주걱에 약간의 왁스 조각을 배치합니다. 왁스 용융 될 때까지 알코올 버너를 사용하여 왁스 조각을 가열 한 다음 블록을 준수 섹션 2.1.1에 왁스베이스에 녹은 왁스를 배치합니다. 마이크로톰에 클램프. </li><li> 마이크로톰에 새로운 블레이드를 배치하고, 마이크로톰의 절편을 촉진하기 위하여 5도까지 각도를 조정합니다. </li><li> 이전 11 설명 된 바와 같이, 얇게 (10 μm의)에 샘플 파라핀 블록을 잘라. </li> &lt;/ OL&gt; </li><li> 하이브리드 잘라 단면 처리 방법 <ol><li> 면도날을 사용하여 적절한 크기의 상단에서 사다리꼴 표면 열에 단계 1.6.4에서 샘플 파라핀 블록을 낸다. </li><li> 그라 이오 스탯 무대의 중심으로 일부 최적의 절단 온도 화합물 OCT ()를 추가합니다. 그라 이오 스탯 단계로 파라핀 블록을 부착하고 신속하게 원하는 위치로 상기 조직 블록을 배향. </li><li> 그라 이오 스탯 챔버에 파라핀 블록 / 스테이지를 전송합니다. OCT를 10 분 동안 -42 ℃에서 빠른 동결 바에서 응고 할 수 있습니다. 10월 (그림 2C)의 응고시에 블록을 이동하지 마십시오. </li><li> 그라 이오 스탯 어댑터와 챔버 온도가 저온 유지 장치 어댑터에 파라핀 블록 / 무대를 부착하기 전에 -20 ° C 및 -16 ° C에 각각 냉각 할 수 있습니다. 두께 10 μm의 섹션 조직. </li><li> 집게로 조직 섹션을 선택합니다. 폴리에 800 μL의 DEPC 처리 된 물에 섹션을 플로트 - L을 - 라이신 COA를테드 슬라이드와 42 ° C에서 핫 플레이트에 슬라이드를 전송합니다. </li><li> 섹션 42 ° C에서 DEPC 처리 된 물에 평평하게 할 수 있습니다. 가장자리에서 물을 배수 필터 종이를 사용합니다. </li><li> 하룻밤 42 ° C 핫 플레이트에 슬라이드를 배치하여 슬라이드에 마운트 조직. </li></ol></li></ol> 3. 조직 염색 <ol><li> 탈 파라핀 <ol><li> 핫 플레이트에서 슬라이드를 수집하고 염색 랙에 배치합니다. 흄 후드에서 염색 항아리에 150 ml의 자일 렌을 추가하고 5 분 동안 크실렌에서 랙을 담그지. </li></ol></li><li> 재수 <ol><li> DEPC 처리 된 물에 에탄올 용액의 다양한 농도 (100 %, 95 %, 70 %, 50 %, 30 %)을 준비하여, 각각 별개의 염색 단지에 용액 150 ㎖를 채운다. </li><li> 에탄올 농도, 실온에서 3 분 동안 각 단계가 감소하는 일련의 샘플 재수. 얼룩에 슬라이드를 이동하면 다른 병 들어있는 D 한 병 랙ifferent 에탄올 농도 : 100 % 에탄올, 95 % 에탄올, 70 % 에탄올, 50 % 에탄올, 30 % 에탄올. </li><li> 수분 보충 한 후, 3 분 동안 DDH 2 O의 표본을 담그지. </li></ol></li><li> 헤 마톡 실린 염색 <ol><li> 1.5 분 동안 헤 마톡 실린 용액 조직 슬라이드를 침지 얼룩 조직 샘플. </li><li> 다음 몇 초 동안 12 N의 염산 (HCL) 2 방울 및 DDH O. 2에 간단히 세척 1 - 2 O가 함유 DDH에서 간단히 헹구어 </li></ol></li><li> 탈수 <ol><li> 30 % 에탄올, 50 % 에탄올, 70 % 에탄올, 95 % 에탄올, 100 % 에탄올 : 실온에서 3 분 동안 에탄올 농도가 증가하는 일련의 샘플을 탈수. 5 분 동안 흄 후드에서 자일 렌으로 표본을 취소합니다. </li></ol></li><li> 설치 <ol><li> 슬라이드에 크실렌 기반 장착 매체의 적절 600 μl를 삭제합니다. 조심스럽게 시편 위에 커버 슬립을 배치합니다. 좋은 품질의 이미지를 얻을 수 형성 공기 방울을 피하십시오. </li><li> 슬라이드가 건조 하룻밤을 방송 할 수 있습니다. 다음 날 현미경으로 시료를 관찰한다. 참고 : 이미지는 표본의 크기에 따라 400 배 배율로 25X에서 촬영되었다. </li></ol></li></ol> 현장 하이브리드 4. <ol><li> 프로브 합성 <ol><li> 복제 접 아프로디테 액틴 유전자 특정 코딩 서열 사용하여 프라이머 5&#39;-GGCAGAGTATGATGAATCTGGTCC-3 &#39;와 5&#39; AGGACAGAAGTTCGGCTGGC -3&#39;(242 bp의 PCR 증폭 물을 얻기 위해) 및 CyclinB1 1 유전자 특정 코딩 서열 사용하여 프라이머 5&#39;-TCGTAGCAAGGTTGCTTGTG-3 &#39; 및 5&#39; ATGAGCATGGCGCTAATACC-3 &#39;(327 bp의 PCR 증폭 물을 얻기 위해) 12 설명 된대로. </li><li> 제조 업체의 프로토콜에 따라 (예를 들면 pGEMT)를 벡터로 특정 코딩 서열을 결찰. </li><li> 디그 옥시 제닌 생성 (DIG)는 제조업체의 지시에 따라 SP6 / T7 DIG RNA 라벨 키트를 사용하여 센스 및 안티센스 프로브를 표시에스. </li></ol></li><li> 현장 하이브리드에 <ol><li> 하이브리드 컷 방법을 사용하여 생성 된 2 차 및 3 차 겨드랑 꽃 봉오리 조직 조각 (10 μm의 두께) 절단 및 코팅 된 슬라이드에 슬라이스를 탑재합니다. </li><li> 크실렌 Deparaffinize 조직 절편 (3.1.1 참조) 에탄올 농도 (3.2.2 참조) 감소하는 재수, 30 분 동안 37 ° C에서 2 ㎎ / ㎖ 프로 테이나 제 K의 다이제스트. </li><li> 프로토콜에 따라 현장 하이브리드에 수행 이전에 59 ° C 및 CyclinB1 60 ° C로 액틴을위한 하이브리드 온도, 즉 일부 수정과 11,13 설명;. 1 40 NG의 DIG 표지 RNA 프로브와 슬라이드를 혼성화. </li><li> 11 바와 같이 하이브리드 화 신호를 검출하기 nitroblue 테트라 졸륨 / 5- 브로 모 -4- 클로로 -3- 인돌 릴 포스페이트 (NBT / BCIP) 용액을 사용한다. </li></ol></li></ol>

<ol>
	<li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> Cold Spring Harb Protoc. 3, 1-2 (2008).</li><li>Knox, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Freeze-sectioning+of+plant+tissues.">Freeze-sectioning of plant tissues.</a> Stain Technol. 45, 265-272 (1970).</li><li>Ruan, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+cryosection+method+for+polyethylene+glycol+hydrogels+used+in+tissue+engineering.">An improved cryosection method for polyethylene glycol hydrogels used in tissue engineering.</a> Tissue Eng.: Part C Methods. 19, 794-801 (2013).</li><li>Prychid, C. J., Rudall, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+oxalate+crystals+in+monocotyledons:+A+review+of+their+structure+and+systematics.">Calcium oxalate crystals in monocotyledons: A review of their structure and systematics.</a> Ann Bot. 84, 725-739 (1999).</li><li>Prychid, C. J., Rudall, P. J., Gregory, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematics+and+biology+of+silica+bodies+in+monocotyledons.">Systematics and biology of silica bodies in monocotyledons.</a> Bot. Rev. 69 (4), 377-440 (2004).</li><li>Arnott, H. J., Pautard, F. G. E., Steinfink, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+calcium+oxalate+monohydrate.">Structure of calcium oxalate monohydrate.</a> Nature. 208, 1197-1198 (1965).</li><li>Mitani, N., Yamaji, N., Ma, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+maize+silicon+influx+transporters.">Identification of maize silicon influx transporters.</a> Plant Cell Physiol. 50, 5-12 (2009).</li><li>Hayasaka, T., Fujii, H., Ishiguro, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+silicon+in+preventing+appressorial+penetration+by+the+rice+blast+fungus.">The role of silicon in preventing appressorial penetration by the rice blast fungus.</a> Phytopathology. 98, 1038-1044 (2008).</li><li>Ma, J. F., Yamaji, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+uptake+and+accumulation+in+higher+plants.">Silicon uptake and accumulation in higher plants.</a> Trends Plant Sci. 11, 392-397 (2006).</li><li>Chen, W., Tang, C., YL, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ploidy+doubling+by+in+vitro+culture+of+excised+protocorms+or+protocorm-like+bodies+in+Phalaenopsis+species.">Ploidy doubling by in vitro culture of excised protocorms or protocorm-like bodies in Phalaenopsis species.</a> Plant Cell Tiss Org. 98, 229-239 (2009).</li><li>Javelle, M., Marco, C. F., Timmermans, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Situ+Hybridization+for+the+Precise+Localization+of+Transcripts+in+Plants.">In Situ Hybridization for the Precise Localization of Transcripts in Plants.</a> J. Vis. Exp. (57), e3328 (2011).</li><li>Park, D. J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+Protocols.">PCR Protocols.</a> Methods in Molecular Biology. 687, (2011).</li><li>Lin, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+annotation,+expression+profiling,+and+protein+interaction+studies+of+the+core+cell-cycle+genes+in+Phalaenopsis+aphrodite.">Genome-wide annotation, expression profiling, and protein interaction studies of the core cell-cycle genes in Phalaenopsis aphrodite.</a> Plant Mol Biol. 84, 203-226 (2014).</li><li>Lee, Y. -. I., Yeung, E. C., Lee, N., Chung, M. -. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryology+of+Phalaenopsis+amabilis+var.+formosa:+embryo+development.">Embryology of Phalaenopsis amabilis var. formosa: embryo development.</a> Bot Stud. 49, 139-146 (2008).</li><li>Endo, M., Ikusima, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diurnal+rhythm+and+characteristics+of+photosynthesis+and+respiration+in+the+leaf+and+root+of+a+Phalaenopsis+plant.">Diurnal rhythm and characteristics of photosynthesis and respiration in the leaf and root of a Phalaenopsis plant.</a> Plant Cell Physiol. 30, 43-47 (1989).</li><li>Guo, W. J., Lee, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+leaf+and+plant+age,+and+day/night+temperature+on+net+CO2+uptake+in+Phalaenopsis+amabilis+var.+formosa.">Effect of leaf and plant age, and day/night temperature on net CO2 uptake in Phalaenopsis amabilis var. formosa.</a> J. Amer. Soc. Hort. Sci. 131, 320-326 (2006).</li><li>Lewin, J., Reimann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silicon+and+plant+growth.">Silicon and plant growth.</a> Ann. Rev. of Plant Physiol. 20, 289-304 (1969).</li><li>Kaufman, P. B., Simpson, T. L., Valcani, B. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silica+in+shoots+of+higher+plants.">Silica in shoots of higher plants.</a> Silicon and siliceous structures in biological systems. , 409-449 (1981).</li><li>Lundgren, M. R., Osborne, C. P., Christin, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deconstructing+Kranz+anatomy+to+understand+C4+evolution.">Deconstructing Kranz anatomy to understand C4 evolution.</a> J Exp Bot. 65, 3357-3369 (2014).</li><li>Liu, W. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anatomical+and+transcriptional+dynamics+of+maize+embryonic+leaves+during+seed+germination.">Anatomical and transcriptional dynamics of maize embryonic leaves during seed germination.</a> Proc Natl Acad Sci U S A. 110, 3979-3984 (2013).</li><li>Driscoll, S. P., Prins, A., Olmos, E., Kunert, K. J., Foyer, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specification+of+adaxial+and+abaxial+stomata,+epidermal+structure+and+photosynthesis+to+CO2+enrichment+in+maize+leaves.">Specification of adaxial and abaxial stomata, epidermal structure and photosynthesis to CO2 enrichment in maize leaves.</a> J Exp Bot. 57, 381-390 (2006).</li><li>Karlgren, A., Carlsson, J., Gyllenstrand, N., Lagercrantz, U., Sundstr&#246;m, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-radioactive+in+situ+Hybridization+Protocol+Applicable+for+Norway+Spruce+and+a+Range+of+Plant+Species.">Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species.</a> J. Vis. Exp. (26), (2009).</li><li>Hejatko, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+technique+for+mRNA+detection+in+whole+mount+Arabidopsis+samples.">In situ hybridization technique for mRNA detection in whole mount Arabidopsis samples.</a> Nat Protoc. 1, 1939-1946 (2006).</li><li>Javelle, M., Timmermans, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+localization+of+small+RNAs+in+plants+by+using+LNA+probes.">In situ localization of small RNAs in plants by using LNA probes.</a> Nat Protoc. 7, 533-541 (2012).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+analysis+of+gene+expression+in+plants.">In situ analysis of gene expression in plants.</a> Methods Mol Biol. 513, 229-242 (2009).</li><li>Drea, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+streamlined+method+for+systematic,+high+resolution+in+situ+analysis+of+mRNA+distribution+in+plants.">A streamlined method for systematic, high resolution in situ analysis of mRNA distribution in plants.</a> Plant Methods. 1, 8 (2005).</li></ol>

No conflicts of interest declared.

식물 세포는 식물 조직 절편 동안 조직 인열 문제를 일으킬 단단한 세포벽 강인한 섬유, 결정, 높은 수분 함량을 갖는다. 파라핀 계 단면 자주 식물 조직에 사용 되더라도 내인성 결정들은 (도 1) 절편 동안 식물 조직을 가르기. 때문에 식물 세포 내에서 본질적으로 높은 수분 함량, 저온 유지 절편 기반 자주 끊어 세포 금 조직 절편시킨다. 본 연구에서는 하이브리드 컷라는 이름의 결합 파라핀 삽입 및 동결 절단 (Cryosections) 프로토콜을 개발하고 좋은 품질의 조직 절편을 얻었다. 이 프로토콜은 파라핀 삽입을 도입하여 높은 수분 함량과 관련된 문제를 해결하고, (그림 3) 절편 동안 낮은 온도에서 파라핀 왁스를 경화에 의해 찢어 효과를 감소시킨다. 따라서이 수정 된 프로토콜은 하나 파라핀 기반 SECTIO 이상 유리하다닝 또는 식물 조직의 무결성을 유지하기위한 냉동 절편. 이 원고는 하이브리드 컷 방법 결정 (그림 3-4)의 높은 수준을 포함하는 등 겨드랑이 새싹, 씨앗, 그리고 PLB, 같은 호 접 난초의 많은 조직에서 조직의 무결성을 유지 것을 보여줍니다. 또한,이 프로토콜은 높은 실리카 (그림 5-6)를 포함 생식 기관, 쌀, 옥수수 잎, 밀 같은 곡물 의무가 있습니다. 아마도,이 프로토콜은 높은 섬유를 함유하는 우디 플랜트에 적용될 수있다. 일반적으로, 고정 조직은 철저히 하이브리드 컷 매우 중요하다. 우리는 포름 알데히드 알코올 산성 산 (FAA) 정착는 PFA는 축 방향 등 싹, 뿌리, 그러나, PFA는 RNA의 무결성을 보존에 FAA보다 더 나은 작품으로 일부 완강히 저항하는 조직의 조직 무결성을 유지하는 것보다 낫다 발견했다. 따라서 PFA는 해결하는 것이 좋습니다현장 하이브리드에서 (ISH) 작업 샘플. 여기에 설명 된 프로토콜을 RNA ISH 실험을 위해 설계된다. 따라서, 모든 시약은 DEPC 처리 된 RNase하여 오염을 제거하여 RNA 분해를 방지하기 위해 제조 하였다. 하이브리드 컷 부분은 해부학 적 연구, 일반 역 삼투압 (RO) 물과 파생 버퍼 또는 시약은 허용합니다. 3 mm 이하로 시험편 크기 및 두께를 감소하기위한 침투 유용하다. 또한, 탈수 및 침투에 대한 증가 침지 시간은 하드 질감 조직을 위해 필요하다. 이 프로토콜의 제한은 불충분 한 고정, 탈수, 그리고 시편의 침투로 인한 문제로 인해 수 있습니다. 따라서, 각 단계에 대한 처리 시간의 조정은 우수한 파라핀 블록을 생성하는 것이 중요하다. 일반적으로, 더 열심히 조직은 부드러운 조직보다 처리 시간 이상이 필요합니다. 또한, 우리는 하이브리드 컷 조합 위스콘신에서 성공적 일 것으로 나타났다제 ISH 선택된 사체 (도 7)의 공간 분포를 제공한다. 요약하면,이 프로토콜은 식물 해부학의 연구에 유용하고, 선택된 유전자의 조직 특이 적 RNA지도를 제공합니다. 또한 그러한 터미널 데 옥시 뉴 클레오 타이 딜 트랜스퍼 dUTP 닉 엔드 (nick end) 표지화 (TUNEL) 분석, 형광성 원위치 하이브리드 화 (FISH), 및 면역 기술과 같은 다른 분자 연구에 적용될 수있다. 결론적으로,이 개선 된 조직 절편 프로토콜은 유용하고 식물 사회 연구원에 도움이 둘입니다.

파라핀 계 단면 처리 방법은, 해부학 적 연구가 광범위하게 사용되는 기술이다. 손상 조직의 해부학의 보존 형태 학적 및 생물학적 연구에 중요하다. 파라핀이 매립 세포 및 조직 형태를 유지하고 있기 때문에, 파라핀 포매 절편 기술이 유리하다. 또한, 파라핀 블록은 오랫동안 편리하게 저장 될 수있다. 그러나, 파라핀 절편 세포 내 결정을 포함하는 식물 조직에 적합하지 않다. 세포 내 결정은 종종 절편 동안 파라핀 리본과 손상 조직의 무결성을 찢어. 파라핀 절편 달리 저온 절편 비교적 빠르며 섹션은 고정 직렬 탈수 또는 중간 침투 한 매립하지 않고 얻을 수있다. 저온부 많은 같은 면역와 같은 응용 프로그램에서 현장 하이브리드 및 효소 조직 화학와 호환됩니다. 냉동 절편의 또 다른 장점은이 방법은 높은 온도와 화학적 처리 등의 잠재적 인 변성 과정을 통과하지 않는, 그래서 세포 분자 잘 조직 2 항 내에서 유지됩니다. 냉동 절편은 일반적으로 파라핀 계 동물 조직에서의 연구에 절편 위에 바람직하다. 온도 차는 것은 때때로 부분의 무결성의 품질에 영향을 얼음 결정의 형성을 초래하기 때문에, 저온 절편 식물의 첫번째 선택이 아니다. 삼투는 수 크로스 용액, 폴리에틸렌 글리콜 (PEG) 또는 글리세롤 (3)로 동결 조건 결정 얼음 형성을 감소하는 것으로보고되었지만, 개선 최적 이하이다. 서로 다른 환경에 적응하기 위해 다른 식물은 종종 별개의 조직 질감과 식물 세포가 단단한 세포벽, 거친 섬유 및 결정 4,5를 형성하기 위해 진화해야합니다. 예를 들어, 불용성 칼슘 옥살 레이트 결정 실리카 몸은 비슷한 공통식물 6. 규산 몸은 / 결정 공장 건축, erectness을 유지하는 데 도움이, 시리얼 공장 7-9에서 질병이나 해충을 방지하기 위해보고되었다. 화분에 심는 난초와 컷 꽃 난초 시장이 번성하고, 그것은 성장하는 산업이다. 접 아프로디테 (엄 난초)는 대만에서 가장 중요한 수출 관상용 식물 중 하나입니다. 상당한 노력이 접 난초의 꽃 프로세스의 형태 학적 및 생리 학적 변화를 이해하게되었습니다. 호 접 난초의 꽃 스파이크는 잎 기지에서 겨드랑이 싹에서 시작됩니다. 멋진 주변 온도의 기간 후에 (약 반 개월), 겨드랑이 싹이 확대, 휴면 휴식, 젊은 꽃 스파이크로 개발하기 위해 잎 기지에서 돌출. 생리 학적, 세포 및 스파이크 개시 분자 과정을 이해하기 위해서는 visua하는 해부학 강력한 기술을 개발하는 것이 필수적이다적시에 리제 조직 또는 마커. 그러나, 런 조직에서 편재 결정의 존재는 특히 겨드랑이 싹 해부학 작업이 곤란한다. 여기에서 우리는 지금까지 기술적 도전으로 간주 된 난 분해성 식물 조직의 섹션의 무결성을 개선하기 위해 노력했다. 여기에서 우리는 하이브리드 컷라는 이름의 개선 된 프로토콜을 보여줍니다. 이는 저온 유지 장치를 이용하여 수행되는 파라핀 계 단면 처리 방법이다. 파라핀 삽입은 식물 조직에서 높은 수분 함량을 해결합니다. 파라핀 블록은 낮은 온도에서 경화 단면, 문제를 찢어 결정을 줄이고, 상당히 조직의 무결성을 향상시킨다. 이 프로토콜은 크게 완강히 저항하는 식물 샘플에 대한 조직의 무결성을 향상시킨다.

<table border="0" cellpadding="0" cellspacing="0" width="734">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Embedding Center model EC780-1</td>
			<td style="width:127px;">CSA</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Microtome model RM2255</td>
			<td style="width:127px;">Leica</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Cryostat model CM 1950</td>
			<td style="width:127px;">Leica</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Axio Scope A1 microscope&#160;</td>
			<td style="width:127px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Murashige &#38; Skoog medium including vitamins</td>
			<td style="width:127px;">Duchefa Biochemia</td>
			<td style="width:119px;">M0222.0050</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">RNase free surface decontaminant</td>
			<td style="width:127px;">Apex</td>
			<td style="width:119px;">10-228</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Diethyl pyrocarbonate (DEPC)</td>
			<td style="width:127px;">Bio Basic Inc.&#160;</td>
			<td style="width:119px;">D801154</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Sodium chloride (NaCl)</td>
			<td style="width:127px;">MDBio, Inc.</td>
			<td style="width:119px;">101-7647-14-5</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:321px;">Potassium chloride, crystal (KCl)</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">7447-40-7</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:321px;">Sodium phosphate dibasic (NA2HPO4)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7558-79-4</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:321px;">Potassium phosphate monobasic (KH2PO4)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7778-77-0</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Paraformaldehyde (PFA)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">16005</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Sodium hydroxide (NaOH)</td>
			<td style="width:127px;">Showa</td>
			<td style="width:119px;">19430160</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:321px;">Sulfuric acid (H2SO4)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7664-93-9</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Glutaraldehyde solution</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">111-30-8</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Polyoxyethylene 20 sorbitan monolaurate (Tween 20)</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">9005-64-5</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Octyl Phenol Ethoxylate (Triton X100)</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">9002-93-1</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Glass scintillation vials</td>
			<td style="width:127px;">Newastar</td>
			<td style="width:119px;">DG60805-00020</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:321px;">Desiccator vacuum</td>
			<td style="width:127px;">Violet Bioscience Inc.</td>
			<td style="width:119px;">TS-402030</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Rotary vane pump RZ2.5</td>
			<td style="width:127px;">Vacuubrand</td>
			<td style="width:119px;">36149406</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Ethanol</td>
			<td style="width:127px;">J.T. Baker</td>
			<td style="width:119px;">64-17-5</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Sub-X&#160;</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3803670</td>
			<td style="width:167px;">Xylene substitute</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Paraplast Plus&#160;</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">39602004</td>
			<td style="width:167px;">Tissue embedding paraffin</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">SUPERFROST micro slide glass</td>
			<td style="width:127px;">Matsunami</td>
			<td style="width:119px;">S7441</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:321px;">FSC 22 Clear&#160;</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3801480</td>
			<td style="width:167px;">Optimal Cutting Temperature compound (OCT)&#160;</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Xylenes, Purified</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3803665</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Hematoxylin</td>
			<td style="width:127px;">Merck</td>
			<td style="width:119px;">HX305311</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Hydrochloric acid (HCl)</td>
			<td style="width:127px;">Sigma-Aldrich</td>
			<td style="width:119px;">7647-01-0</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">Micromount</td>
			<td style="width:127px;">Leica Surgipath</td>
			<td style="width:119px;">3801731</td>
			<td style="width:167px;">Mounting medium</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">pGEM T-easy vector</td>
			<td style="width:127px;">Promega</td>
			<td style="width:119px;">A1360</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Proteinase K</td>
			<td style="width:127px;">Roche</td>
			<td style="width:119px;">3115879001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">SP6/T7 DIG RNA Labeling Kit</td>
			<td style="width:127px;">Roche</td>
			<td style="width:119px;">11175025910</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:321px;">NBT/BCIP stock solution</td>
			<td style="width:127px;">Roche</td>
			<td style="width:119px;">11681451001</td>
			<td style="width:167px;"></td>
		</tr>
	</tbody>
</table>

hybrid-cut: an improved sectioning method for recalcitrant plant tissue samples

식물 부분의 무결성을 유지하는 세포, 조직, 또는 기관 수준에서 해부학 적 구조의 상세한 연구를 위해 필수적이다. 그러나, 일부 식물 세포는 단단한 세포벽 강인한 섬유 결정을 (옥살산 칼슘, 실리카 등), 및 높은 수분 함량은 종종 식물 조직 절편 동안 조직의 무결성을 파괴하는. 이 연구는 간단한 하이브리드 잘라 조직 절편 방법을 설정합니다. 이 프로토콜은 파라핀 계 단면 기법을 수정 및 다른 식물의 조직 절편의 무결성을 향상시킨다. 식물 조직은 -16 ℃에서 저온 유지 장치 (cryostat)에 절편 전에 파라핀 하였다. 파라핀 블록, 감소 찢어 및 긁힘, 크게 개선 된 조직의 무결성은 낮은 온도에서을 경화 단면. 이 프로토콜은 성공적으로 생식 ORGA 칼슘 옥살 레이트 풍부한 호 접 난초 조직뿐만 아니라 난 분해성 조직에 적용 하였다NS, 쌀, 옥수수, 밀 잎. 또한, 하이브리드 컷 조직 절편의 높은 품질은 관심 유전자의 발현 패턴의 공간을 제공하기 위해 원위치 혼성화 (ISH)의 병용 할 수있다. 결론적으로,이 프로토콜은 높은 결정 실리카 함량을 함유 분해성 식물 조직에 특히 유용하다. 좋은 품질의 조직 섹션은 형태 학적 및 기타 생물학적 연구를 할 수 있습니다.

하이브리드 컷은 조직 섹션의 무결성을 향상 생식 꽃 구조의 해부학을 이해하는 것은 난초 꽃 개시의 기본 메커니즘을 조사하는 것이 중요하다. 그러나 호 접 난초의 세포 내 칼슘 옥살 레이트 결정의 축적은 연구에게 도전적인 작업을합니다. 섹션화 처리 (도 1) 중에 결정 의한 찢어짐과 관련된 문제를 피하기 위해, 우리는 하이브리드 컷라고하는 시스템을 개발 하였다. 이 프로토콜은 기존의 파라핀 삽입 및 동결 절단 (Cryosections) 기술을 결합합니다. 우리는 최초의 하이브리드 컷들이 조직 강성과 높은 결정 내용에 대한 악명 때문에 접 난초의 겨드랑이 새싹에서 테스트. 겨드랑이 새싹 조직은 4 % PFA에서 수정되었습니다 (프로토콜, 단계 1.3 참조). 시리얼 에탄올 탈수 및 파라핀 왁스 난 후nfiltration, 겨드랑 꽃 봉오리는 파라핀 블록에 포함되었다. 블록은 (그림 2A)을 절편하기 전에 적당한 크기로 손질했다. 의 OCT 소량 후 저온 유지 단계 (도 2b)의 중앙에 적용 하였다. 파라핀 블록이어서 10월 통해 스테이지에 부착 하였다. 스테이지는 (도 2c)를 전 단면 처리의 OCT 완전한 응고를 허용하도록 10 분 동안 저온 유지 장치에서 배양 한 후, 동결 절단 (Cryosections)는 -16에서 수행 하였다 ° C 챔버 (그림 2D). 비교로서, 접 난초의 겨드랑이 새싹이 포함 된 파라핀 블록은 일반 마이크로톰 절편을 실시 하였다. 도 1a에 도시 된 바와 같이, 파라핀 리본 심한 인열은 마이크로톰 절편 후에 관찰 하였다. 조직의 무결성 및 세포의 구조는 (그림 1B) 손상되었다. 하이브리드 컷 반면보존 된 구조적 완전성 (도 3b)로 생성 손상 조직 절편 (도 3A). 적용 P.의 다양한 조직에 하이브리드 - 컷 아프로디테 또한 하이브리드 컷의 복종 할 의무를 테스트하기 위해, 우리는 호 접 난초의 다른 조직을 테스트했다. 이 때문에 경화 시드 코트 잘 조직 무결성 종자 부분을 획득하는 것이 어렵다. 이 프로토콜을 이용하여, 종자의 상세한 구조 (도 4a)를 절편 한 후 유지 하였다. 도 4a 단백질 체에 도시 된 바와 같이, 공통 스토리지 제품 (14)은 명확하게 식별 될 수있다. 하이브리드 컷이 성공적으로 일을하고 한 달 오래 protocorm의 촬영 혀끝의 분열 조직 (씨앗에서 발아 구조) (그림 4B)의 세부 구조를 보여protocorm 같은-기구 (PLBs, 그림 4C). 세포 내 결정은 두껍고 즙이 많은 잎 PLB. 호 접 난초의 섹션에서이 관찰되었다 그들은 CAM 식물 (CAM) 형 광합성 (15)을 수행합니다. 리프 블레이드의 횡단면은 목부와 사부 (도 4d)를 포함하는 많은 엽육 세포 관다발을 보였다. 몇몇 기공 개구 낮 (도 4d) 동안에 축외 잎 표면을 관찰 하였다. 사실, CAM 식물 탄소 이득을 최대화하지만, 동시에 건조 조건 하에서 15,16 밤 그들의 stomates를 열어 물 손실을 최소화하도록 진화. P.의 루트 혀끝의 분열 조직 아프로디테는 그림 4E에 표시됩니다. 루트 팁 세포는 잘 (도 4E)를 절편 한 후 보존 된 결정의 상당수를 포함 나타났다. 젊은 꽃 스파이크의 길이 섹션은 정보 흐름을 제공젊은 꽃 primordials (그림 4 층)의 구조에 대해 이온. 또한, 꽃받침 잎은 꽃잎, labellum 및 pollinia 명확하게이 5mm 꽃 봉오리 (그림 4 세대)의 분화를 완료 한 젊은 꽃 봉오리의 종단면에서 확인 할 수있다. 결정이 젊은 꽃 봉오리의 꽃받침 잎에 축적 된 것을 알 수 있습니다. 즉,이 프로토콜은 조직 무결성을 유지하기 위해 지속적으로 작동하고 해부학 가능한 세포의 연구를 가능 본래 형태를 생성한다. 하이브리드 컷은 시리얼 작물의 조직 무결성을 보존 우리는 또한 하이브리드 컷 높은 실리카 함량 (17, 18)를 포함하는 쌀, 밀, 옥수수 등의 곡물 테스트. 도 5에 도시 된 바와 같이, 쌀, 밀, 옥수수 잎의 횡단면의 조직 무결성 크게 향상되었다 하이록BRID 컷 방법을. 수분 손실을 방지하기 위해 리프 블레이드의 롤링을 제어 목부, 체관부, 엽육 세포 stomates 및 bulliform 세포 명확 벼 잎의 섹션에서 확인되었다. 크란츠 해부학, 엽육 세포와 옥수수 잎 (19, 20)의 관다발이 명확하게 확인되었다. 옥수수 잎 (그림 5)의 향축과 배축 양측에 stomates의 높은 밀도를 찾을 흥미로운했다. 옥수수 0.7의 향축과 배축 기공의 비율은 이전 21보고되었다. 또한,이 프로토콜은 쌀, 밀, 옥수수 (도 6)에서 이삭의 상세한 세포 형태를 제공하기 위해 성공적으로했다. 이삭이 풍부한 실리카 구를 포함하는 것으로 알려져있다. 일반적으로, 그 조직 절편을 수행에 어려움이 발생합니다. 현장 하이브리드에 인 - 시튜 하이브리드 화 (ISH)는 티슈 레벨 11에서의 유전자 발현 패턴 국산화 개발되었으며, 22-25. 또한, ISH 셀룰러 제공 할 수있는 경우 서브 셀룰러 다세포 유기체 26 mRNA의 분포 해상도. ISH 중에 RNA 조직 무결성 선택된 스크립트에 대한 신뢰성있는 공간 정보를 얻는 것이 중요하다. 우리는 하이브리드 컷 프로토콜을 사용하여 ISH 테스트 액틴 유전자 (PATC157348가) 프라이머 5&#39;-GGCAGAGTATGATGAATCTGGTCC-3 &#39;와 5&#39; AGGACAGAAGTTCGGCTGGC -3&#39;242 bp의 PCR의 증폭 사이클린의 B1 얻을 사용하여 복제되었다.. 1 (PATC146999) 유전자가 특정을 코딩 서열 사용하여 프라이머 5&#39;-TCGTAGCAAGGTTGCTTGTG-3 &#39;와 5&#39; ATGAGCATGGCGCTAATACC-3&#39;327 bp의를 얻기 위해 PCR 증폭 물. ISH, 액틴과 사이클린은 B1 후 : 1 유전자 발현 젊은 성숙한 겨드랑이 새싹에서 모니터링 하였다 강한 신호가 3 차 겨드랑이 싹이 검출와 (그림 7). 두 유전자는, 2 차 및 3 차 겨드랑이 새싹의 분열 세포에서 발현되었다. 이러한 결과는 하이브리드 컷 좋은 해부학을 유지하고 공간 유전자 발현 패턴을 제공하고 있다고 설명했다. <img alt="그림 1" src="/files/ftp_upload/54754/54754fig1.jpg" /> 그림 1 : 전통적인 파라핀 섹션 조직의 심한 찢어 원인 접 난초의 겨드랑이 새싹이 포함 된 파라핀 블록은 일반 마이크로톰 절편을 실시 하였다.. 파라핀 리본의 심한 파열이 전통적인 마이크로톰 절편 후 관찰되었다 (A) </strong&gt;. 조직의 무결성 및 세포 구조는 (B) 손상되었다. 화살표는 조직 절편의 심한 인열을 나타낸다. 화살촉은 결정 몸을 보여줍니다. 스케일 바 100 μm의. <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/54754/54754fig2.jpg" /> 그림 2 :. 하이브리드 컷 단면의 메소드 겨드랑 꽃 봉오리 조직은 PFA에서 수정되었습니다 및 조직은 파라핀 왁스와 함께 침투, 탈수 및 파라핀 블록에 포함. 파라핀 블록을 적당한 크기 (A)로 트리밍 하였다. 최적의 절단 온도 화합물 OCT ()는 저온 유지 스테이지 (B)의 중심에 적용 하였다. 파라핀 블록은 저온 유지 장치 무대에서 OCT를 부착했다. 저온 하에서, 파라핀 블록<html> 10월 (C)를 통해 저온 유지 스테이지에 부착 하였다. 조직 슬라이스는 -16 ° C의 (D)에서 저온 유지 챔버에서 절단 하였다. 스케일 바는 0.5 cm (A), 1 cm (BD)를 나타냅니다. <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/54754/54754fig3.jpg" /> 그림 3 : 하이브리드 컷 절 무결성을 향상 접 난초의 겨드랑이 새싹이 포함 된 파라핀 블록 (A)를 절편 하이브리드 컷을 실시하고, 하이브리드 컷 방법은 우수한 조직의 무결성 (B)와 섹션을 생산.. 화살촉은 겨드랑이 새싹 조직에 포함 된 내생 결정 몸을 보여줍니다. 스케일 바 100 μm의.rget = &quot;_ 빈&quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 4" src="/files/ftp_upload/54754/54754fig4.jpg" /> 그림 4 :. 하이브리드 잘라 접 난초의 다양한 조직 섹션에 다른 난초의 응용 프로그램 조직은 성숙 단계 (A), protocorm의 종단면 (B), protocorm 같은 기관의 종단면 (PLB) (C)의 횡단면 동안 난초 씨의 종단면으로, 하이브리드 컷 방법을 사용하여 구분 하였다 잎 블레이드 (D), 루트 (E)의 종단면, 젊은 꽃 스파이크 (F), 젊은 꽃 봉오리 (G)의 종단면의 종단면. 조직 섹션은 헤 마톡 실린으로 염색 하였다. SC, 종피; PB 단백질 본체; 엠,분열 조직; MP, 어머니 PLB; DP, 딸 PLB; 광고, 향축 잎 표면; AB, 배축 잎 표면; 성, 기공; MC, 엽육 세포; VB, 혈관 번들; RC, 루트 캡; FB, 꽃 봉오리; 자체, 꽃받침; PE, 꽃잎; 라, labellum; 포, pollinia; 롬, rostellum; 캘리포니아, 캘러스. 화살촉은 결정을 보여줍니다. 스케일 바는 20 μm의 (AE) 200 μm의 (FG)를 나타냅니다. <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/54754/54754fig5.jpg" /> 그림 5 :. 하이브리드 컷이 여러 시리얼 작물의 잎 조직의 무결성을 보존 전통적인 파라핀 방법 (왼쪽 패널) 및 연구 (오른쪽 패널)에서 개발 된 하이브리드 컷 기술을 사용하여 잎 조직의 비교. 이미지는 쌀, 밀, 옥수수의 잎 가로 섹션을 보여줍니다. MC, 엽육 세포; 박사, 체관부; 성, 기공; BC, BU<html> lliform 세포. 화살표는 조직 절편의 파열을 보여줍니다. 화살촉은 실리카 몸을 보여줍니다. 파란색 점선 원은 C4 옥수수에서 크란츠 해부학을 나타냅니다. 규모는 20 μm의 바. <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 6" src="/files/ftp_upload/54754/54754fig6.jpg" /> 그림 6 :. 하이브리드 컷이 여러 시리얼 작물의 이삭 조직 무결성을 보존 전통적인 파라핀과 하이브리드 컷 방법 사이 이삭 부분의 조직 무결성의 비교. 화살표는 조직 절편의 파열을 보여줍니다. 화살촉은 실리카 몸을 나타냅니다. 스케일 바 20 μm의 (쌀), 200 μm의 (밀, 옥수수). <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 1 &quot;&gt; :&quot;유지 - together.within 페이지 = FO &quot;천만에 <img alt="그림 7" src="/files/ftp_upload/54754/54754fig7.jpg" /> 그림 7 : 액틴과 CyclinB1의 제자리 교잡에서, 호 접 난초 2 차 겨드랑이 새싹과 3 차 겨드랑이 새싹의 조직 조각이 하이브리드 컷 방법을 사용하여 제조되었다의 겨드랑이 버드 1 식 패턴.. 액틴 및 CyclinB1 40 NG 총 1 파기 표지 된 프로브가 혼성화에 사용 하였다. 감지 탐침은 음성 대조군으로 사용 하였다. 화살표는 겨드랑이 새싹의 생식 분열 조직을 나타냅니다. 규모는 100 μm의 바. <a href="http://ecsource.jove.com/files/ftp_upload/54754/54754fig7large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples at JoVE.com

Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

하이브리드 컷 : 난 분해성 식물 조직 샘플에 대한 개선 단면 방법

Maintaining plant section integrity is essential for studying detailed anatomical structures at the cellular, tissue, or even organ level. However, some ...

hybrid-cut-an-improved-sectioning-method-for-recalcitrant-plant

Nanyang Technological University

Research

JoVE Journal

Biology

18.8K 조회수.  Academia Sinica. This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).

비디오: Hybrid-Cut: An Improved Sectioning Method for Recalcitrant Plant Tissue Samples

Thin Sectioning of Slice Preparations for Immunohistochemistry

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been preserved, freshly removed, or excised but kept viable, as in slice preparations of brain tissue.  Subsequent microscopic studies of this material can be challenging, as the tissue samples may be difficult to handle.  Demonstrated here is a method for obtaining thin cryostat sections of tissue with a thickness that may range from 0.2-5.0 mm.  We routinely cut 400 micron thick Vibratome brain slices serially into 5-10 micron coronal cryostat sections.  The slices are typically first used for electrophysiology experiments and then require microscopic analysis of the cytoarchitecture of the region from which the recordings were observed.  We have constructed a simple device that allows controlled and reproducible preparation and positioning of the tissue slice.  This device consists of a cylinder 5 cm in length with a diameter of 1.2 cm, which serves as a freezing stage for the slice.  A ring snugly slides over the cylinder providing walls around the slice allowing the tissue to be immersed in freezing compound (e.g., OCT).  This is then quickly frozen with crushed dry ice and the resulting  wafer  can be position easily for cryostat sectioning.  Thin sections can be thaw-mounted onto coated slides to allow further studies to be performed, such as various staining methods, in situ hybridization, or immunohistochemistry, as demonstrated here.

The present method allows reproducible cryostat sectioning of small, difficult-to-manage, tissue pieces, such as biopsies and brain slices. We utilize a simple aluminum freezing stage to facilitate handling of tissue and a standard cryostat to routinely produce 5-10 micron serial sections from 400 micron thick brain slices.

Immunohistochemistry에 대한 슬라이스 준비 씬 Sectioning

Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been ...

연구

생물학

Testing Nicotine Tolerance in Aphids Using an Artificial Diet Experiment

Plants may upregulate the production of many different seconday metabolites in response to insect feeding. One of these metabolites, nicotine, is well know to have insecticidal properties. One response of tobacco plants to herbivory, or being gnawed upon by insects, is to increase the production of this neurotoxic alkaloid. Here, we will demonstrate how to set up an experiment to address this question of whether a tobacco-adapted strain of the green peach aphid, Myzus persicae, can tolerate higher levels of nicotine than the a strain of this insect that does not infest tobacco in the field.

In this video and assay is demonstrated that tests the tolerance of nicotine to two types of aphids one that infests tobacco plants in the field and one that does not.

인공 다이어트 실험을 사용하여 Aphids에 니코틴 공차 테스트

Plants may upregulate the production of many different seconday metabolites in response to insect feeding. One of these metabolites, nicotine, is well ...

Agar-Block Microcosms for Controlled Plant Tissue Decomposition by Aerobic Fungi

The two principal methods for studying fungal biodegradation of lignocellulosic plant tissues were developed for wood preservative testing (soil-block; agar-block). It is well-accepted that soil-block microcosms yield higher decay rates, fewer moisture issues, lower variability among studies, and higher thresholds of preservative toxicity. Soil-block testing is thus the more utilized technique and has been standardized by American Society for Testing and Materials (ASTM) (method D 1413-07). The soil-block design has drawbacks, however, using locally-variable soil sources and in limiting the control of nutrients external (exogenous) to the decaying tissues. These drawbacks have emerged as a problem in applying this method to other, increasingly popular research aims. These modern aims include degrading lignocellulosics for bioenergy research, testing bioremediation of co-metabolized toxics, evaluating oxidative mechanisms, and tracking translocated elements along hyphal networks. Soil-blocks do not lend enough control in these applications. A refined agar-block approach is necessary.
Here, we use the brown rot wood-degrading fungus Serpula lacrymans to degrade wood in agar-block microcosms, using deep Petri dishes with low-calcium agar. We test the role of exogenous gypsum on decay in a time-series, to demonstrate the utility and expected variability. Blocks from a single board rip (longitudinal cut) are conditioned, weighed, autoclaved, and introduced aseptically atop plastic mesh. Fungal inoculations are at each block face, with exogenous gypsum added at interfaces. Harvests are aseptic until the final destructive harvest. These microcosms are designed to avoid block contact with agar or Petri dish walls. Condensation is minimized during plate pours and during incubation. Finally, inoculum/gypsum/wood spacing is minimized but without allowing contact. These less technical aspects of agar-block design are also the most common causes of failure and the key source of variability among studies. Video publication is therefore useful in this case, and we demonstrate low-variability, high-quality results.

This video demonstrates a controlled environment approach to study degradation of lignocellulosic plant tissues by aerobic fungi. The ability to control nutrient sources and moisture is a key advantage of agar-block microcosms, but the approach often yields mixed success. We address critical pitfalls to yield reproducible, low-variability results.

에어로빅 곰팡이에 의해 제어 플랜트 조직 분해에 대한 한천 - 블럭 Microcosms

The two principal methods for studying fungal biodegradation of lignocellulosic plant tissues were developed for wood preservative testing (soil-block; ...

Genotyping of Plant and Animal Samples without Prior DNA Purification

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and animal tissues (Figure 1). Direct PCR is based on specially engineered Thermo Scientific Phusion and Phire DNA Polymerases, which include a double-stranded DNA binding domain that gives them unique properties such as high tolerance of inhibitors.
PCR-based target DNA detection has numerous applications in plant research, including plant genotype analysis and verification of transgenes. PCR from plant tissues traditionally involves an initial DNA isolation step, which may require expensive or toxic reagents. The process is time consuming and increases the risk of cross contamination1, 2. Conversely, by using Thermo Scientific Phire Plant Direct PCR Kit the target DNA can be easily detected, without prior DNA extraction. In the model demonstrated here, an example of derived cleaved amplified polymorphic sequence analysis (dCAPS)3,4 is performed directly from Arabidopsis plant leaves. dCAPS genotyping assays can be used to identify single nucleotide polymorphisms (SNPs) by SNP allele-specific restriction endonuclease digestion3. 
Some plant samples tend to be more challenging when using Direct PCR methods as they contain components that interfere with PCR, such as phenolic compounds. In these cases, an additional step to remove the compounds is traditionally required2,5. Here, this problem is overcome by using a quick and easy dilution protocol followed by Direct PCR amplification (Figure 1). Fifteen year-old oak leaves are used as a model for challenging plants as the specimen contains high amounts of phenolic compounds including tannins. 
Gene transfer into mice is broadly used to study the roles of genes in development, physiology and human disease. The use of these animals requires screening for the presence of the transgene, usually with PCR. Traditionally, this involves a time consuming DNA isolation step, during which DNA for PCR analysis is purified from ear, tail or toe tissues6,7. However, with the Thermo Scientific Phire Animal Tissue Direct PCR Kit transgenic mice can be genotyped without prior DNA purification. In this protocol transgenic mouse genotyping is achieved directly from mouse ear tissues, as demonstrated here for a challenging example where only one primer set is used for amplification of two fragments differing greatly in size.

The Direct PCR approach presented here facilitates PCR amplification directly from small amounts of unpurified plant and animal tissue.

이전 DNA의 정제없이 식물과 동물 샘플의 Genotyping

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and ...

An Improved Method for Accurate and Rapid Measurement of Flight Performance in Drosophila

Drosophila has proven to be a useful model system for analysis of behavior, including flight. The initial flight tester involved dropping flies into an oil-coated graduated cylinder; landing height provided a measure of flight performance by assessing how far flies will fall before producing enough thrust to make contact with the wall of the cylinder. Here we describe an updated version of the flight tester with four major improvements. First, we added a &#34;drop tube&#34; to ensure that all flies enter the flight cylinder at a similar velocity between trials, eliminating variability between users. Second, we replaced the oil coating with removable plastic sheets coated in Tangle-Trap, an adhesive designed to capture live insects. Third, we use a longer cylinder to enable more accurate discrimination of flight ability. Fourth we use a digital camera and imaging software to automate the scoring of flight performance. These improvements allow for the rapid, quantitative assessment of flight behavior, useful for large datasets and large-scale genetic screens.

An Improved Method for Accurate and Rapid Measurement of Flight Performance in Drosophila

Here we describe a method for rapid and accurate measurement of flight performance in Drosophila, enabling high-throughput screening.

비행 성능의 정확하고 빠른 측정을위한 개선 된 방법에<em&gt; 초파리</em

Drosophila has proven to be a useful model system for analysis of behavior, including flight. The initial flight tester involved dropping flies into an ...

An Efficient Method for Quantitative, Single-cell Analysis of Chromatin Modification and Nuclear Architecture in Whole-mount Ovules in Arabidopsis

In flowering plants, the somatic-to-reproductive cell fate transition is marked by the specification of spore mother cells (SMCs) in floral organs of the adult plant. The female SMC (megaspore mother cell, MMC) differentiates in the ovule primordium and undergoes meiosis. The selected haploid megaspore then undergoes mitosis to form the multicellular female gametophyte, which will give rise to the gametes, the egg cell and central cell, together with accessory cells. The limited accessibility of the MMC, meiocyte and female gametophyte inside the ovule is technically challenging for cytological and cytogenetic analyses at single cell level. Particularly, direct or indirect immunodetection of cellular or nuclear epitopes is impaired by poor penetration of the reagents inside the plant cell and single-cell imaging is demised by the lack of optical clarity in whole-mount tissues.
Thus, we developed an efficient method to analyze the nuclear organization and chromatin modification at high resolution of single cell in whole-mount embedded Arabidopsis ovules. It is based on dissection and embedding of fixed ovules in a thin layer of acrylamide gel on a microscopic slide. The embedded ovules are subjected to chemical and enzymatic treatments aiming at improving tissue clarity and permeability to the immunostaining reagents. Those treatments preserve cellular and chromatin organization, DNA and protein epitopes. The samples can be used for different downstream cytological analyses, including chromatin immunostaining, fluorescence in situ hybridization (FISH), and DNA staining for heterochromatin analysis. Confocal laser scanning microscopy (CLSM) imaging, with high resolution, followed by 3D reconstruction allows for quantitative measurements at single-cell resolution.

An Efficient Method for Quantitative, Single-cell Analysis of Chromatin Modification and Nuclear Architecture in Whole-mount Ovules in Arabidopsis

We provide here an efficient and reliable protocol for immunostaining, Fluorescence in&#160;situ Hybridization, DNA staining followed by quantitative, high-resolution imaging in whole-mount Arabidopsis thaliana ovules. This method was successfully used to analyze chromatin modifications and nuclear architecture.

전체 마운트 난자에있는 염색질 수정 및 핵 구조의 정량, 단일 세포 분석을위한 효율적인 방법<em&gt; 애기 장대</em

In flowering plants, the somatic-to-reproductive cell fate transition is marked by the specification of spore mother cells (SMCs) in floral organs of the ...

Method for Measuring the Activity of Deubiquitinating Enzymes in Cell Lines and Tissue Samples

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, techniques for studying the regulatory mechanism of this system are essential to elucidating the cellular and molecular processes of the aforementioned diseases. The use of hemagglutinin derived ubiquitin probes outlined in this paper serves as a valuable tool for the study of this system. This paper details a method that enables the user to perform assays that give a direct visualization of deubiquitinating enzyme activity. Deubiquitinating enzymes control proteasomal degradation and share functional homology at their active sites, which allows the user to investigate the activity of multiple enzymes in one assay. Lysates are obtained through gentle mechanical cell disruption and incubated with active site directed probes. Functional enzymes are tagged with the probes while inactive enzymes remain unbound. By running this assay, the user obtains information on both the activity and potential expression of multiple deubiquitinating enzymes in a fast and easy manner. The current method is significantly more efficient than using individual antibodies for the predicted one hundred deubiquitinating enzymes in the human cell.

The current protocol details a method for measuring the activity of functionally homologous deubiquitinating enzymes. Specialized probes covalently modify the enzyme and allow for detection. This method holds the potential to identify new therapeutic targets.

세포주 및 조직 샘플에서 Deubiquitinating 효소의 활성을 측정 방법

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, ...

A Fast Air-dry Dropping Chromosome Preparation Method Suitable for FISH in Plants

Preparation of chromosome spreads is a prerequisite for the successful performance of fluorescence in situ hybridization (FISH). Preparation of high quality plant chromosome spreads is challenging due to the rigid cell wall. One of the approved methods for the preparation of plant chromosomes is a so-called drop preparation, also known as drop-spreading or air-drying technique. Here, we present a protocol for the fast preparation of mitotic chromosome spreads suitable for the FISH detection of single and high copy DNA probes. This method is an improved variant of the air-dry drop method performed under a relative humidity of 50%-55%. This protocol comprises a reduced number of washing steps making its application easy, efficient and reproducible. Obvious benefits of this approach are well-spread, undamaged and numerous metaphase chromosomes serving as a perfect prerequisite for successful FISH analysis. Using this protocol we obtained high-quality chromosome spreads and reproducible FISH results for Hordeum vulgare, H. bulbosum, H. marinum, H. murinum, H. pubiflorum and Secale cereale.

A protocol is described for the preparation of high-quality mitotic plant chromosome spreads by a fast air-dry dropping method suitable for the FISH detection of single and high copy DNA probes.

식물에서 물고기에 적합한 빠른 공기 건조 떨어 뜨리 염색체 제조 방법

Preparation of chromosome spreads is a prerequisite for the successful performance of fluorescence in situ hybridization (FISH). Preparation of high ...

Improved Swiss-rolling Technique for Intestinal Tissue Preparation for Immunohistochemical and Immunofluorescent Analyses

Understanding the role of factors that regulate intestinal epithelial homeostasis and response to injury and regeneration is important. The current literature describes several different methodological approaches to obtain images of intestinal tissues for data validation. In this paper, we delineate a common protocol relating to the derivation and processing of mouse intestinal tissues. Proper fixation of intestinal tissues and Swiss-roll techniques that enhance intestinal epithelial morphology are discussed. Postresection processing and reorientation of embedded intestinal tissues are critical in obtaining paraffin-embedded blocks that display intact intestinal structural features after sectioning. The Swiss-rolling technique helps in histological assessment of the complete intestinal or colonic sections examined. An ability to differentiate intestinal structural features can be vital in quantitative measurements of intestinal inflammation and tumorigenesis along the entire length. Finally, paraffin-embedded sections are ideal for robust processing using both immunohistochemical and immunofluorescent detection methods. Nonfluorescent immunohistochemical sections provide a vibrant image of the tissue detailing different cellular structural features but do not provide flexibility for intracellular co-localization experiments. Multiple fluorescent channels can be appropriately utilized with immunofluorescent detection for co-localization experiments, lending support to mechanistic studies.

Accurate identification and location of epithelial cells along the intestinal mucosal lining are essential to define different cell lineages. Proper imaging of intestinal tissues is crucial for identification of protein expression patterns with maximum resolution. This study aims to delineate the optimal methods and conditions for processing mouse intestinal tissues.

면역 조직 화학적 및 면역 형광 분석을위한 창자 조직 준비를위한 향상된 스위스 압연 기술

Understanding the role of factors that regulate intestinal epithelial homeostasis and response to injury and regeneration is important. The current ...

An Easy Method for Plant Polysome Profiling

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues. A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After centrifugation, six fractions are directly collected from the bottom to the top of the gradient, without piercing the ultracentrifugation tube. During collection, the absorbance at 260 nm is read continuously to generate a polysome profile that gives a snapshot of global translational activity. Fractions are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis thaliana seedlings and adult plants, Nicotiana benthamiana, Solanum lycopersicum, and Oryza sativa leaves.

This protocol describes an easy method to extract and fractionate transcripts from plant tissues on the basis of the number of bound ribosomes. It allows a global estimate of translation activity and the determination of the translational status of specific mRNAs.

공장 Polysom​​e 프로파일 링을위한 쉬운 방법

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the ...