ברצוננו להודות ג פולדה (מרכז מיקרוסקופי אלקטרונים, רוסטוק אונ&#39;, גרמניה) עבור התמיכה הטכנית ברכישת תמונות TEM של חלקיקים פאראמגנטי מסוננים בביצוע ניתוח רנטגן שלהם. העבודה מתבצעת על רוסטוק RTC נתמכה על ידי המשרד הפדרלי לחינוך ולמחקר גרמניה (FKZ 0312138A, FKZ 316,159 ו VIP + 03VP00241) ואת פומרניה מדינת מקלנבורג-מערב עם הקרנות המבניות של האיחוד האירופי (ESF / IV-WM-B34- 0030/10 ו ESF / IV-BM-B35-0010 / 12) ועל ידי DFG (DA 1296-1), ורטיבות-קרן, וקרן הלב גרמנית (F / 01/12). פרנק Wiekhorst נתמכה על ידי תוכנית המחקר FP7 האיחוד האירופי &quot;Nanomag&quot; FP7-NMP-2013-גדול 7.

אין לנו שום אינטרסים כלכליים מתחרים לחשוף.

את ייצור תאי מהונדסים גנטית עמוסה חלקיקים פאראמגנטי לקבלת הנחיות נוספות מגנטית נשלטת שלהם מוצג בפרוטוקול הנוכחי. היישום המוצלח של אסטרטגיה זו מאפשר לפתרון קשיים מסוימים של טיפול בתא, כגון החזקה נמוכה engraftment העני באזור נפצע 2, 3, <s...

ג&#39;ין וטיפול תא הם כלים רבים עצמה יש פוטנציאל לפתור אתגרים נוכחיים בטיפול CVD. למרות העובדה כי הן הגישות הללו נבדקות כעת בניסויים קליניים, הם עדיין אינם מוכנים ליישום קליני רחב 1. יש לציין, גישה משותפת להתמודדות עם האתגרים של גן לבין טיפול בתא היא לפתח וקטורים למסירת גן רבים תכליתיים מתאימים ליישום קליני. היעדר מערכות למסירת הגן בטוחות ויעילות הוא הדאגה העיקרית של ריפוי גנטי. במקביל, ההנדסה הגנטית של מוצרי הסלולר לפני ההשתלה יכולה להתגבר על האתגרים הרציניים של טיפול בתא, כגון יעילות נמוכה (למשל, בתחום הלב, רק ~ 5% של שיפור תפקודי מושגת פוסט-תאי גזע להשתלת 1 ) ושימור / engraftment עני באתר של פציעה (כלומר, החזקת תא יורד מתחת 5 - 10% בתוך דקות עד שעות POst-יישום, ללא קשר לתוואי ממשל 2, 3, 4). נכון להיום, וקטורים ויראליים מאוד יעלו מערכות שאינן ויראליות במונחים של יעילות, אשר הביאה היישום הרחב יותר שלהם בניסויים קליניים (~ 67%) 5. עם זאת, כלי רכב ויראלי לשאת בסיכונים חמורים, כגון חיסוני (ואת התגובה הדלקתית שלאחר מכן, עם סיבוכים חמורים), oncogenicity, ומגבלות בגודל של החומר הגנטי הנישא 6. בשל חששות בטיחות אלה לבין העלויות הגבוהות של ייצור וקטור ויראלי, השימוש במערכות הלא-ויראלית עדיף במקרים מסוימים 7, 8. היא מתאימה במיוחד עבור הפרעות הדורשות תיקון גנטי חולף, כגון הביטוי של גורמי גדילה השליטה אנגיוגנזה (למשל, לטיפול CVD) או deliveר&quot;י של חיסונים. בקבוצה שלנו, מערכת מסירה תוכננה על ידי שילוב מסועף 25-kDa polyethyleneimine (תש&quot;ן) ואת חלקיקי תחמוצת ברזל פאראמגנטי (MNP) קשורים יחדיו על ידי האינטראקציה ביוטין- streptavidin 9. וקטור זה הוא כלי פוטנציאלי עבור הנדסה גנטית של תאי, המאפשר המגנטיזציה שלהם סימולטני לפני ההשתלה. זה האחרון מספק בסיס הדרכה / שימור מגנטי, אשר מבטיחה במיוחד בימינו, כמו טכניקות מיקוד מגנטיות מתקדמות מפותח בהצלחה 10. יתר על כן, התא מגנטי תגובה וכתוצאה מכך יש את הפוטנציאל להיות פולשני במעקב דימות בתהודה מגנטית (MRI) או הדמית חלקיקים מגנטית 11, 12. במקרה של וקטור PEI / MNP, polyamine מבטיח התעבות חומצות גרעין ובכך הגנה מפני גורם משפיל<html> ים, הפנמת וקטור בתאים, ו endosomal להימלט 5. MNPs משלימים את המאפיינים של PEI, לא רק במונחים של הדרכה מגנטי, אלא גם על ידי הפחתת הרעילות 7 הידוע PEI, 13, 14. בעבר, תש&quot;ן / נכסים וקטור MNP הותאמו מבחינת יעילות משלוח (כלומר, pDNA ו מירנה) ובטיחות באמצעות פיברובלסטים ותאי גזע mesenchymal אנושי 15, 16. בכתב היד הזה, פרוטוקול מפורט על היישום של PEI / MNPs עבור הדור של תאי-modified מירנה מתואר 17. לשם כך, HUVECs משמש ומהווה מודל הוקם עבור אנגיוגנזה במבחנה. הם מאתגר transfect והם רגישים השפעה רעילה 18, 19,התחת = &quot;Xref&quot;&gt; 20. בנוסף, אנו מספקים אלגוריתם להעריך תאים כאלה במבחנה, כולל מיקוד שלהם, תקשורת בין-תאית, וזיהוי MRI.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

נכון להיום, הטיפולים כירורגיים תרופתיים הזמינים עבור מחלות לב וכלי דם (CVD) מוגבלים ולעתים קרובות פליאטיבי. במקביל, טיפולי גני תא הם מאוד גישות חלופיות מבטיחות לטיפול CVD. עם זאת, היישום הקליני הרחב של ריפוי גנטי מוגבל מאוד על ידי חוסר מערכות למסירת הגן מתאימות. ההתפתחות של וקטורים למסירת הגן מתאימים יכולה לספק פתרון לאתגרים נוכחיים טיפול בתא. בפרט, חסרונות קיימים, כגון יעילות מוגבלת ושימור תאי נמוך ב האיבר נפצע, ניתן להתגבר על ידי הנדסת תא מתאימה (כלומר, גנטי) לפני ההשתלה. הפרוטוקול המובא מתאר את השינוי החולף היעיל ובטוח של תאי האנדותל באמצעות ננו-חלקיקים מגנטיים פאראמגנטי polyethyleneimine (PEI / MNP) וקטור משלוח מבוסס. כמו כן, האלגוריתם ושיטות לאפיון תאים מוגדרים. Intracellu המוצלחמסירה של microRNA (miR) לתוך האדם ורידים טבורי תאים אנדותל (HUVECs) הושגה מבלי להשפיע על כדאיות התא, פונקציונליות, או תקשורת בין תאיים. יתר על כן, גישה זו הוכחה לגרום השפעה תפקודית חזקה מיר exogenous הציג. חשוב לציין, היישום של וקטור זה מבוסס MNP מבטיח מגנטיזציה התא, עם אפשרויות נלוות של מיקוד מגנטי לא מעקב פולשני MRI. זה עשוי לספק בסיס מגנטי מונחה, מהונדס גנטית תרפויטים תא שניתן לפקח ללא פולשנית עם MRI.

המטרה העיקרית של הפרוטוקול המוצע היא לייצר מגנטי תגובת תאי miR-modified וכדי לנהל האפיון המדויק שלהם (איור 1). כתוצאה מכך, תאי transfected ביעילות, מגיבים בחירה מגנטית והדרכה לזיהוי באמצעות MRI, יש לקבל. <p class="jove_content" fo:keep-together.within-page="1" style=";text-align:right;directi...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

כתב היד הזה מתאר את משלוח יעיל, שאינו ויראלי של miR לתאי אנדותל ידי וקטור PEI / MNP ו המגנטיזציה שלהם. לכן, בנוסף שינוי גנטי, גישה זו מאפשרת להדרכת תא מגנטית ויכולת גילוי MRI. הטכניקה יכולה לשמש כדי לשפר את המאפיינים של מוצרי תא טיפוליים.

הכנה<em&gt; במבחנה</em&gt; אפיון ממוגנטים miR-modified לתאי אנדותל

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

preparation-vitro-characterization-magnetized-mir-modified

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

7.6K Views.  University of Rostock.  כתב היד הזה מתאר את משלוח יעיל, שאינו ויראלי של miR לתאי אנדותל ידי וקטור PEI / MNP ו המגנטיזציה שלהם. לכן, בנוסף שינוי גנטי, גישה זו מאפשרת להדרכת תא מגנטית ויכולת גילוי MRI. הטכניקה יכולה לשמש כדי לשפר את המאפיינים של מוצרי תא טיפוליים. 

Video: Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full thickness corneal transplantation has been the treatment to restore sight in those limited by corneal disease. Some disadvantages to this approach include a high degree of post-operative astigmatism, lack of predictable refractive outcome, and disturbance to the ocular surface. The development of Descemet's stripping endothelial keratoplasty (DSEK), transplanting only the posterior corneal stroma, Descemet's membrane, and endothelium, has dramatically changed treatment of corneal endothelial disease. DSEK is performed through a smaller incision; this technique avoids 'open sky' surgery with its risk of hemorrhage or expulsion, decreases the incidence of postoperative wound dehiscence, reduces unpredictable refractive outcomes, and may decrease the rate of transplant rejection3-6.
Initially, cornea donor posterior lamellar dissection for DSEK was performed manually1 resulting in variable graft thickness and damage to the delicate corneal endothelial tissue during tissue processing. Automated lamellar dissection (Descemet's stripping automated endothelial keratoplasty, DSAEK) was developed to address these issues. Automated dissection utilizes the same technology as LASIK corneal flap creation with a mechanical microkeratome blade that helps to create uniform and thin tissue grafts for DSAEK surgery with minimal corneal endothelial cell loss in tissue processing.
Eye banks have been providing full thickness corneas for surgical transplantation for many years. In 2006, eye banks began to develop methodologies for supplying precut corneal tissue for endothelial keratoplasty. With the input of corneal surgeons, eye banks have developed thorough protocols to safely and effectively prepare posterior lamellar tissue for DSAEK surgery. This can be performed preoperatively at the eye bank. Research shows no significant difference in terms of the quality of the tissue7 or patient outcomes8,9 using eye bank precut tissue versus surgeon-prepared tissue for DSAEK surgery. For most corneal surgeons, the availability of precut DSAEK corneal tissue saves time and money10, and reduces the stress of performing the donor corneal dissection in the operating room. In part because of the ability of the eye banks to provide high quality posterior lamellar corneal in a timely manner, DSAEK has become the standard of care for surgical management of corneal endothelial disease.
The procedure that we are describing is the preparation of the posterior lamellar cornea at the eye bank for transplantation in DSAEK surgery (Figure 1).

Endothelial corneal transplantation is a surgical technique for treatment of posterior corneal diseases. Mechanical microkeratome dissection to prepare tissue results in thinner, more symmetric grafts with less endothelial cell loss and improved outcomes. Dissections can be performed at the eye bank prior to corneal transplantation surgery.

קרנית התורם רקמות הכנה Keratoplasty האנדותל

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

בידוד, אפיון והשוואתי התמיינות של תאי גזע אנושיים שיניים זולות נגזרה שיניים קבועות על ידי שימוש בשתי שיטות שונות

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying mechanisms involved in it are useful for treatment. There are both in vivo and in vitro methods available for this purpose. In vivo models can mimic actual head injury as it occurs during TBI. However, in vivo techniques may not be exploited for studies at the cell physiology level. Hence, in vitro methods are more advantageous for this purpose since they provide easier access to the cells and the extracellular environment for manipulation.
Our protocol presents an in vitro model of TBI using stretch injury in brain microvascular endothelial cells. It utilizes pressure applied to the cells cultured in flexible-bottomed wells. The pressure applied may easily be controlled and can produce injury that ranges from low to severe. The murine brain microvascular endothelial cells (cEND) generated in our laboratory is a well-suited model for the blood brain barrier (BBB) thus providing an advantage to other systems that employ a similar technique. In addition, due to the simplicity of the method, experimental set-ups are easily duplicated. Thus, this model can be used in studying the cellular and molecular mechanisms involved in TBI at the BBB.

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

In vitro traumatic brain injury models are being developed to reproduce in vivo brain deformation. Stretch-induced injury has been employed for astrocytes, neurons, glial cells, aortic, and brain endothelial cells. However, our system uses a blood brain barrier (BBB) model that possesses properties constituting a legitimate model of the BBB to establish an in vitro&#160;TBI model.

למתוח בתאי אנדותל כלי הדם במוח (cEND) כ<em&gt; במבחנה</em&gt; פגיעה מוחי טראומטי דגם של מחסום דם המוח

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to extravasate and form a secondary niche.&#160;The extravasation of tumor cells from the blood vascular system can be studied using endothelial cells (ECs) and tumor cells obtained from different cell lines.&#160;Initial studies were conducted using static conditions but it has been well documented that ECs behave differently under physiological flow conditions.&#160;Therefore, different flow chamber assemblies are currently being used to studying cancer cell interactions with ECs.&#160;Current flow chamber assemblies offer reproducible results using either different cell lines or fluid at different shear stress conditions.&#160;However, to observe and study interactions with rare cells such as circulating tumor cells (CTCs), certain changes are required to be made to the conventional flow chamber assembly.&#160;CTCs are a rare cell population among millions of blood cells. Consequently, it is difficult to obtain a pure population of CTCs.&#160;Contamination of CTCs with different types of cells normally found in the circulation is inevitable using present enrichment or depletion techniques.&#160;In the present report, we describe a unique method to fluorescently label circulating prostate cancer cells and study their interactions with ECs in a self-assembled flow chamber system.&#160;This technique can be further applied to observe interactions between prostate CTCs and any protein of interest.

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Our report describes a unique method to visualize and analyze CTC/EC interactions in prostate cancer under physiological flow conditions.

בשיטה חוץ גופית כדי לבחון אינטראקציות בתיווך-E-selectin בין תאים סרטניים בערמונית מחזור שמקורם בתאי חולים ואנדותל האנושי

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, along with its basement membrane (Descemet&#39;s membrane) is introduced onto the recipient&#39;s posterior stroma3. Unlike Descemet&#8217;s Stripping Automated Endothelial Keratoplasty (DSAEK), where additional donor stroma is introduced, no unnatural stroma-to-stroma interface is created. As a result, the natural anatomy of the cornea is preserved as much as possible allowing for improved recovery time and visual acuity4. Endothelial Keratoplasty (EK) is the procedure of choice for treatment of endothelial dysfunction. The advantages of EK include rapid recovery of vision, preservation of ocular integrity and minimal refractive change due to use of a small, peripheral incision1. DSAEK utilizes donor tissue prepared with partial thickness stroma and endothelium. The rapid success and utilization of this procedure can be attributed to availability of eye-bank prepared precut tissue. The benefits of eye-bank preparation of donor tissue include elimination of need for specialized equipment in the operating room and availability of back up donor tissue in case of tissue perforation during preparation. In addition, high volume preparation of donor tissue by eye-bank technicians may provide improved quality of donor tissue. DSAEK may have limited best corrected visual acuity due to creation of a stromal interface between the donor and recipient cornea. Elimination of this interface with transplantation of only donor Descemet&#39;s membrane and endothelium in DMEK may improve visual outcomes and reduce complications after EK5. Similar to DSAEK, long term success and acceptance of DMEK is dependent on ease of availability of precut, eye-bank prepared donor tissue. Here we present a stepwise approach to donor tissue preparation which may reduce some barriers eye-banks face in providing DMEK grafts.

Endothelial keratoplasty is a surgical technique continuously evolving as advancements result in transplantation of thinner grafts with each succession1. Here we present a technique for controlled manual tissue dissection to allow safe and repeatable separation of endothelium and Descemet&#39;s membranes from donor corneoscleral buttons for transplantation2.

הכנת רקמות התורמות קרנית לממברנה האנדותל Keratoplasty של Descemet

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The approach allows unbiased identification and functional characterization of individual colorectal afferents. Extracellular recordings of propagated action potentials (APs) that originate from one or a few afferent (i.e., single-fiber) receptive fields (RFs) in the colorectum are made from teased nerve fiber fascicles. The colorectum is removed with either the pelvic (PN) or lumbar splanchnic (LSN) nerve attached and opened longitudinally. The tissue is placed in a recording chamber, pinned flat and perfused with oxygenated Krebs solution. Focal electrical stimulation is used to locate the colorectal afferent endings, which are further tested by three distinct mechanical stimuli (blunt probing, mucosal stroking and circumferential stretch) to functionally categorize the afferents into five mechanosensitive classes. Endings responding to none of these mechanical stimuli are categorized as mechanically-insensitive afferents (MIAs). Both mechanosensitive and MIAs can be assessed for sensitization (i.e., enhanced response, reduced threshold, and/or acquisition of mechanosensitivity) by localized exposure of RFs to chemicals (e.g., inflammatory soup (IS), capsaicin, adenosine triphosphate (ATP)). We describe the equipment and colorectum&#8211;nerve recording preparation, harvest of colorectum with attached PN or LSN, identification of RFs in the colorectum, single-fiber recording from nerve fascicles, and localized application of chemicals to the RF. In addition, challenges of the preparation and application of standardized mechanical stimulation are also discussed.

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

This video demonstrates a protocol for conducting single-fiber electrophysiological recordings on an in vitro mouse colorectum-nerve preparation.

באפיון פונקציונלי מבחנה של עכבר המעי הגס מביא Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

לומד סרטן לבלב גזע מאפייני תא לפיתוח טיפול חדש אסטרטגיות

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model for developing new angiogenesis inhibitors for cancer. However, long-term in vitro expansion of murine endothelial cells (EC) is challenging due to phenotypic drift in culture (endothelial-to-mesenchymal transition) and contamination with non-EC. This is especially true for TEC which are readily outcompeted by co-purified fibroblasts or tumor cells in culture. Here, a high fidelity isolation method that takes advantage of immunomagnetic enrichment coupled with colony selection and in vitro expansion is described. This approach generates pure EC fractions that are entirely free of contaminating stromal or tumor cells. It is also shown that lineage-traced Cdh5cre:ZsGreenl/s/l reporter mice, used with the protocol described herein, are a valuable tool to verify cell purity as the isolated EC colonies from these mice show durable and brilliant ZsGreen fluorescence in culture.

We report a reliable method to isolate and culture primary tumor-specific endothelial cells from genetically engineered mouse models.

הרחבת בידוד והתרבות של תאי האנדותל גידול ספציפי

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study vasculogenesis, (tumor) angiogenesis, and atherosclerosis. The current standard for in vitro research on human endothelial cells (ECs) is the use of Human Umbilical Vein Endothelial Cells (HUVECs) and Human Umbilical Artery Endothelial Cells (HUAECs). For canine endothelial research, only one cell line (CnAOEC) is available, which is derived from canine aortic endothelium. Although currently not completely understood, there is a difference between ECs originating from either arteries or veins. For a more direct approach to in vitro functionality studies on ECs, we describe a new method for isolating Canine Primary Endothelial Cells (CaPECs) from a variety of vessels. This technique reduces the chance of contamination with fast-growing cells such as fibroblasts and smooth muscle cells, a problem that is common in standard isolation methods such as flushing the vessel with enzymatic solutions or mincing the vessel prior to digestion of the tissue containing all cells. The technique we describe was optimized for the canine model, but can easily be utilized in other species such as human.

Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

בידוד והתרבות של תאי האנדותל ראשיים מן העורקים וורידים לכלבים

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Forskolin-induced נפיחות מעיים Organoids: An<em&gt; במבחנה</em&gt; Assay עבור הערכת תגובה לתרופה בחולי סיסטיק פיברוזיס

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...