מחקר זה מומן על ידי הפרויקטים של הקרן הלאומית למדעי הטבע של סין (32172476, 32102275), התוכנית לחדשנות במדע חקלאי וטכנולוגיה (CAAS-ZDRW202203, CAAS-ZDRW202108), וקרנות מרכזיות המנחות את פיתוח המדע והטכנולוגיה המקומי (XZ202301YD0042C).

הערה: עיין בטבלת החומרים לקבלת פרטים הקשורים לכל החומרים, המכשירים, התוכנה והריאגנטים המשמשים בפרוטוקול זה.
1. איסוף ותחזוקת תרבות חרקים
<ol><li>הדביקו קבוצה של ~5,000 ביצים של Corcyra cephalonica (סטינטון) על כרטיס בגודל 9 ס"מ על 16 ס"מ באמצעות תמיסה של 1:5 (v/v) של אבקת גומי ערבי ומים25,26. הערה: הימנעו מהצמדת יותר מדי ביצי מארח לכרטיס מכיוון שהצפיפות הופכת אותו לבלתי מעשי עבור הליכי העברה ונתיחה הבאים.</li>
	<li>כדי למנוע בקיעה של ביצי מארח, יש להכפיף את כרטיסי הביצים של המארח ל-30 דקות של קרינה על-סגולה (UV) (איור 1-i). לאחר מכן, חתכו את הנייר עם ביצים לא פעילות לכרטיסי ביצים בעובי 1 ס"מ ובקוטר 8 ס"מ, שכל אחד מהם מכיל כ-300-500 ביצים (איור 1-ii)25,26,27.</li>
	<li>הכניסו קבוצה של 80-120 צרעות T. denrolimi לתוך צינור זכוכית בקוטר 2 ס"מ ובאורך 8 ס"מ. אוטמים את הצינור עם כותנה. הערה: שמרו על הצרעות בטמפרטורה של 25 ± 1 מעלות צלזיוס, עם מחזור אור/חושך של 16 שעות אור ו-8 שעות חושך ושמרו על לחות יחסית של כ-75%.</li>
	<li>הציגו קלף ביצה מארחת לצרעות לצורך טפילות (איור 1-ii). הרשו לצרעות להפקיד את ביציהן בביצי הפונדקאי למשך 6 שעות, ולאחר מכן הוציאו מיד את הצרעות. הערה: הימנעו מהארכת תקופת הטפילות יתר על המידה מכיוון שהדבר עלול להוביל לצפיפות יתר של צאצאי T. denrolimi בתוך ביצה מארחת, וכתוצאה מכך לתמותת צרעות צאצאים מוגברת28,29.</li>
</ol>2. סינתזה של dsRNA
<ol><li>תכנון ערכות פריימר המכילות מקדם T7 לסינתזה של RNA דו-גדילי (dsRNA). בחר קטע של 300-400 bp מגן המטרה (Ferhch) לסינתזה של dsRNA.</li>
	<li>לרכוש ערכות פריימר מסונתזות מסחריות לייצור dsRNA עבור הגן הממוקד ו- dsGFP לשימוש כבקרה שלילית.</li>
	<li>חלץ תוכן RNA מצרעות 100 T. denrolimi באמצעות הערכה המוזכרת בהתאם לפרוטוקולהיצרן 9. בדוק את איכות תוכן ה- RNA; המשך אם הערך של OD260/OD280 נע בין 1.8 ל- 2.09.</li>
	<li>לטהר את תכולת הרנ"א עם 2 μL של 5x buffer (1 U/50 μL), 1 μL של DNAse (1 U/50 μL), ו-6.5 μL של RNA (~100 ng/μL), 0.5 μL של H2O ב-42°C למשך 2 דקות.</li>
	<li>בצע תגובת שרשרת פולימראז שעתוק לאחור (RT-PCR) כדי ליצור תבנית cDNA עם 10 μL של RNA מטוהר (~ 100 ng/μL), 4 μL של 5x buffer (1 U/50 μL), 1 μL של Enzyme Mix I (1 U/50 μL), ו- 4 μL של H2O. בצע RT-PCR באמצעות ההגדרות הבאות: 37 ° C למשך 15 דקות, 85°C למשך 5 שניות. יש לאחסן את מוצר ה-cDNA בטמפרטורה של -4°C עד לשימוש.</li>
	<li>בצע תגובת שרשרת פולימראז (PCR) כדי להגביר את רצפי ה-dsRNA בהתאם לתערובת האב הנזכרת (10 μL של Taq II [1 U/50 μL], 0.8 μL של פריימר קדמי [0.4 μM], 0.8 μL של פריימר הפוך [0.4 μM], 0.8 μL של תבנית DNA [40 ng/μL], ו-7.6 μL של H2O). בצע PCR באמצעות ההגדרות הבאות: 94 °C למשך 2 דקות; 35 מחזורים עם 94 ° C עבור 30 שניות, 60 ° C עבור 30 שניות, 72 ° C עבור 30; 72°C למשך 2 דקות.</li>
	<li>להעריך את האיכות של מוצרי PCR על ידי אלקטרופורזה על ג'ל אגרוז 2.0% 5,9 ולאשר את רצף המטרה באמצעות ריצוף Sanger.</li>
	<li>יש לטהר את מוצר ה-PCR באמצעות ערכת מיצוי הג'ל בהתאם להנחיות היצרן 9,23.</li>
	<li>השתמש במערכת RNAi כדי לסנתז dsRNA עבור גן המטרה עם 10 μL של 2x buffer (0.02 U/μL), 8 μL של תבנית DNA (75 ng/μL), ו 2 μL של תערובת אנזימים (1 U/50 μL) עם ההגדרות הבאות: 37 ° C במשך 30 דקות, 70 ° C במשך 10 דקות, ו 25 ° C במשך 20 דקות. הצהירו את ה-dsRNA המסונתז עם 30 מיקרוליטר של מים נטולי Nuclease.</li>
	<li>הערך את האיכות של מוצר dsRNA על ידי הדמיה על 1.0% agarose ג'ל 5,9. לדלל את ה-dsRNA ל-7,000 ננוגרם/מיקרוליטר. בדוק את איכות מוצר ה-dsRNA; המשך אם הערך של OD260/OD280 נע בין 1.8 ל- 2.09. יש לאחסן את מוצר ה-dsRNA בטמפרטורה של -20°C עד לשימוש.</li>
</ol>3. השתלת גלמים T. denrolimi
<ol><li>טפחו את ביצי המאכסן הטפיליות במשך כ-8 ימים בטמפרטורה של 25 ± 1°C, תוך שמירה על מחזור אור של 16 שעות / 8 שעות חושך ולחות יחסית של ~75%. ביצי הפונדקאי הטפיליות יושחרו לאחר 5 ימים30 (איור 1-iv,v).</li>
	<li>מעבירים את כרטיס הביצית המארחת למיקרוסקופ מנתח. השתמשו בזוג מחטי טונגסטן (איור 1-vi) כדי להסיר בקפדנות את הכוריון מביצי הפונדקאי (איור 1-vii) ולשלוף את הגלמים מבפנים (איור 1-viii)5,17,18. הערה: קצה מחט הניתוח צריך להיות פחות מ 0.05 מ"מ.</li>
	<li>מכינים צלחת נקייה למצע. שפכו החוצה 10-15 מ"ל של תמיסת אגר בנפח 15 גרם/ליטר, ואפשרו לה להתקרר באופן טבעי (איור 2-i). הערה: ערבבו את תמיסת האגר עם 0.5 גרם סטרפטומיצין כדי לעכב את צמיחת המזהמים במבחנה.</li>
	<li>השתמשו בקבר שעבר חיטוי כדי לחרוט מספר חריצים בעומק 0.2-0.3 מ"מ וברוחב 0.4-0.8 מ"מ (איור 2-ii).</li>
	<li>השתמשו במברשת קטנה (איור 2-iii) כדי להשתיל גולם מביצת הפונדקאי שנותחה לאחד החריצים במצע האגר (איור 2-iv).</li>
	<li>חזרו על שלבים 3.4 ו-3.5, והשתילו 100-300 גלמים בנפרד לתוך החריצים בזה אחר זה (איור 2-v).</li>
</ol>4. הזרקה זעירה של dsRNA לתוך T. denrolimi pupa
<ol><li>השתמשו במושך מחטי זכוכית כדי למשוך נימי זכוכית (איור 3-i,ii). הגדירו את החום ל-280, את המהירות ל-170, את ההשהיה ל-250 ואת המשיכה ל-30 במושך מחטים (איור 3-iii). הכינו מחטי זכוכית נימיות מרובות למיקרו-הזרקה (איור 3-iv,v).</li>
	<li>שיקוע קצה מחט הזכוכית באמצעות צלחת שוחקת (איור 3-vi). הערה: ודא שקצה מחט ההזרקה נשאר חד; אחרת, זה עלול לגרום לתמותת גולמים או לעכב זרימת מגיבים דרך המחט (איור 3-vii).</li>
	<li>טען כ-2 μL של תמיסת הזרקת dsRNA עם 7,000 ng/μL לתוך מחט ההזרקה המוכנה באמצעות משאבת מיקרו-הזרקה (איור 3-vii).</li>
	<li>העבירו את מצע האגר המכיל מאות גלמים על משטח של מיקרוסקופ מורכב (איור 3-viii).</li>
	<li>הכניסו בזהירות את מחט ההזרקה לבטן של גולם T. denrolimi בזווית ~30° לבטן מתחת לעדשה (איור 3-ix).</li>
	<li>הזריקו בהדרגה ~5 nL של תמיסת ההזרקה (שלב 4.3) לתוך גולם T. denrolimi בעדינות ככל האפשר. הערה: גולם T. denrolimi עשוי להתנפח מעט כאשר תמיסת dsRNA מוזרקת. הזרקת כמות מוגזמת של תמיסה לגלמים או שימוש במחטים עם פתחים גדולים מדי עלולים לגרום למוות מוקדם של הגולם. החליפו את המחטים כאשר הן נסתמות לאחר הזרקת מספר עד עשרות גלמים.</li>
	<li>חזור על שלבים 4.5 ו -4.6, הזרקת dsRNA לתוך 600 גלמים אחד אחד. הערה: לניתוח RT-qPCR אמין, יש לבודד את תכולת הרנ"א מלפחות 100 גלמים. הזריקו לפחות 600 גלמים עבור שלושה עותקים משוכפלים בטיפול dsRNA ושלושה משוכפלים בבקרה השלילית dsGFP 9.</li>
</ol>5. דגירה של T. denrolimi pupae
<ol><li>העבר את המצע המכיל גלמים מוזרקים לאינקובטור ב 25 ± 1 ° C עם מחזור אור / כהה 16 שעות / 8 שעות ו ~ 75% RH.</li>
	<li>יש לדגור על כ-700 גלמים מסוג T. denrolimi לכל טיפול למשך 24 שעות או 48 שעות. חלץ תוכן RNA מקבוצה של 100 גלמים לכל שכפול9. הערה: הסר את הגלמים המכווצים (הגלמים המתים) מהדגימות; אחרת, זה עלול לגרום לטעויות בזיהוי ביטוי גנים.</li>
	<li>לדגור ~50 T. denrolimi גלמים בכל טיפול עד שהצרעות מגיחות (איור 3-x). רשום את שיעור ההופעה ואת שיעור העיוות.</li>
</ol>6. איתור ביטוי גנים ממוקד
<ol><li>עצבו את ערכת הפריימר עבור גן היעד ואת גני הייחוס עבור RT-qPCR באמצעות כלי עיצוב. הערה: ודא שהרצפים של הפריימרים RT-qPCR אינם חופפים לאזור היעד של dsRNA.</li>
	<li>השתמש בתיבת מזלג הגן O (FoxO) כגן הייחוס בניתוח RT-qPCR; הפריימרים של FoxO דווחו בעבר9.</li>
	<li>השג ערכות פריימר מסונתזות מסחריות. בצע RT-qPCR עם 10 μL של Taq II (1 U/50 μL), 0.8 μL של פריימר קדמי (0.4 μM), 0.8 μL של פריימר הפוך (0.4 μM), 0.8 μL של תבנית (10 ng/μL) ו- 7.6 μL של H2O. בצע RT-qPCR באמצעות ההגדרות הבאות: 95 ° C עבור 30 שניות; 35 מחזורים עם 95 ° C עבור 5 שניות, 57 ° C עבור 30 שניות, 72 ° C עבור 30; 95 °C עבור 10 שניות; 60°C עבור 5 שניות, ו- 95°C עבור 5 שניות.</li>
	<li>חשב את ערך הביטוי של גן היעד באמצעות שיטת 2-ΔΔCt 9,25.</li>
	<li>להשתמש במבחן Kruskal-Wallis כדי לנתח את הביטוי של גן המטרה תחת השפעת טיפולים שונים (dsFerhch, dsGFP, ללא הזרקה). הערה: הימנע משימוש במבחנים פרמטריים (למשל, מבחן t) להשוואות פוסט-הוק מכיוון שההטרוסקדסטיות וחוסר הנורמליות של הנתונים עלולים להוביל למסקנות שגויות25.</li>
</ol>

קידום טכניקות RNAi ב - Trichogramma dendrolimi לניתוח תפקודי גנים

<ol>
	<li>Zang, L. S., Wang, S., Zhang, F., Desneux, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+control+with+Trichogramma+in+China:+History,+present+status+and+perspectives.">Biological control with Trichogramma in China: History, present status and perspectives.</a> Annu Rev Entomol. 66, 463-484 (2020).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimal+clutch+size+for+quality+control+of+bisexual+and+Wolbachia-infected+thelytokous+lines+of+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+mass+reared+on+eggs+of+a+substitutive+host,+Antheraea+pernyi+Gu&#233;rin-M&#233;neville+(Lepidoptera:+Saturniidae).">Optimal clutch size for quality control of bisexual and Wolbachia-infected thelytokous lines of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) mass reared on eggs of a substitutive host, Antheraea pernyi Gu&#233;rin-M&#233;neville (Lepidoptera: Saturniidae).</a> Pest Manag Sci. 76 (8), 2635-2644 (2020).</li><li>Li, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+status+of+the+biological+control+of+the+fall+armyworm+Spodoptera+frugiperda+by+egg+parasitoids.">Current status of the biological control of the fall armyworm Spodoptera frugiperda by egg parasitoids.</a> J Pest Sci. 96, 1345-1363 (2023).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+temperature+and+superparasitism+on+quality+and+characteristics+of+thelytokous+Wolbachia-infected+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+during+mass+rearing.">Effects of temperature and superparasitism on quality and characteristics of thelytokous Wolbachia-infected Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) during mass rearing.</a> Sci Rep. 9 (1), 18114 (2019).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Penetrance+during+Wolbachia-mediated+parthenogenesis+of+Trichogramma+wasps+is+reduced+by+continuous+oviposition,+associated+with+exhaustion+of+Wolbachia+titers+in+ovary+and+offspring+eggs.">Penetrance during Wolbachia-mediated parthenogenesis of Trichogramma wasps is reduced by continuous oviposition, associated with exhaustion of Wolbachia titers in ovary and offspring eggs.</a> Pest Manag Sci. 78 (7), 3080-3089 (2022).</li><li>Huang, N. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+and+large-scale+releases+of+Trichogramma+promote+pesticide+decrease+in+maize+in+northeastern+China.">Long-term and large-scale releases of Trichogramma promote pesticide decrease in maize in northeastern China.</a> Entomol Gen. 40 (4), 331-335 (2020).</li><li>Wang, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+Trichogramma+japonicum+as+a+vector+of+Beauveria+bassiana+for+parasitizing+eggs+of+rice+striped+stem+borer,+Chilo+suppressalis.">Performance of Trichogramma japonicum as a vector of Beauveria bassiana for parasitizing eggs of rice striped stem borer, Chilo suppressalis.</a> Entomol Gen. 41 (2), 147-155 (2021).</li><li>Ning, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+identification+and+expression+pattern+of+the+sex+determination+genes+and+their+sex-specific+variants+in+the+egg+parasitoid+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae).">The identification and expression pattern of the sex determination genes and their sex-specific variants in the egg parasitoid Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae).</a> Front Physiol. 14, 1243753 (2023).</li><li>Huo, L. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+and+evaluation+of+RT-qPCR+reference+genes+for+expression+analysis+in+the+tiny+egg+parasitoid+wasp,+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae).">Selection and evaluation of RT-qPCR reference genes for expression analysis in the tiny egg parasitoid wasp, Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae).</a> J Asia Pac Entomol. 25 (2), 101883 (2022).</li><li>Leung, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+biological+control:+the+need+for+integrating+genetics+and+genomics.">Next-generation biological control: the need for integrating genetics and genomics.</a> Biol Rev Camb Philos Soc. 95 (6), 1838-1854 (2020).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Leonard, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+symbionts+activate+honey+bee+immunity+and+limit+pathogens.">Engineered symbionts activate honey bee immunity and limit pathogens.</a> Science. 367 (6477), 573-576 (2020).</li><li>Sun, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+an+essential+gene+involved+in+infestation+and+digestion+in+grain+aphid+through+plant-mediated+RNA+interference+generates+aphid-resistant+wheat+plants.">Silencing an essential gene involved in infestation and digestion in grain aphid through plant-mediated RNA interference generates aphid-resistant wheat plants.</a> Plant Biotechnol J. 17 (5), 852-854 (2019).</li><li>Li, M., Bui, M., Akbari, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryo+Microinjection+and+Transplantation+Technique+for+Nasonia+vitripennis+Genome+Manipulation.">Embryo Microinjection and Transplantation Technique for Nasonia vitripennis Genome Manipulation.</a> J Vis Exp. 130, e56990 (2017).</li><li>Dalla Benetta, E., Chaverra-Rodriguez, D., Rasgon, J. L., Akbari, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pupal+and+Adult+Injections+for+RNAi+and+CRISPR+Gene+Editing+in+Nasonia+vitripennis.">Pupal and Adult Injections for RNAi and CRISPR Gene Editing in Nasonia vitripennis.</a> J Vis Exp. 166, e61892 (2020).</li><li>Lynch, J. A., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+parental+RNA+interference+in+the+wasp+Nasonia+vitripennis.">A method for parental RNA interference in the wasp Nasonia vitripennis.</a> Nat Protoc. 1 (1), 486-494 (2006).</li><li>Zhu, K. Y., Palli, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms,+Applications,+and+Challenges+of+Insect+RNA+Interference.">Mechanisms, Applications, and Challenges of Insect RNA Interference.</a> Annu Rev Entomol. 65, 293-311 (2020).</li><li>Colinet, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+RNAi+in+a+Drosophila+endoparasitoid+wasp+and+demonstration+of+its+efficiency+in+impairing+venom+protein+production.">Development of RNAi in a Drosophila endoparasitoid wasp and demonstration of its efficiency in impairing venom protein production.</a> J Insect Physiol. 63, 56-61 (2014).</li><li>Wang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+digestive+tract+expressing+&#945;-amylase+influences+the+adult+lifespan+of+Pteromalus+puparum+revealed+through+RNAi+and+rescue+analyses.">A digestive tract expressing &#945;-amylase influences the adult lifespan of Pteromalus puparum revealed through RNAi and rescue analyses.</a> Pest Manag Sci. 75 (12), 3346-3355 (2019).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia-infected+Trichogramma+dendrolimi+is+outcompeted+by+its+uninfected+counterpart+in+superparasitism+but+does+not+have+developmental+delay.">Wolbachia-infected Trichogramma dendrolimi is outcompeted by its uninfected counterpart in superparasitism but does not have developmental delay.</a> Pest Manag Sci. 79 (3), 1005-1017 (2023).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posterior+concentration+of+Wolbachia+during+the+early+embryogenesis+of+the+host+dynamically+shapes+the+tissue+tropism+of+Wolbachia+in+host+Trichogramma+wasps.">Posterior concentration of Wolbachia during the early embryogenesis of the host dynamically shapes the tissue tropism of Wolbachia in host Trichogramma wasps.</a> Front Cell Infect Microbiol. 13, 1198428 (2023).</li><li>Lee, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+development+of+Trichogramma+evanescens+Westw.+and+its+influence+on+the+embryonic+development+of+its+host,+Attacus+cynthia+ricini+Boisd.">The development of Trichogramma evanescens Westw. and its influence on the embryonic development of its host, Attacus cynthia ricini Boisd.</a> Acta Entomol Sin Z. 11 (1), 89-119 (1961).</li><li>Shen, Y., Chen, Y. Z., Zhang, C. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+silencing+of+genes+in+the+brown+planthopper+Nilaparvata+lugens+affects+survival,+growth+and+female+fecundity.">RNAi-mediated silencing of genes in the brown planthopper Nilaparvata lugens affects survival, growth and female fecundity.</a> Pest Manag Sci. 77 (1), 365-377 (2021).</li><li>Wu, S., Yin, S., Zhou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+physiology+of+iron+trafficking+in+Drosophila+melanogaster.">Molecular physiology of iron trafficking in Drosophila melanogaster.</a> Curr Res Insect Sci. 50, 100888 (2022).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia-Driven+Memory+Loss+in+a+Parasitic+Wasp+Increases+Superparasitism+to+Enhance+Horizontal+Transmission.">Wolbachia-Driven Memory Loss in a Parasitic Wasp Increases Superparasitism to Enhance Horizontal Transmission.</a> mBio. 13 (6), e0236222 (2022).</li><li>Ning, S. F., Zhou, J. C., Liu, Q. Q., Zhao, Q., Dong, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gradual,+temperature-induced+change+of+secondary+sexual+characteristics+in+Trichogramma+pretiosum+infected+with+parthenogenesis-inducing+Wolbachia.">Gradual, temperature-induced change of secondary sexual characteristics in Trichogramma pretiosum infected with parthenogenesis-inducing Wolbachia.</a> PeerJ. 7, e7567 (2019).</li><li>Zhang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decreased+Wolbachia+titers+cause+gradual+change+in+masculinization+of+intersex+individuals+of+thelytokous+Trichogramma+dendrolimi.">Decreased Wolbachia titers cause gradual change in masculinization of intersex individuals of thelytokous Trichogramma dendrolimi.</a> Entomol Gen. 42 (5), 751-759 (2022).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-parasitism:+A+promising+approach+to+simultaneously+produce+Trichogramma+chilonis+and+T.+dendrolimi+on+eggs+of+Antheraea+pernyi.">Multi-parasitism: A promising approach to simultaneously produce Trichogramma chilonis and T. dendrolimi on eggs of Antheraea pernyi.</a> Entomol Gen. 41 (6), 627-636 (2021).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Thelytokous+parthenogenesis-inducing+Wolbachia+on+the+fitness+of+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+in+superparasitised+and+single-parasitised+hosts.">Effects of Thelytokous parthenogenesis-inducing Wolbachia on the fitness of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) in superparasitised and single-parasitised hosts.</a> Front Ecol Evol. 9, 730664 (2021).</li><li>Flanders, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notes+on+the+life+history+and+anatomy+of+Trichogramma.">Notes on the life history and anatomy of Trichogramma.</a> Ann Entomol Soc Am. 30 (2), 304-308 (1937).</li></ol>

המחברים מצהירים כי אין להם ניגודי עניינים.

צרעות טריכוגרמה מוכרות כמדבירות ביולוגיות יעילות, במיוחד נגד מגוון מזיקים לפידופטרנים בחקלאות וייעור1. צרעות זעירות אלה עוברות את השלבים הלא בשלים שלהן בתוך הביצה המארחת, מאפיין המציב אתגרים בביצוע ניסויי RNAi 5,18. מחקר זה מציע מדריך חזותי מ...

Trichogramma spp. הם קבוצה של טפילי ביצים שנעשה בהם שימוש נרחב כחומרי הדברה ביולוגיים יעילים ביותר נגד ספקטרום רחב של מזיקים לפידופטרנים במערכות אקולוגיות חקלאיות ויערות ברחבי העולם 1,2,3,4. היישום של טריכוגרמה בגידול המוני מספק גישה ידידותית לסביבה לניהול בר קיימא של מזיקים 5,6,7. הבנת הביולוגיה המולקולרית של צרעות טריכוגרמה מספקת תובנות חשובות לשיפור יעילות גידול המסה וביצועי השטח של חומרי הדברה ביולוגיים אלה 8,9 על ידי חקירת המתודולוגיה של בקרת גנים ועריכת גנום10.
מאז גילוי ההתערבות הגנטית הספציפית בתיווך RNA דו-גדילי (dsRNA) ב-Caenorhabditis elegans בשנת 1998, שיטת RNA-interference (RNAi) התפתחה לארגז כלים גנטי חיוני לחקר מנגנוני הבקרה של אורגניזמים על ידי דיכוי ביטוי של גני מטרה11. ניסויי RNAi הפכו למתודולוגיה סטנדרטית המיושמת באופן נרחב לחקר תפקוד גנים במינים רבים של חרקים 12,13. אף על פי כן, המניפולציה של RNAi מהווה אתגר עצום במינים טפיליים רבים, במיוחד בקרב אלה השייכים למשפחת הכלסידואידים האנדופרזיטיים 14,15,16. שיטת RNAi תועדה בלפחות 13 מיני טפילים 14,15,16,17,18,19. בין אלה, גישת RNAi בוצעה באופן מקיף בצרעות נסוניה והיא ישימה לאורך כל שלבי ההתפתחות, כולל עוברים, זחלים, גלמים ובוגרים 14,15,16. ראוי לציין כי צרעות נסוניה הן אקטופרזיטואידים, כאשר צאצאיהן מתפתחים בחלל הביניים בין הגלמים המארחים לבין הגולם, מה שמאפשר את גידולם במבחנה וגורם להם לסבול טיפולים מסוימים, כגון מיקרו-הזרקה. בניגוד לצרעות הנסוניה, פרטי טריכוגרמה עוברים את כל התפתחותם העוברית, הזחלית והגולמית בתוך הביצה המארחת. השכבה בשלבי העובר והזחל (העלולה לעכב חדירות dsRNA), פגיעות לנזקים, והקושי לשרוד במבחנה מהווים מכשולים אימתניים 20,21,22. בנוסף, גודלם הזעיר של פרטי טריכוגרמה, בערך ~0.5 מ"מ באורך בוגר או גולם, הופך אותם למורכבים ביותר למניפולציה של 20,21,22.
במחקר הנוכחי, אנו מתארים הליך מקיף לביצוע ניסויים בהפרעות RNA (RNAi) ב- Trichogramma denrolimi Matsumura. הליך זה כולל את ההליכים הבאים: (1) תכנון וסינתזה של RNA דו-גדילי (dsRNA), (2) מיקרו-הזרקה של גלמי T. denrolimi, (3) השתלה ודגירה חוץ גופית של גלמים אלה, ו-(4) זיהוי של הפלת גן מטרה באמצעות ניתוח RT-qPCR. גן המטרה שנבחר לניסוי ה-RNAi הוא הומולוגיה של שרשרת כבדה פריטין (Ferhch). FerHCH, חלבון קושר ברזל, מכיל מרכז פרוקסידאז שניחן ביכולות נוגדות חמצון, המקלות על חמצון Fe2+ עד Fe3+. הוא ממלא תפקיד חיוני בצמיחה והתפתחות של אורגניזמים שונים על ידי שמירה על שיווי משקל חיזור והומאוסטזיס ברזל. דלדול FerHCH יכול לגרום להצטברות יתר של ברזל, מה שמוביל לנזק בלתי הפיך לרקמות, ולעתים קרובות מגיע לשיאו בשינויים פנוטיפיים משמעותיים, כולל פגמים בגדילה, עיוותים ותמותה23,24. מחקר זה מציע מדריך שלב אחר שלב לביצוע RNAi ב- T. denrolimi, אשר יהיה רב ערך לחקר תפקודי הגן בהקשר הרחב יותר של צרעות טריכוגרמה.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2x ES Taq MasterMix (Dye)</td>
			<td>Cowin Biotech, China</td>
			<td>CW0690H</td>
			<td>To amplify the dsRNA sequences</td>
		</tr>
		<tr>
			<td>20x PBS Buffer, DEPC treated (7.2-7.6)</td>
			<td>Sangon Biotech, China</td>
			<td>B540627-0500</td>
			<td>To dilute dsRNA</td>
		</tr>
		<tr>
			<td>Agar strip</td>
			<td>Shishi Globe Agar Industries Co.,Ltd, China</td>
			<td>n/a</td>
			<td>To make culture medium</td>
		</tr>
		<tr>
			<td>Ampicillin sodium</td>
			<td>Sangon Biotech, China</td>
			<td>A610028</td>
			<td>To make culture medium</td>
		</tr>
		<tr>
			<td>Bioer Constant temperature metal bath&#160;</td>
			<td>BIOER, China</td>
			<td>MB-102</td>
			<td>To synthesis dsRNA</td>
		</tr>
		<tr>
			<td>Borosilicate glass capillary&#160;</td>
			<td>WPI, USA</td>
			<td>1B100-4</td>
			<td>To pull capillary glass needle</td>
		</tr>
		<tr>
			<td>Clean bench&#160;</td>
			<td>Airtech, China</td>
			<td>SW-CJ-1FD</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Double distilled water</td>
			<td>Sangon Biotech, China</td>
			<td>A500197-0500</td>
			<td>To dilute cDNA</td>
		</tr>
		<tr>
			<td>Environmental Testing chamber&#160;</td>
			<td>Panasonic, Japan</td>
			<td>MLR-352H-PC</td>
			<td>To culture T. denrolimi</td>
		</tr>
		<tr>
			<td>Eppendorf Centrifuge&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>5418R</td>
			<td>To store RNA content</td>
		</tr>
		<tr>
			<td>Eppendorf FemtoJet 4i</td>
			<td>Eppendrof, Germany</td>
			<td>FemtoJet 4i</td>
			<td>To inject T. denrolimi</td>
		</tr>
		<tr>
			<td>Eppendorf Refrigerated Centrifuge&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>5810R</td>
			<td>Centrifuge</td>
		</tr>
		<tr>
			<td>Ethanol solution (75%, RNase-free)</td>
			<td>Aladdin, China</td>
			<td>M052131-500ml</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Gel Extraction Kit</td>
			<td>Omega, USA</td>
			<td>D25000-02</td>
			<td>To extract cDNA</td>
		</tr>
		<tr>
			<td>GUM Arabic</td>
			<td>Solarbio, China</td>
			<td>CG5991-500g</td>
			<td>To make egg card</td>
		</tr>
		<tr>
			<td>Isopropyl alchohol</td>
			<td>Aladdin, China</td>
			<td>80109218</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Laser-Based Micropipette Puller&#160;</td>
			<td>SUTTER, USA</td>
			<td>P-2000</td>
			<td>To pull capillary glass needle</td>
		</tr>
		<tr>
			<td>Microloader&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>20 &#181;L</td>
			<td>To load dsRNA</td>
		</tr>
		<tr>
			<td>Multi-sample tissue grinder&#160;</td>
			<td>LICHEN, China</td>
			<td>LC-TG-24</td>
			<td>To grind T. denrolimi</td>
		</tr>
		<tr>
			<td>Needle Grinder&#160;</td>
			<td>SUTTER, USA</td>
			<td>BV-10-E</td>
			<td>To grind capillary glass needle</td>
		</tr>
		<tr>
			<td>Nuclease-Free Water</td>
			<td>Sangon Biotech, China</td>
			<td></td>
			<td>To dilute RNA</td>
		</tr>
		<tr>
			<td>OLYMPUS Microscope</td>
			<td>OLYMPUS, Japan</td>
			<td>XZX16</td>
			<td>To observe T. denrolimi</td>
		</tr>
		<tr>
			<td>PCR machine&#160;</td>
			<td>Bio-rad, USA</td>
			<td>S-1000</td>
			<td>For DNA amplification</td>
		</tr>
		<tr>
			<td>PowerPac Basic</td>
			<td>Bio-rad, USA</td>
			<td>PowerPacTM Basic</td>
			<td>To detect the quality of dsRNA&#160;</td>
		</tr>
		<tr>
			<td>Primer of dsGFP (Forward)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			ACAAACCAAGGCAAGTAATA</td>
		</tr>
		<tr>
			<td>Primer of dsGFP (Reverse)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			CAGAGGCATCTTCAACG</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for qPCR (Forward)</td>
			<td></td>
			<td></td>
			<td>TGAAGAGATTCTGCGTTCTGCT</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for qPCR (Reverse)</td>
			<td></td>
			<td></td>
			<td>CTGTAGGAACATCAGCAGGCTT</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for RNAi (Reverse)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG]AG 
			TAGCCATCATCTTTCC</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for RNAi(Forward)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			ACACTGTCAATCGTCCTG</td>
		</tr>
		<tr>
			<td>Primer of FoxO for qPCR (Forward)</td>
			<td></td>
			<td></td>
			<td>CTACGCCGATCTCATAACGC</td>
		</tr>
		<tr>
			<td>Primer of FoxO for qPCR (Reverse)</td>
			<td></td>
			<td></td>
			<td>TGCTGTCGCCCTTGTCCT</td>
		</tr>
		<tr>
			<td>PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time)</td>
			<td>TaKaRa, Japan</td>
			<td>RR047A</td>
			<td></td>
		</tr>
		<tr>
			<td>Quantitative Real-time PCR&#160;</td>
			<td>Bio-rad, USA</td>
			<td>CFX 96 Touch</td>
			<td>To perform reverse transcriptase polymerase chain reaction (RT-PCR)&#160;</td>
		</tr>
		<tr>
			<td>Real-time PCR (TaqMan) Primer and Probes Design Tool</td>
			<td></td>
			<td></td>
			<td>https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool/</td>
		</tr>
		<tr>
			<td>T7 RiBoMAX Express RNAi System</td>
			<td>Promega, USA</td>
			<td>P1700</td>
			<td>To synthesis dsRNA &#160;in vitro&#160;</td>
		</tr>
		<tr>
			<td>TB Green Premix Ex TaqTM <img alt="Equation 1" src="/files/ftp_upload/66250/66250eq01.jpg" style="margin: auto;" /> (Til RnaseH Plus)</td>
			<td>TaKaRa, Japan</td>
			<td>RR820A</td>
			<td>To perform RT-qPCR</td>
		</tr>
		<tr>
			<td>Trichloromethane</td>
			<td>KESHI, China</td>
			<td>GB/T682-2002</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Ambion, USA</td>
			<td>15596018</td>
			<td>To extract total RNA content from samples</td>
		</tr>
		<tr>
			<td>Ultra-low Temperature Freezer&#160;</td>
			<td>Thermo, USA</td>
			<td>Forma 911</td>
			<td></td>
		</tr>
	</tbody>
</table>

rna interference in the egg parasitoid, trichogramma dendrolimi matsumura

טפילי הביצה, Trichogramma spp, מוכרים כמדבירים ביולוגיים יעילים נגד מזיקים לפידופטרנים שונים בחקלאות וביערות. השלבים הלא בוגרים של צאצאי טריכוגרמה מתפתחים בתוך הביצה המארחת, ומפגינים זעירות יוצאת דופן (כ-0.5 מ"מ אורך בוגר). מתודולוגיית RNA-interference (RNAi) התפתחה ככלי חיוני להבהרת תפקודי גנים באורגניזמים רבים. עם זאת, מניפולציה של RNAi במינים מסוימים של טפילים קטנים, כגון טריכוגרמה, הציבה בדרך כלל אתגרים משמעותיים. במחקר זה אנו מציגים שיטת RNAi יעילה ב-Trichogramma denrolimi. ההליך המתואר כולל רכישה ובידוד של דגימות בודדות של T. dendrolimi מביצים מארחות, תכנון וסינתזה של RNA דו-גדילי (dsRNA), השתלת מבחנה וטיפוח של גלמי T. dendrolimi , מיקרו-הזרקה של dsRNA, והערכה לאחר מכן של הפלת גן המטרה באמצעות ניתוח RT-qPCR. מחקר זה מספק הליך מקיף ומפורט ויזואלית לביצוע ניסויי RNAi ב- T. dendrolimi, ובכך מאפשר לחוקרים לחקור את בקרת הגנים במין זה. יתר על כן, מתודולוגיה זו ניתנת להתאמה למחקרי RNAi או מיקרו-זריקות במינים אחרים של טריכוגרמה עם התאמות קלות, מה שהופך אותה להתייחסות רבת ערך לביצוע ניסויי RNAi במינים אנדופרזיטיים אחרים.

Trichogramma spp. are a group of egg parasitoids that have been extensively utilized as highly efficient biological control agents against a wide spectrum of lepidopteran pests in agricultural and forest ecosystems worldwide1,2,3,4. The application of mass-reared Trichogramma provides an environmentally friendly approach for the sustainable management of pests5,6,7. Understanding the molecular biology of Trichogramma wasps provides valuable insights into enhancing the mass-rearing efficiency and field performance of these biological control agents8,9by investigating the methodology of gene regulation and genome editing10.
Since the discovery of double-stranded RNA (dsRNA)-mediated specific genetic interference in Caenorhabditis elegans in 1998, the RNA-interference (RNAi) method has evolved into a vital genetic toolkit for exploring the regulatory mechanisms of organisms by suppressing the expression of target genes11. RNAi experiments have become a standard methodology widely applied to study gene function in numerous insect species12,13. Nevertheless, the manipulation of RNAi presents a formidable challenge in many parasitoid species, particularly among those belonging to the endoparasitic Chalcidoidea family14,15,16. The RNAi method has been documented in at least 13 parasitoid species14,15,16,17,18,19. Among these, the RNAi approach has been comprehensively conducted in Nasonia wasps and is applicable throughout the developmental stages, including embryos, larvae, pupae, and adults14,15,16. It is noteworthy that Nasonia wasps are ectoparasitoids, with their offspring developing in the interstitial space between the host pupa and the puparium, enabling their cultivation in vitro and making them tolerate certain treatments, such as micro-injection. Unlike Nasonia wasps, Trichogramma individuals undergo their entire embryonic, larval, and pupal development inner the host egg. The layer at embryo and larva stages (which may impede dsRNA permeability), vulnerability to damage, and the difficulty in surviving in vitro present formidable obstacles20,21,22. Additionally, the diminutive size of Trichogramma individuals, approximately ~0.5 mm in adult or pupal length, renders them exceedingly intricate to manipulate20,21,22.
In the present study, we outline a comprehensive procedure for conducting RNA interference (RNAi) experiments in Trichogramma denrolimi Matsumura. This procedure encompasses the following procedures: (1) the design and synthesis of double-stranded RNA (dsRNA), (2) microinjection of T. denrolimi pupae, (3) the transplantation and in vitro incubation of these pupae, and (4) the detection of target gene knockdown through RT-qPCR analysis. The target gene selected for the RNAi experiment is the ferritin heavy chain homology (Ferhch). FerHCH, an iron-binding protein, contains a ferroxidase center endowed with antioxidant capabilities, facilitating the oxidation of Fe2+ to Fe3+. It plays an indispensable role in the growth and development of various organisms by maintaining redox equilibrium and iron homeostasis. Depletion of FerHCH can result in the overaccumulation of iron, leading to irreversible tissue damage, and often culminating in significant phenotypic alterations, including growth defects, deformities, and mortality23,24. This study offers a step-by-step guide for conducting RNAi in T. denrolimi, which will be invaluable for investigating the gene functions within the broader context of Trichogramma wasps.

מחבר זרקור: חקירת פרתנוגנזה תליטוקוסית הנגרמת על ידי וולבכיה והתפתחות ארגז כלים גנטי באמצעות הפרעות RNA

הפרעות RNA בפרזיטואיד ביצה, Trichogramma dendrolimi Matsumura

Trichogramma wasps are a group of egg parasitoids used to control lepidopteran pests in agriculture. The intracellular bacteria Wolbachia induces thelytokous parthenogenesis in some Trichogramma wasps. We are trying to answer the mechanism of Wolbachia and sex-determination systems in Trichogramma wasps.We have developed the RNA interference method in Trichogramma wasps. This method is a vital genetic toolkit for investigating the gene functions of Trichogramma. The immature stages of Trichogramma offspring develop within the host egg.The body size of Trichogramma is extremely small and is approximately 0.5 millimeter in adult length. The manipulation of genetic tools such as RNA interference and genome editing presents a formidable challenge for these tiny parasitoid wasps. For decades, gene functions within the entire Trichogramma genus have been rarely explored.The present methodology provides a robust model for investigating gene regulation during developmental and physiological activities in Trichogramma wasps.

שיעור ההופעה של גלמי T. denrolimi שהוזרקו עם dsFerhch היה נמוך משמעותית מזה של אלה שהוזרקו עם dsGFP או אלה ללא הזרקה (טבלה 1). מבין הצרעות שהופיעו, 51.85% מצרעות T. denrolimi שהיו נתונות ל-dsFerhch פיתחו כנפיים קטנות מעוותות. הצרעות המעוותות לא נצפו בצרעות שהוזרקו להן dsGFP או ללא ...

Watch this Scientific Journal Video about RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura at JoVE.com

המניפולציה של הפרעות RNA (RNAi) מהווה אתגר עצום במינים רבים של טפילים בעלי גודל זעיר, כגון צרעות טריכוגרמה . מחקר זה התווה שיטת RNAi יעילה ב - Trichogramma denrolimi. המתודולוגיה הנוכחית מספקת מודל חזק לחקר בקרת גנים בצרעות טריכוגרמה .

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and ...

צרעות טריכוגרמה הן קבוצה של טפילי ביצים המשמשים להדברת מזיקים לפידופטרנים בחקלאות. החיידק התוך-תאי וולבכיה גורם לפרתנוגנזה תליטוקוסית בחלק מצרעות הטריכוגרמה. אנחנו מנסים לענות על המנגנון של וולבכיה ומערכות קביעת מין בצרעות טריכוגרמה.פיתחנו את שיטת התאבכות הרנ"א בצרעות טריכוגרמה. שיטה זו היא ארגז כלים גנטי חיוני לחקר תפקודי הגן של טריכוגרמה. השלבים הלא בשלים של צאצאי טריכוגרמה מתפתחים בתוך הביצית המארחת.גודל הגוף של טריכוגרמה הוא קטן ביותר ואורכו כ -0.5 מילימטר בבוגר. המניפולציה של כלים גנטיים כגון התערבות RNA ועריכת גנום מציבה אתגר עצום לצרעות הטפיליות הזעירות הללו. במשך עשרות שנים, תפקודי גנים בתוך כל סוג Trichogramma נחקרו רק לעתים רחוקות.המתודולוגיה הנוכחית מספקת מודל איתן לחקר בקרת גנים במהלך פעילויות התפתחותיות ופיזיולוגיות בצרעות טריכוגרמה.

rna-interference-egg-parasitoid-trichogramma-dendrolimi

Research

JoVE Journal

Biology

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

1.0K Views.  Shenyang Agricultural University. צרעות טריכוגרמה הן קבוצה של טפילי ביצים המשמשים להדברת מזיקים לפידופטרנים בחקלאות. החיידק התוך-תאי וולבכיה גורם לפרתנוגנזה תליטוקוסית בחלק מצרעות הטריכוגרמה. אנחנו מנסים לענות על המנגנון של וולבכיה ומערכות קביעת מין בצרעות טריכוגרמה.פיתחנו את שיטת התאבכות הרנ"א בצרע...

Video: מחבר זרקור: חקירת פרתנוגנזה תליטוקוסית הנגרמת על ידי וולבכיה והתפתחות ארגז כלים גנטי באמצעות הפרעות RNA

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

Cultivation and Transplantation of Trichogramma dendrolimi Pupae Using Corcyra cephalonica Eggs

To begin, add a solution of gum Arabic powder and water to a nine centimeter by 16 centimeter card. Then place approximately 5, 000 eggs of Corcyra cephalonica onto the card. Subject the host egg cards to 30 minutes of ultraviolet irradiation to prevent the hatching of eggs.Subsequently, cut the paper with inactivated eggs into egg cards, each containing approximately 300 to 500 eggs. Next, introduce a cohort of 80 to 120 Trichogramma dendrolimi wasps into a glass tube. Seal the tube with cotton.For parasitization, allow the wasps to deposit their eggs into the host eggs for six hours. Then promptly remove the wasps. Cultivate the parasitized host eggs for approximately eight days at 25 degrees Celsius.After five days, the parasitized host eggs turned black. Transfer the host egg card to a dissecting microscope. Using a pair of tungsten needles, meticulously remove the chorion from the host eggs and retrieve the pupa from within.Next, prepare a plate with 1.5%agar as substrate. Using a disinfected graver, etch several grooves on the agar. Now using a small brush, transplant a pupa from the dissected host egg into one of the grooves on the agar substrate.

גידול והשתלה של גלמים Trichogramma dendrolimi באמצעות ביצי Corcyra cephalonica

Microinjecting dsRNA into Trichogramma dendrolimi Pupae and Monitoring Developmental Outcomes

To begin, turn on the glass needle puller, then set the heat to 280, the velocity to 170, the delay to 250, and the pole to 30. Bevel the tip of the capillary glass needle. Then using a micro injection pump, load approximately two microliters of ferritin heavy chain homology double-stranded RNA solution into the injection needle.Transfer the agar plate containing Trichogramma dendrolimi pupae onto the compound microscope stage. Carefully insert the injection needle into the abdomen of a pupa at an approximately 30 degree angle and gradually inject five nanoliters of ferritin heavy chain homology double-stranded RNA solution. Incubate approximately 700 pupae per treatment at 25 degrees Celsius for 24 or 48 hours.Extract RNA content from 100 pupae per replicate. From approximately 50 pupae per treatment, observe the wasps emergence. Finally, record the wasps emergence rate and deformity rate.T.dendrolimi pupae injected with double-stranded ferritin heavy chain homology exhibited a significantly lower emergence rate compared to those injected with double-stranded GFP or without injection. In emerged wasps, 51.85%of T.dendrolimi wasps subjected to double-stranded ferritin heavy chain homology developed deformed small wings. This deformation was absent in wasps injected with double-stranded GFP or those without any injection.Additionally, T.dendrolimi pupae injected with double-stranded ferritin heavy chain homology showed melanism, indicative of abnormal iron metabolism. The melanin was not observed in wasps injected with double-stranded GFP or those without any injection.