עבודות המחקר דיווח בפרסום זה נתמך על ידי הלאומית המכון כללי רפואי למדעים של מכוני הבריאות הלאומיים תחת פרס מספר R35GM124913 PI4D מאוניברסיטת Purdue תמריץ התוכנית, PVM פנימי תחרותי תוכנית קרנות מחקר בסיסי. התוכן הוא אך ורק באחריות המחברים, ואינם מייצגים בהכרח את הנופים הרשמי של הסוכנים מימון. אנו מודים קואיצ'י Kawakami על Tol2 הבונה, מייקל לין עבור הבונה ASAP1, ולבנות לאונרד Zon ייצוג המקדם ubi דרך Addgene.

דג זברה מוחזקים במתקן בעל חיים שאושרו על-ידי AAALAC, כל הניסויים בוצעו לפי הפרוטוקולים אושרה על ידי טיפול בעלי חיים פרדו שימוש הוועדה (PACUC).
1. Tol2 Transposon פלסמיד לבנות הכנה
הערה: Tol2, transposon שנתגלה בשנת medaka דגים, נרחב שימש ב8,9קהילת המחקר דג זברה. כבר בהצלחה לאמץ את שער ספציפי לאתר רקומבינציה מערכת מבוססת-שיבוט, המכונה ערכת Tol210. ערכת Tol2 מאפשר דרך נוחה יותר של יצירת ביטוי אישית בונה, בעת גם להגדיל את היעילות של transgenesis. לכן היה החלטה קלה כדי לנצל את היתרון של מערכת זו, וליצור בכל מקום ASAP1 ביטוי דג זברה קו באמצעות מקדם המאומת אוביקוויטין לנהוג ASAP111.
<ol><li>יצירת מבנה התיכון כניסה ASAP1: pDONR221-ASAP1<ol>
<li>רוכשים הבונה חיישן ASAP1 מתח מקודדים גנטית, pcDNA3.1/פורו-חטיבתי-ASAP1 (פלסמיד #52519), מ- Addgene. כדי להגביר את האזור קידוד ASAP1, להגדיר PCR באמצעות את אישית תחל (attB1-ASAP1F ו- attB2-ASAP1R) תמר מוקף עם רצפים attB בקצה 5' של תחל (איור 1). Phusion DNA פולימראז נבחרתי שלה יעילות גבוהה, תנאי ה-PCR אופטימציה בהתבסס על פרוטוקול שפורסמו בעבר12.</li>
		<li>טען את המוצרים PCR µL 50 % 1 טה ג'ל באמצעות פיפטה רגיל עם טיפים µL 200, ולבצע אלקטרופורזה-160 V במיכל אופקי ג'ל למשך כ- 30 דקות.</li>
		<li>בדוק את הג'ל תחת transilluminator UV (353 nm), לסלק את הלהקה הרצוי באמצעות אזמל/להב תחת transilluminator UV שפורסמו בעבר13,14ו להכניס המכיל ג'ל לדנ microcentrifuge mL 1.5 נקי שפופרת.</li>
		<li>לבצע טיהור ג'ל עבור המוצרים ASAP1 PCR. לשחזר את ה-DNA הג'ל נכרת שימוש מסחרי DNA ג'ל ערכת טיהור בעקבות ההוראה של היצרן, elute את ה-DNA לתוך 20 µL של מים. קח 1 µL כמדגם, מודדים את ריכוז הדנ א באמצעות ספקטרופוטומטרים. זורמים ההוראות תוכנה באמצעות מים כמו בקרה הריק15.</li>
		<li>קח 100 ננוגרם של לטהר המוצר PCR ומערבבים אותו עם 150 ng של פלסמיד pDONR221 ב- 10 µL של טה מאגר (10 מ מ טריס, 1 מ מ EDTA pH 8.0)16. להוסיף 2 µL של BP Clonase השני לתוך התגובה, דגירה התגובה בטמפרטורת החדר למשך הלילה.</li>
		<li>ביום השני, להוסיף 1 µL של proteinase K לתוך התגובה, דגירה התגובה ב 37 מעלות צלזיוס למשך 30 דקות.</li>
		<li>לבצע טרנספורמציה. להעביר את התגובה ומערבבים אותו עם µL 50 של Top10 המוסמכת e. coli תאים, דגירה התאים על קרח למשך 30 דקות. אז, העברת הצינור התגובה לתוך אמבט מים 42 ° C עבור מינימלית 1 מיד להסיר את הצינור, דגירה על קרח למשך 2 דקות. בשלב הבא, לשים את הצינור לתוך מטרף 37 ° C, דגירה זה מאובטח.</li>
		<li>תוציאי את הצינור, צלחת התאים לצלחת kanamycin ליברות. בשלב הבא, דגירה את הצלחת בן לילה (16-18 h) ב 37 º C.</li>
		<li>לבחור אחת, מופרדים היטב מושבות, לחסן אותם לתוך צינורות תרבות תא 14 מ עם 3 מ ל LB בינוני. תרבות אותם בן לילה ב 37 מעלות צלזיוס ב שייקר עם מהירות סיבוב של 250 סל"ד (סיבוב לדקה).</li>
		<li>לבצע miniprep באמצעות ערכת miniprep מסחרי בעקבות ידנית את ההוראה17.</li>
		<li>רצף פלסמידים 3-4 עם סנגר רצף לזהות pDONR221 חיובי-ASAP1 שיבוטים באמצעות תחל רצף M13F ו- M13R.</li>
	</ol>
</li>
	<li>יצירת הבונה Tol2 עבור microinjection: pDestTol2 -ubi-ASAP1<ol>
<li>לבחור שהרצף לאמת pDONR221-ASAP1 שיבוט ולמדוד את ריכוז הדנ א באמצעות קהל מעריצים ספקטרופוטומטרים ההוראה תוכנה באמצעות מים כפי ריק לשלוט15.</li>
		<li>קח 100 µg של pDONR221-ASAP1, ולערבב עם 100 µg של Tol2 ערכת 5-end פלסמיד (pENTR5'_ubi, Addgene #27320), 100 µg של p3E-תיקים עשויים (ערכת Tol2 #302) ו- 150 µg של pDestTol2pA2 (Tol2 ערכת #394). להתאים את הנפח הכולל כדי 8 µL באמצעות מאגר TE (10 מ מ טריס, 1 מ"מ EDTA, pH 8.0) ב- microcentrifuge 1.5 מ ל צינור ומערבבים היטב על ידי מערבולת קצרה של s 2-5. לאחר מכן, להוסיף 2 µL LR Clonase השנייה פלוס, דגירה התגובה בטמפרטורת החדר למשך הלילה.</li>
		<li>ביום השני, להוסיף 1 µL של proteinase K לתוך התגובה באמצעות פיפטה 10 µL, דגירה התגובה ב 37 מעלות צלזיוס למשך 30 דקות.</li>
		<li>לבצע טרנספורמציה ולזהות שיבוטים חיובי כפי שתואר לעיל (צעדים 1.1.7-11).</li>
		<li>מדד ריכוז ה-DNA רצף לאמת שיבוט pDestTol2-ubi-ASAP1 (איור 1B) באמצעות ספקטרופוטומטרים15. בדרך כלל הריכוז הוא סביב 200ng/µL.</li>
	</ol>
</li>
</ol>2. מכינים Tol2 Transposase mRNA והפתרון הזרקה
<ol><li>רצף של e. coli גליצרול מלאי של פלסמיד pCS2FA-transposase (Tol2 ערכת #396) על צלחת ליברות (עם 100 אמפיצילין µg/mL) באמצעות לולאה חיסון מעוקר. דגירה בן לילה את הצלחת ב 37 מעלות צלזיוס בתוך אינקובטור. למחרת, לבחור שמושבה בודדת, לחסן אותו לתוך 3 מ"ל של ליברות (אמפיצילין µg 100/mL) באמצעות טיפ פיפטה של 10 µL מעוקר. תרבות זה בין לילה ב 37 מעלות צלזיוס ב שייקר עם מהירות סיבוב של 250 סל"ד.</li>
	<li>מבצע miniprep התרבות החיידק באמצעות ערכת miniprep מסחרי בעקבות ההדרכה שלה. Elute דנ א פלסמיד לתוך 30-50 µL טה מאגר על ידי צנטריפוגה דקה-14,000 סל ד, מודדים את ריכוז הדנ א שלה עם ספקטרופוטומטרים.</li>
	<li>Linearize µg 1-2 של פלסמיד עם לא אני endonuclease ולטהר ה-DNA עם ה-DNA בעקבות ההדרכה שלה אחרי לא ערכת ניקוי מערכת העיכול. Elute ה-DNA לתוך 5 µL של מים על ידי צריך שתוציאו ב 14,000 rpm במשך דקה אחת. ריכוז הצפוי הוא על 200-300 ng/µL.</li>
	<li>לבצע תמלול במבחנה עם לא אני לליניארית pCS2FA-transposase בתור תבנית ה-DNA באמצעות ערכת שעתוק SP6 מסחרי.</li>
	<li>לאחר סיום התגובה, לטהר transposase Tol2 mRNA באמצעות ניקוי RNA מסחרי קיט ההוראות של היצרן. לבסוף elute mRNA לתוך מים ללא RNAase µL 20, מודדים את ריכוז ה-RNA בספקטרופוטומטר. ריכוז הצפוי הוא על 1-3 µg / µL. דוגמאות שניתן לאחסן במקפיא-80 ° C במידת הצורך.</li>
	<li>להכין את הפתרון microinjection על ידי ערבוב 20 ng/µL pDestTol2 -ubi-transposase ASAP1, Tol2 ה-mRNA (100 ng/µL) צינור microcentrifuge על ידי pipetting. כדי למנוע השפלה חומצת גרעין הנגרמת על ידי מפשיר חוזרות ונשנות, refreezing, aliquot µL 6 למחזור ואחסן אותו במקפיא-80 ° C לשימוש עתידי.</li>
</ol>3. microinjection
<ol><li>להגדיר 4-6 טנקים רבייה לפחות 2 זכרים ו 2 נקבות אחר הצהריים לפני ההזרקה. הדגים האלה לא חייבים להיות מוזן בשעות אחר הצהריים. שלב זה להפחית את כמות הפסולת דגים ולחסוך זמן כדי לנקות אותם בבוקר שלמחרת, תוך שהיא מסייעת גם לגרום לתגובה הרבייה.</li>
	<li>למחרת בבוקר, להסיר את הפתרון הזרקת מוכן (pDestTol2 -ubi-ASAP1 לבנות, Tol2 mRNA) מהמקפיא-80 ° C, ומניחים אותו על קרח.</li>
	<li>. עצור את המחיצות הדג גידול טנקים ולאפשר את הדגים להזדווג. באופן כללי, דג טהור מטיל ביצים בתוך 20-30 דקות לאחר הוצאת על המפריד. אם לא, להמתין עוד 1-2 שעות. דגים מסוימים יכולים לא להטיל ביצים בכלל. במקרה זה, חזור על הניסוי הזה לאוסף העובר דגים.</li>
	<li>תוך כדי המתנה, ודא כי קיימים המוכנים הקצה נשבר בזווית יצירת קצה שקוע עם מלקחיים, או על ידי שבירת על מגב המשימה העדינה מחטים.<ol>
<li>. תמשכי מחטים נימי זכוכית פולר micropipette באמצעות הפרמטרים הבאים: חום 545; משוך 60; מהירות 80; זמן 250; הלחץ 500. תשבור את המחט עם מלקחיים מתחת טווח לנתיחה (עם העין-קטע סרגל עבור הערכה קוטר) על-ידי החזקת המלקחיים על זווית כ 45 °. מחט הרצוי קטרים יכולים להיות משתנה בהתאם להגדרות microinjector, אבל קוטר קטן הוא מועדף להפחתת תמותת העובר.</li>
	</ol>
</li>
	<li>ברגע הדג יש הטילו ביצים, לאסוף אותם ב 10-ס מ קוטר צלחת פטרי ולהביא אותם על הטווח לנתיחה. הסר כל העוברים לא נורמלי, דגים פסולת.</li>
	<li>Pipet העוברים מופרית לתוך הזריקה מוכנה 3% agarose עובש. הסרת עודפי מים כדי לשמור על העוברים במקום.</li>
	<li>ברגע כל השורות מלאים עם עוברים קיימא, לסדר אותם כך כל התאים פונים לאותו הכיוון לעבר המחט, וזה בערך בזווית של 45° אופקית. פעולה זו תגרום הזרקת קל יותר מאוחר יותר.</li>
	<li>כשאתה לובש כפפות, להשתמש pipet 20 µL הטעינה עצה 5 µL של הבונה מוכן ולהסיר הצינורית על קרח.</li>
	<li>הכנס בקפידה את הטיפ בקצה האחורי של צינור קפילרי שבור כל הדרך עד איפה זה מתחיל כדי מוזג הברים, גם לקבל הכימית קרוב הטיפ. אם יש עדיין בועות אוויר, לנער את המחט, מקפיד לא לשבור את הטיפ.</li>
	<li>את המחט ישר לתוך למחזיק המחט microinjection והדק בזהירות עד המחט נשאר במקום. להתאים את הזווית כדי בערך 45°.</li>
	<li>ברגע המחט הוא מוכן, מצורף, הפעל למיכל לחץ מיקרוסקופ וגז. מסחרית CO2 טנקים טובים בדרך כלל למטרה זו. האחסון ההזרקה מותאם על ידי הלחץ החזקה, הוצאה: משוער psi 0.5 להחזקת ו- 30 psi לניתוק. הקפד לבדוק כי הפתרון יוצא בעת לחיצה על הדוושה.</li>
	<li>באמצעות מיקרומטר על הבמה עם טיפה של שמן מינרלי, להתאים את עוצמת הקול ואת הזרימה של הפתרון מיקרומטר ~ 150 קוטר (על 2 nL). ודא כי הלחץ גב יאפשר כמות קטנה לטפטף החוצה של המחט. אם אין לחץ מספיק אחורי, נימיות תגרום נוזל מזין את המחט ולהשמיד את ה-mRNA.</li>
	<li>ברגע שהמחט מכויל, מתחילים הזרקת הבונה לתוך התא הבודד של העוברים מופרית. הערה: פעולה זו מעבירה כמות גדולה של תרגול, סבלנות, עידון, עקב קרום התא קשה לחדור. חשוב להחדיר את הפתרון לתוך התא, לא החלמון, ליצירת דג זברה מהונדס. זה שונה מורפולינו הזרקה. זה לא משנה באיזה צד המחט חודרים לתא ככל הבונה נכנס לתא. Transgenesis יהיה שיעור נמוך מאוד של הצלחה אם מוזרק לתוך החלמון במקום התא. הזרקת תא בודד שלב חשוב גם, או דגים כמירה סומאטית ייווצר. פעולה זו תקטין את הסיכוי transgene נכנס אל תאי הנבט.</li>
	<li>השתמש הקצה של החריץ ג'ל כדי לספק גיבוי כל הזמן העובר במקום ומאפשרת את המחט להפעיל לחץ מבלי להזיז את העובר. לאחר קצה המחט בתא בודד, לחץ על דוושת לשחרר את הכמות הרצויה של פתרון. חזור על תהליך זה עבור כל אחד מהעוברים.</li>
	<li>לאחר השלמת, העברת העוברים מוזרק לתוך תבשיל שכותרתו בהדחה מתוך החריץ agarose עם מערכת מים, פיפטה העברה של mL 3.4 חד פעמיות. אחסן את העוברים חממה 28.5 ° C כדי לתת להם לפתח. בדוק שוב במהלך היום הסרת עוברי דגים מתים ולהחליף מים עם 0.1% מתילן כחול במים דגים.</li>
	<li>כ- 6-8 שעות לאחר ההזרקה, קח 10 הפרט מוזרק דגים עוברי והכן DNA גנומי אותם באמצעות שיטה קטלנית18.</li>
	<li>למחרת בבוקר, להשתמש במיקרוסקופ לנתיחה עם מקור אור זריחה למיין את העוברים מציג GFP ברקמות שאינן-חלמון. אלה העוברים דגים צריך להכיל הבונה מוזרק.</li>
	<li>לבצע Tol2 assay בלו כדי לבדוק את פעילות transposon כפי שתואר לעיל19. אם נכרת פלסמיד יכול להתגלות, לשמור את מוזרק דגים עוברי ולגדל אותם. אם אין פלסמיד נכרת יכול להתגלות, חזור על סינתזת Tol2 mRNA את תהליך microinjection עד להשגת התוצאות החיוביות של Tol2 בלו וזמינותו.</li>
</ol>4. הקמת ASAP1 הטרנסגניים דגים, Tg (ubi: ASAP1)
<ol><li>מגדל את הדגים מוזרק (F0 הדור) לבגרות כמתואר קודם לכן הספר של דג זברה20. זה בדרך כלל לוקח כ 4 חודשים.</li>
	<li>קח יחיד של מבוגרים F0 דגים, לחצות אותו יחיד מול מין wildtype דגים. לאסוף דגים העוברים לאחר הרבייה בהמשך היום. שמור העוברים דגים שנאספו בחממה 28.5 ° C דגים מים עם 0.1% מתילן כחול.</li>
	<li>ביום השלישי, לבדוק את העוברים דגים מתחת למיקרוסקופ לנתיחה פלורסנט עם מסנן ה-GFP. למיין את עוברי דגים ירוק, אם יש כאלה, ולגדל אותם לבגרות כמו F1 ייצור הטרנסגניים דג, Tg (ubi: ASAP1). הערה: יחס Mendelian לא צפויה שכן רוב הדגים0 F הורים כימרות גנטית בחיידקים-קו.</li>
	<li>צלב למבוגרים-דג יחיד של F1 , עם דגים wildtype ולאסוף עוברי דגים. למיין את עוברי דגים ירוק ולגדל אותם לבגרות כמו דג דור2 F. הערה: עוברי דגים-ירוק וירוק צריך להיות קרוב ל- 1:1 אם יש transgene יחיד.</li>
	<li>כדי להציג שינויים פוטנציאל חשמלי בגידול כמו גידולים ממאירים במערכת העצבים ההיקפית נדן (MPNST), לחצות את הדור2 F Tg (ubi: ASAP1) דגים עם rpl35hi258/wt דגים. זה ידוע כי גלוי גידולים להתחיל למצוא בן 6-8 חודש מבוגרים21,22.</li>
</ol>5. הדמיה
<ol><li>תמונת דג זברה עוברי, לקחת מספר F2 הדור המייסד דגים, חוצים אותם עם דגים wildtype בזוגות בודדים. לאסוף דגים עוברי בשלבים התפתחותיים שונים הרצוי בהתאם דג זברה היערכות מדריך23.</li>
	<li>בשלבים המוקדמים של עוברי דגים, לקלף, להסיר chorions של העוברים בזהירות באמצעות זוג מלקחיים תחת טווח לנתיחה ב 10-ס מ קוטר צלחת פטרי עם דגים מערכת מים.</li>
	<li>העברת כמה עוברי דגים על זכוכית והקעורות עם 3% methylcellulose באמצעות פיפטה העברה חד פעמיות של 3.4 מ. התאם את העוברים למיקום הרצוי כדי להציג את הפעילות GFP הסלולר באמצעות מחט מתחת טווח לנתיחה פלורסנט.</li>
	<li>לשלבים נע של עוברי דגים (שגילן עולה על הבמה somite 12), להשתמש מסילייט tricaine 0.05% כדי עזים ומתנגד העוברים דגים לפני העברת שקופיות. בקצרה, עוברי דגים היו צמחו לתוך מסילייט tricaine 0.05% במים דגים עד שהפסיקו שחייה ואיזון הגוף אובדן. בנוסף, להוסיף טיפה של 0.05% מסילייט tricaine עם methylcellulose בשקופית.</li>
	<li>עבור פחות מ-12 somite שלב עוברי דגים, להשתמש במיקרוסקופ מתחם epi-זריחה עם המצלמה תואם, תוכנה עבור הדמיה. שגילן עולה על 12 somite הבמה דגים עוברי, להשתמש במיקרוסקופ לנתיחה קרינה פלואורסצנטית.</li>
	<li>תמונה מתח התא הגידול, תחילה לזהות את הדג עם גידולים MPNST. לאחר מכן, עזים ומתנגד הדג עם מסילייט tricaine 0.05%. עבור הדמיה הר שלמה, מכניסים את הדגים 10-ס מ קוטר צלחת פטרי. כדי להציג את הפעילות החשמלית של תאי הגידול, ייתכן ניסויים דגים גידולים החוצה לאחר כל הר הדמיה.</li>
</ol>

<ol><li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+bioelectricity%3A+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo%5BTitle%5D)+AND+%22Molecular+Biology+of+the+Cell%22%5BJournal%5D)">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li>
<li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential%5BTitle%5D)+AND+%22Trends+in+Neuroscience%22%5BJournal%5D)">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li>
<li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording%5BTitle%5D)+AND+%22Current+Opinion+in+Chemical+Biology%22%5BJournal%5D)">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li>
<li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor%5BTitle%5D)+AND+%22Nature+Neuroscience%22%5BJournal%5D)">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li>
<li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Animal+models+of+human+disease%3A+zebrafish+swim+into+view%5BTitle%5D)+AND+%22Nature+Reviews+Genetics%22%5BJournal%5D)">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li>
<li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hooked%21+Modeling+human+disease+in+zebrafish%5BTitle%5D)+AND+%22Journal+of+Clinical+Investigation%22%5BJournal%5D)">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li>
<li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li>
<li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+a+functional+transposase+of+the+Tol2+element%2C+an+Ac-like+element+from+the+Japanese+medaka+fish%2C+and+its+transposition+in+the+zebrafish+germ+lineage%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Science+USA%22%5BJournal%5D)">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li>
<li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Science+USA%22%5BJournal%5D)">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li>
<li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Tol2kit%3A+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs%5BTitle%5D)+AND+%22Developmental+Dynamics%22%5BJournal%5D)">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li>
<li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish%5BTitle%5D)+AND+%22Development%22%5BJournal%5D)">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li>
<li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Polymerase+chain+reaction%3A+basic+protocol+plus+troubleshooting+and+optimization+strategies%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998(2012).</li>
<li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis%5BTitle%5D)+AND+%22Methods+in+Molecular+Biology%22%5BJournal%5D)">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li>
<li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Extraction+of+DNA+from+agarose+gels%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li>
<li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((NanoDrop+microvolume+quantitation+of+nucleic+acids%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li>
<li>Green, M. R., Sambrook, J. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aGreen%2C+MR+%22Molecular+cloning+%3A+a+laboratory+manual%22">Molecular cloning : a laboratory manual</a>. , Cold Spring Harbor Laboratory Press. (2012).</li>
<li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247(2007).</li>
<li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues%5BTitle%5D)+AND+%22Biotechniques%22%5BJournal%5D)">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), 610, 612, 614 (2007).</li>
<li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Excision+of+the+tol2+transposable+element+of+the+medaka+fish%2C+Oryzias+latipes%2C+in+zebrafish%2C+Danio+rerio%5BTitle%5D)+AND+%22Gene%22%5BJournal%5D)">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li>
<li>Westerfield, M. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aWesterfield%2C+M+%22The+zebrafish+book.+A+guide+for+the+laboratory+use+of+zebrafish+%28Danio+rerio%29%22">The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio)</a>. , 4th edn, Univ. of Oregon Press. (2000).</li>
<li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish%5BTitle%5D)+AND+%22PLoS+Biology%22%5BJournal%5D)">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139(2004).</li>
<li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish%5BTitle%5D)+AND+%22Developmental+Dynamics%22%5BJournal%5D)">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li>
<li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Stages+of+embryonic+development+of+the+zebrafish%5BTitle%5D)+AND+%22Developmental+Dynamics%22%5BJournal%5D)">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li>
<li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery%5BTitle%5D)+AND+%22PLoS+Genetics%22%5BJournal%5D)">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734(2013).</li>
<li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Science+USA%22%5BJournal%5D)">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li>
<li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Potassium+channels+in+cell+cycle+and+cell+proliferation%5BTitle%5D)+AND+%22Philosophical+Transactions+of+the+Royal+Society+of+London+Series+B%22%5BJournal%5D)">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094(2014).</li>
<li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li>
<li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators%5BTitle%5D)+AND+%22Elife%22%5BJournal%5D)">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li>
<li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li>
<li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Science+USA%22%5BJournal%5D)">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li>
</ol>

המחברים אין לחשוף.

למרות הפעילות חשמל רמת הסלולר ורקמות במהלך התפתחות מחלות אנושיות התגלו לפני זמן רב, אין ויוו חשמל השינויים הדינמיים ותפקידיהם ביולוגי נותרו עדיין אינו מודע לקיומם. אחד האתגרים הגדולים הוא להמחיש ולכמת את השינויים חשמל. תיקון קלאמפ טכנולוגיה פריצת דרך עבור מעקב אחר תאים בודדים, אך את ...

ביו מתייחס אנדוגני איתות חשמלי מתווך על ידי תעלות יונים ומשאבות ממוקם על קרום התא1. חילופי יוניים על פני הממברנה התאית, והשינויים בשילוב חשמל פוטנציאלית ועדכניים, חיוניים עבור איתות תהליכים של טמפרמנט תאים עצביים ושרירי. בנוסף, ביו ומעברי יון יש מגוון רחב של תפקודים ביולוגיים חשובים אחרים כולל אחסון אנרגיה, ביוסינטזה של המטבוליט תחבורה. איתות הביו-חשמליות התגלה גם כרגולטור של היווצרות תבנית עובריים, כגון צירים הגוף, מחזור התא, תא בידול1. לפיכך, חיוני להבנת מחלות מולדות אנושיים רבים הנובעים התקנה שגויה של סוג זה של איתות. למרות מלחציים תיקון כבר בשימוש נרחב עבור הקלטה תאים בודדים, הוא עדיין רחוק מלהיות אידיאלי בו זמנית פיקוח על תאים מרובים במהלך התפתחות עובריים בתוך vivo. יתר על כן, מולקולות קטנות רגיש מתח אינם גם אידיאלי עבור יישומים ויוו שלהם specificities, רגישויות וכתוצאה רעילות.
היצירה של מגוון רחב של גנטית מקודד מתח פלורסנט אינדיקטורים (GEVIs) מציע מנגנון חדש כדי להתגבר על בעיה זו, והיא מאפשרת יישום קל ללמוד התפתחות עובריים, למרות שהם נועדו במקור עבור ניטור עצבית תאים2,3. אחד GEVIs זמין כעת הוא האצת חיישן של פוטנציאל פעולה 1 (ASAP1)4. הוא מורכב ללולאה חוץ-תאי של תחום חישה מתח של מתח פוספטאז רגיש, חלבון פלואורסצנטי ירוק permuted באופן מעגלי. לכן, ASAP1 מאפשר הדמיה של שינויים סלולריים פוטנציאל חשמלי (קיטוב: ירוק בהיר; דפולריזציה: ירוק כהה). ASAP1 יש 2 מילי-שניות על לסירוגין קינטיקה, ולא ניתן לעקוב אחר שינוי פוטנציאליים subthreshold4. לכן, כלי גנטי זה מאפשר רמה חדשה של יעילות ניטור בזמן אמת הקינטיות בתאים חיים. הבנה נוספת של התפקידים של ביו בתחום הפיתוח עובריים למחלות רבות, כגון סרטן, שופכים אור חדש על המנגנון הבסיסי, אשר הוא קריטי עבור מחלת טיפול ומניעה.
דג זברה הוכחו במודל בעלי חיים רב עוצמה ללמוד ביולוגיה התפתחותית ו האדם מחלות כולל סרטן5,6. הם חולקים גנים orthologous 70% עם בני אדם, ויש להם ביולוגיה חוליות דומות7. דג זברה מספקים טיפול קל יחסית, בגודל גדול מצמד של ביצים, גנטיקה צייתן, transgenesis קל ופיתוח שקופים חיצוני עובריים, ההופכים אותם מערכת מעולה עבור ויוו הדמיה5,6. עם מקור גדול של דגים מוטנטים קווים כבר נוכח, גנום מלא ברצף, דג זברה תספק מגוון מוגבל יחסית של תגלית מדעית.
כדי לחקור את ויוו בזמן אמת הפעילות החשמלית של תאים, עלינו לנצל של דג זברה מודל המערכת ASAP1. בנייר זה, אנו מתארים כיצד לשלב את החיישן מתח פלורסנט ASAP1 הגנום דג זברה באמצעות Tol2 transposon transgenesis, ותנסו לדמיין את הפעילות החשמלית הסלולר במהלך התפתחות, תנועה זחל דגים, ובבתי גידול בשידור חי .

<table><tbody><tr><td>14mL cell culture tubes</td><td>VWR</td><td>60818-725</td><td>E.Coli culture</td></tr><tr><td>Agarose electrophoresis tank</td><td>Thermo Scientific</td><td>Owl B2</td><td>DNA eletrophoresis</td></tr><tr><td>Agarose RA</td><td>Amresco</td><td>N605-500G</td><td>For making the injection gels</td></tr><tr><td>Attb1-ASAP1-F primer</td><td>IDT DNA</td><td>GGGGACAAGTTTGTACAAAAAA&lt;br /&gt;GCAGGCTTCACCATGGAGACGA&lt;br /&gt;CTGTGAGGTATGAACA</td><td>ASAP1 coding region amplification for subcloning</td></tr><tr><td>Attb2-ASAP1-R primer</td><td>IDT DNA</td><td>GGGGACCACTTTGTACAAGAAA&lt;br /&gt;GCTGGGTCTTAGGTTACCACTTC&lt;br /&gt;AAGTTGTTTCTTCTGTGAAGCCA</td><td>ASAP1 coding region amplification for subcloning</td></tr><tr><td>Bright field dissection scope</td><td>Nikon</td><td>SMZ 745</td><td>Dechorionation, microinjection, mounting</td></tr><tr><td>Color camera</td><td>Zeiss</td><td>AxioCam MRc</td><td>Fish embryo image recording</td></tr><tr><td>Concave slide</td><td>VWR</td><td>48336-001</td><td>For holding fish embryos during imaging process</td></tr><tr><td>Disposable transfer pipette 3.4 ml</td><td>Thermo Scientific</td><td>13-711-9AM</td><td>Fish embryos and water transfer</td></tr><tr><td>Endonuclease enzyme, Not I</td><td>NEB</td><td>R0189L</td><td>For linearizing plasmid DNA</td></tr><tr><td>Epifuorescent compound scope</td><td>Zeiss</td><td>Axio Imager.A2</td><td>Fish embryo imaging</td></tr><tr><td>Epifuorescent stereo dissection scope</td><td>Zeiss</td><td>Stereo Discovery.V12</td><td>Fish embryo imaging</td></tr><tr><td>Fluorescent light source</td><td>Lumen dynamics</td><td>X-cite seris 120</td><td>Light source for fluorescence microscopes</td></tr><tr><td>Forceps #5</td><td>WPI</td><td>500342</td><td>Dechorionation and needle breaking</td></tr><tr><td>Gateway BP Clonase II Enzyme mix</td><td>Thermo Scientific</td><td>11789020</td><td>Gateway BP recombination cloning</td></tr><tr><td>Gateway LR Clonase II Plus enzyme</td><td>Thermo Scientific</td><td>12538120</td><td>Gateway LR recombination cloning</td></tr><tr><td>Gel DNA Recovery Kit</td><td>Zymo Research</td><td>D4002</td><td>DNA gel purification</td></tr><tr><td>Loading tip</td><td>Eppendorf</td><td>930001007</td><td>For loading injection solution into capilary needles</td></tr><tr><td>Methylcellulose (1600cPs)</td><td>Alfa Aesar</td><td>43146</td><td>Fish embryo mounting</td></tr><tr><td>Methylene blue</td><td>Sigma-Aldrich</td><td>M9140</td><td>Suppresses fungal outbreaks in Petri dishes</td></tr><tr><td>Microinjection mold</td><td>Adaptive Science Tools</td><td>TU-1</td><td>To prepare agaorse mold tray for holding fish embryos during injection</td></tr><tr><td>Microinjector</td><td>WPI</td><td>Pneumatic Picopump PV820</td><td>Microinjection injector</td></tr><tr><td>Micro-manipulator</td><td>WPI</td><td>Microinjector MM3301R</td><td>Microinjection operation</td></tr><tr><td>Micropipette puller</td><td>Sutter instrument</td><td>P-1000</td><td>For preparing capillary needle</td></tr><tr><td>Mineral oil</td><td>Amresco</td><td>J217-500ml</td><td>For calibrating injection volume</td></tr><tr><td>mMESSAGE mMACHINE SP6 Transcription Kit</td><td>Thermo Scientific</td><td>AM1340</td><td>mRNA in vitro transcription</td></tr><tr><td>Monocolor camera</td><td>Zeiss</td><td>AxioCam MRm</td><td>Fish embryo image recording</td></tr><tr><td>Plasmid Miniprep Kit</td><td>Zymo Research</td><td>D4020</td><td>Prepare small amount of plasmid DNA</td></tr><tr><td>Plastic Petri dishes</td><td>VWR</td><td>25384-088</td><td>For holding fish or fish embryos during imaging process</td></tr><tr><td>RNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>R1015</td><td>mRNA cleaning after in vitro transcription</td></tr><tr><td>Spectrophotometer</td><td>Thermo Scientific</td><td>NanoDrop 2000</td><td>For measuring DNA and RNA concentrations</td></tr><tr><td>Stage Micrometer</td><td>Am Scope</td><td>MR100</td><td>Microinjection volume calibration</td></tr><tr><td>Thermocycler</td><td>Bio-Rad</td><td>T100</td><td>DNA amplification for gene cloning</td></tr><tr><td>Thin wall glass capillaries</td><td>WPI</td><td>TW100F-4</td><td>Raw glass for making cappilary needle</td></tr><tr><td>Tol2-exL1 primer</td><td>IDT DNA</td><td>GCACAACACCAGAAATGCCCTC</td><td>Tol2 excise assay</td></tr><tr><td>Tol2-exR primer</td><td>IDT DNA</td><td>ACCCTCACTAAAGGGAACAAAAG</td><td>Tol2 excise assay</td></tr><tr><td>TOP10 Chemically Competent E. coli</td><td>Thermo Scientific</td><td>C404006</td><td>Used for transformation during gene cloning</td></tr><tr><td>Tricaine mesylate</td><td>Sigma-Aldrich</td><td>A5040</td><td>For anesthetizing fish or fish embryos</td></tr><tr><td>UV trans-illuminator 302nm</td><td>UVP</td><td>M-20V</td><td>DNA visualization</td></tr><tr><td>Water bath</td><td>Thermo Scientific</td><td>2853</td><td>For transformation process of gene cloning</td></tr></tbody></table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

ביו, איתות חשמלי אנדוגני מתווך על ידי תעלות יונים, משאבות ממוקם על קרום התא, משחק תפקידים חשובים באיתות תהליכים של תאים עצביים ושרירי טמפרמנט של תהליכים ביולוגיים רבים אחרים, כגון עובריים המתבנת התפתחותית. עם זאת, יש צורך ויוו פעילות חשמלית מהפיקוח מופרה חוליות. ההתקדמות של מקודדים גנטית פלורסנט מחוני מתח (GEVIs) הפכו אותה ניתן לספק פתרון עבור האתגר הזה. כאן, אנו נתאר כיצד ליצור דג מחוון הטרנסגניים מתח באמצעות מחוון ויצר מתח, ASAP1 (האצת חיישן של פוטנציאל פעולה 1), כדוגמה. ערכת Tol2, מקדם דג זברה בכל מקום, ubi, נבחרו במחקר זה. נסביר גם את התהליכים של שיבוט בייעודי לאתר שער Tol2 דג זברה מבוסס-transposon transgenesis, את תהליך ההדמיה בשלב מוקדם דגים עוברי ודגים גידולים באמצעות מיקרוסקופ פלורסנטי רגיל. באמצעות קו דגים, מצאנו כי ישנם שינויים מתח חשמלי הסלולר במהלך דג זברה מופרה והתנועה זחל דגים. יתר על כן, זה היה ציין כי כמה דג זברה ממאיר במערכת העצבים ההיקפית נדן גידולים, הגידול התאים היו בדרך כלל מקוטב בהשוואה ל נורמלי הרקמות הסובבות.

בזריקה מוצלחת, יותר מ 50% מוזרק דגים עוברי יציג מידה מסוימת של זריחה ירוק בתאים סומטיים ולא רובם יהיה חיובי על-ידי Tol2 transposon בלו assay (איור 2). אחרי 2-4 דורות של יותר לחצות עם דגים wildtype (עד הדג פלורסנט מגיעים 50%, היחס Mendelian הצפוי), הדג הטרנסגניים שימשו הניסוי הדמיה כ?...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

ויזואליזציה של הפעילות החשמלית הסלולר עוברי מוקדם דג זברה, גידולים

כאן, אנו מראים את התהליך של יצירת קו דג זברה כתב מתח חשמלי הסלולר להמחיש את התפתחות, תנועה, דגים גידול תאים ויוו.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

visualization-cellular-electrical-activity-zebrafish-early-embryos

Research

JoVE Journal

Developmental Biology

8.8K Views.  Purdue University. כאן, אנו מראים את התהליך של יצירת קו דג זברה כתב מתח חשמלי הסלולר להמחיש את התפתחות, תנועה, דגים גידול תאים ויוו.

Video: Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Time-lapse Live Imaging of Clonally Related Neural Progenitor Cells in the Developing Zebrafish Forebrain

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To understand the behavior of neural progenitor cells in the complex in vivo environment, time-lapse live imaging of neural progenitor cells in an intact brain is critically required. In this video, we exploit the unique features of zebrafish embryos to visualize the development of forebrain neural progenitor cells in vivo. We use electroporation to genetically and sparsely label individual neural progenitor cells. Briefly, DNA constructs coding for fluorescent markers were injected into the forebrain ventricle of 22 hours post fertilization (hpf) zebrafish embryos and electric pulses were delivered immediately. Six hours later, the electroporated zebrafish embryos were mounted with low melting point agarose in glass bottom culture dishes. Fluorescently labeled neural progenitor cells were then imaged for 36hours with fixed intervals under a confocal microscope using water dipping objective lens. The present method provides a way to gain insights into the in vivo development of forebrain neural progenitor cells and can be applied to other parts of the central nervous system of the zebrafish embryo.

The present video demonstrates a method which takes advantage of the combination of electroporation and confocal microscopy to perform live imaging on individual neural progenitor cells in the developing zebrafish forebrain. In vivo analysis of the development of forebrain neural progenitor cells at a clonal level can be achieved in this way.

זמן לשגות הדמיה חיה של Related Clonally ובתאים עצבית של פיתוח דג הזברה forebrain

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To ...

Neuroscience

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

Biosensing מוטורית נוירון פוטנציאל ממברנה עוברי דג הזברה חיים

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Live Imaging of the Zebrafish Embryonic Brain by Confocal Microscopy

In this video, we demonstrate the method our lab has developed to analyze the cell shape changes and rearrangements required to bend and fold the developing zebrafish brain (Gutzman et al, 2008). Such analysis affords a new understanding of the underlying cell biology required for development of the 3D structure of the vertebrate brain, and significantly increases our ability to study neural tube morphogenesis. The embryonic zebrafish brain is shaped beginning at 18 hours post fertilization (hpf) as the ventricles within the neuroepithelium inflate. By 24 hpf, the initial steps of neural tube morphogenesis are complete. Using the method described here, embryos at the one cell stage are injected with mRNA encoding membrane-targeted green fluorescent protein (memGFP). After injection and incubation, the embryo, now between 18 and 24 hpf, is mounted, inverted, in agarose and imaged by confocal microscopy. Notably, the zebrafish embryo is transparent making it an ideal system for fluorescent imaging. While our analyses have focused on the midbrain-hindbrain boundary and the hindbrain, this method could be extended for analysis of any region in the zebrafish to a depth of 
80-100 &mu;m.

In this video, we demonstrate a method by which to analyze the developing vertebrate brain in live zebrafish embryos at single cell resolution by confocal microscopy. This includes the method by which we inject the single-cell zebrafish embryo and subsequently mount and image the developing brain.

חיים הדמיה של המוח על ידי עוברי דג הזברה מיקרוסקופיה confocal

In this video, we demonstrate the method our lab has developed to analyze the cell shape changes and rearrangements required to bend and fold the ...

Biology

Forebrain Electrophysiological Recording in Larval Zebrafish

Epilepsy affects nearly 3 million people in the United States and up to 50 million people worldwide. Defined as the occurrence of spontaneous unprovoked seizures, epilepsy can be acquired as a result of an insult to the brain or a genetic mutation. Efforts to model seizures in animals have primarily utilized acquired insults (convulsant drugs, stimulation or brain injury) and genetic manipulations (antisense knockdown, homologous recombination or transgenesis) in rodents. Zebrafish are a vertebrate model system1-3 that could provide a valuable alternative to rodent-based epilepsy research. Zebrafish are used extensively in the study of vertebrate genetics or development, exhibit a high degree of genetic similarity to mammals and express homologs for ~85% of known human single-gene epilepsy mutations. Because of their small size (4-6 mm in length), zebrafish larvae can be maintained in fluid volumes as low as 100 &mu;l during early development and arrayed in multi-well plates. Reagents can be added directly to the solution in which embryos develop, simplifying drug administration and enabling rapid in vivo screening of test compounds4. Synthetic oligonucleotides (morpholinos), mutagenesis, zinc finger nuclease and transgenic approaches can be used to rapidly generate gene knockdown or mutation in zebrafish5-7. These properties afford zebrafish studies an unprecedented statistical power analysis advantage over rodents in the study of neurological disorders such as epilepsy. Because the "gold standard" for epilepsy research is to monitor and analyze the abnormal electrical discharges that originate in a central brain structure (i.e., seizures), a method to efficiently record brain activity in larval zebrafish is described here. This method is an adaptation of conventional extracellular recording techniques and allows for stable long-term monitoring of brain activity in intact zebrafish larvae. Sample recordings are shown for acute seizures induced by bath application of convulsant drugs and spontaneous seizures recorded in a genetically modified fish.

A simple method to record extracellular field potentials in the larval zebrafish forebrain is described. The method provides a robust in vivo read-out of seizure-like activity. This technique can be used with genetically modified zebrafish larvae carrying epilepsy-related genes or seizures evoked by administration of convulsant drugs.

הקלטת אלקטרו מוח קדמי בזחל דג זברה

Epilepsy affects nearly 3 million people in the United States and up to 50 million people worldwide. Defined as the occurrence of spontaneous unprovoked ...

Live Imaging of Cell Motility and Actin Cytoskeleton of Individual Neurons and Neural Crest Cells in Zebrafish Embryos

The zebrafish is an ideal model for imaging cell behaviors during development in vivo. Zebrafish embryos are externally fertilized and thus easily accessible at all stages of development. Moreover, their optical clarity allows high resolution imaging of cell and molecular dynamics in the natural environment of the intact embryo. We are using a live imaging approach to analyze cell behaviors during neural crest cell migration and the outgrowth and guidance of neuronal axons.
Live imaging is particularly useful for understanding mechanisms that regulate cell motility processes. To visualize details of cell motility, such as protrusive activity and molecular dynamics, it is advantageous to label individual cells. In zebrafish, plasmid DNA injection yields a transient mosaic expression pattern and offers distinct benefits over other cell labeling methods. For example, transgenic lines often label entire cell populations and thus may obscure visualization of the fine protrusions (or changes in molecular distribution) in a single cell. In addition, injection of DNA at the one-cell stage is less invasive and more precise than dye injections at later stages.
Here we describe a method for labeling individual developing neurons or neural crest cells and imaging their behavior in vivo. We inject plasmid DNA into 1-cell stage embryos, which results in mosaic transgene expression. The vectors contain cell-specific promoters that drive expression of a gene of interest in a subset of sensory neurons or neural crest cells. We provide examples of cells labeled with membrane targeted GFP or with a biosensor probe that allows visualization of F-actin in living cells1.
Erica Andersen, Namrata Asuri, and Matthew Clay contributed equally to this work.

This protocol describes imaging of individual neurons or neural crest cells in living zebrafish embryos. This method is used to examine cellular behaviors and actin localization using fluorescence confocal time-lapse microscopy.

הדמיה חיה של תנועתיות התא ואת cytoskeleton אקטין של נוירונים בודדים לבין תאים קרסט עצבית בעוברים דג הזברה

The zebrafish is an ideal model for imaging cell behaviors during development in vivo. Zebrafish embryos are externally fertilized and thus easily ...

Visualizing the Developing Brain in Living Zebrafish using Brainbow and Time-lapse Confocal Imaging

Development of the vertebrate nervous system requires a precise coordination of complex cellular behaviors and interactions. The use of high resolution in vivo imaging techniques can provide a clear window into these processes in the living organism. For example, dividing cells and their progeny can be followed in real time as the nervous system forms. In recent years, technical advances in multicolor techniques have expanded the types of questions that can be investigated. The multicolor Brainbow approach can be used to not only distinguish among like cells, but also to color-code multiple different clones of related cells that each derive from one progenitor cell. This allows for a multiplex lineage analysis of many different clones and their behaviors simultaneously during development. Here we describe a technique for using time-lapse confocal microscopy to visualize large numbers of multicolor Brainbow-labeled cells over real time within the developing zebrafish nervous system. This is particularly useful for following cellular interactions among like cells, which are difficult to label differentially using traditional promoter-driven colors. Our approach can be used for tracking lineage relationships among multiple different clones simultaneously. The large datasets generated using this technique provide rich information that can be compared quantitatively across genetic or pharmacological manipulations. Ultimately the results generated can help to answer systematic questions about how the nervous system develops.

In vivo imaging is a powerful tool that can be used to investigate the cellular mechanisms underlying nervous system development. Here we describe a technique for using time-lapse confocal microscopy to visualize large numbers of multicolor Brainbow-labeled cells in real time within the developing zebrafish nervous system.

מדמיין את המוח המתפתח בחיים דגים באמצעות הברקשת וזמן-הדמיה קונמיקוד

Development of the vertebrate nervous system requires a precise coordination of complex cellular behaviors and interactions. The use of high resolution in ...

Multicolor Time-lapse Imaging of Transgenic Zebrafish: Visualizing Retinal Stem Cells Activated by Targeted Neuronal Cell Ablation

High-resolution time-lapse imaging of living zebrafish larvae can be utilized to visualize how biological processes unfold (for review see 1). Compound transgenic fish which express different fluorescent reporters in neighboring cell types provide a means of following cellular interactions 2 and/or tissue-level responses to experimental manipulations over time. In this video, we demonstrate methods that can be used for imaging multiple transgenically labeled cell types serially in individual fish over time courses that can span from minutes to several days. The techniques described are applicable to any study seeking to correlate the "behavior" of neighboring cells types over time, including: 1) serial 'catch and release' methods for imaging a large number of fish over successive days, 2) simplified approaches for separating fluorophores with overlapping excitation/emission profiles (e.g., GFP and YFP), 3) use of hypopigmented mutant lines to extend the time window available for high-resolution imaging into late larval stages of development, 4) use of membrane targeted fluorescent reporters to reveal fine morphological detail of individual cells as well as cellular details in larger populations of cells, and 5) a previously described method for chemically-induced ablation of transgenically targeted cell types; i.e., nitroreductase (NTR) mediated conversion of prodrug substrates, such as metronidazole (MTZ), to cytotoxic derivatives 3,5.
As an example of these approaches, we will visualize the ablation and regeneration of a subtype of retinal bipolar neuron within individual fish over several days. Simultaneously we will monitor several other retinal cell types, including neighboring non-targeted bipolar cells and potential degeneration-stimulated retinal stem cells (i.e., M&#971;ller glia). This strategy is being applied in our lab to characterize cell- and tissue-level (e.g., stem cell niche) responses to the selective loss and regeneration of targeted neuronal cell types.

In this video, techniques for multicolor confocal time-lapse imaging and targeted cell ablation are provided. Time-lapse imaging is used to monitor the behavior of multiple cell types of interest in vivo. Targeted cell ablation facilitates the study neural circuit function and cell-specific neuronal regeneration paradigms.

ססגוניות זמן לשגות הדמיה של דג הזברה טראנסגנטי: חזותי בתאי גזע רשתית הופעל על ידי אבלציה ממוקד תאים עצביים

High-resolution time-lapse imaging of living zebrafish larvae can be utilized to visualize how biological processes unfold (for review see 1). Compound ...

Imaging and 3D Reconstruction of Cerebrovascular Structures in Embryonic Zebrafish

Zebrafish are a powerful tool to study developmental biology and pathology in vivo. The small size and relative transparency of zebrafish embryos make them particularly useful for the visual examination of processes such as heart and vascular development. In several recent studies transgenic zebrafish that express EGFP in vascular endothelial cells were used to image and analyze complex vascular networks in the brain and retina, using confocal microscopy. Descriptions are provided to prepare, treat and image zebrafish embryos that express enhanced green fluorescent protein (EGFP), and then generate comprehensive 3D renderings of the cerebrovascular system. Protocols include the treatment of embryos, confocal imaging, and fixation protocols that preserve EGFP fluorescence. Further, useful tips on obtaining high-quality images of cerebrovascular structures, such as removal the eye without damaging nearby neural tissue are provided. Potential pitfalls with confocal imaging are discussed, along with the steps necessary to generate 3D reconstructions from confocal image stacks using freely available open source software.

Imaging of cerebrovascular development in larval zebrafish is described. Techniques to facilitate 3D imaging and modify cerebrovascular development using chemical treatments are also provided.

הדמיה ו3D שחזור של מבני כלי דם במוח בעוברי דג הזברה

Zebrafish are a powerful tool to study developmental biology and pathology in vivo.  The small size and relative transparency of zebrafish embryos make ...

Semi-automated Imaging of Tissue-specific Fluorescence in Zebrafish Embryos

Zebrafish embryos are a powerful tool for large-scale screening of small molecules. Transgenic zebrafish that express fluorescent reporter proteins are frequently used to identify chemicals that modulate gene expression. Chemical screens that assay fluorescence in live zebrafish often rely on expensive, specialized equipment for high content screening. We describe a procedure using a standard epifluorescence microscope with a motorized stage to automatically image zebrafish embryos and detect tissue-specific fluorescence. Using transgenic zebrafish that report estrogen receptor activity via expression of GFP, we developed a semi-automated procedure to screen for estrogen receptor ligands that activate the reporter in a tissue-specific manner. In this video we describe procedures for arraying zebrafish embryos at 24-48 hours post fertilization (hpf) in a 96-well plate and adding small molecules that bind estrogen receptors. At 72-96 hpf, images of each well from the entire plate are automatically collected and manually inspected for tissue-specific fluorescence. This protocol demonstrates the ability to detect estrogens that activate receptors in heart valves but not in liver.

Described here is a protocol for semi-automated imaging of tissue-specific fluorescence in zebrafish embryos.

הדמיה חצי אוטומטית של הקרינה רקמות ספציפיות בעוברי דג הזברה

Zebrafish embryos are a powerful tool for large-scale screening of small molecules. Transgenic zebrafish that express fluorescent reporter proteins are ...

In vivo Imaging of Fully Active Brain Tissue in Awake Zebrafish Larvae and Juveniles by Skull and Skin Removal

Understanding the ephemeral changes that occur during brain development and maturation requires detailed high-resolution imaging in space and time at cellular and subcellular resolution. Advances in molecular and imaging technologies have allowed us to gain numerous detailed insights into cellular and molecular mechanisms of brain development in the transparent zebrafish embryo. Recently, processes of refinement of neuronal connectivity that occur at later larval stages several weeks after fertilization, which are for example control of social behavior, decision making or motivation-driven behavior, have moved into focus of research. At these stages, pigmentation of the zebrafish skin interferes with light penetration into brain tissue, and solutions for embryonic stages, e.g., pharmacological inhibition of pigmentation, are not feasible anymore.
Therefore, a minimally invasive surgical solution for microscopy access to the brain of awake zebrafish is provided that is derived from electrophysiological&#160;approaches. In teleosts, skin and soft skull cartilage can be carefully removed by micro-peeling these layers, exposing underlying neurons and axonal tracts without damage. This allows for recording neuronal morphology, including synaptic structures and their molecular contents, and the observation of physiological changes such as Ca2+ transients or intracellular transport events. In addition, interrogation of these processes by means of pharmacological inhibition or optogenetic manipulation is feasible. This brain exposure approach provides information about structural and physiological changes in neurons as well as the correlation and interdependence of these events in live brain tissue in the range of minutes or hours. The technique is suitable for in vivo brain imaging of zebrafish larvae up to 30 days post fertilization, the latest developmental stage tested so far. It, thus, provides access to such important questions as synaptic refinement and scaling, axonal and dendritic transport, synaptic targeting of cytoskeletal cargo or local activity-dependent expression. Therefore, a broad use for this mounting and imaging approach can be anticipated.

Here we present a method to image the zebrafish embryonic brain in vivo upto larval and juvenile stages. This microinvasive procedure, adapted from electrophysiological approaches, provides access to cellular and subcellular details of mature neuron and can be combined with optogenetics and neuropharmacological studies for characterizing brain function and drug intervention.

In vivo הדמיה של רקמת מוח פעילה לחלוטין בזחלי דגי זברה ערים וצעירים על ידי הסרת גולגולת ועור

Understanding the ephemeral changes that occur during brain development and maturation requires detailed high-resolution imaging in space and time at ...