This research was funded by the Projects of the National Natural Science Foundation of China (32172476, 32102275), the Agricultural Science and Technology Innovation Program (CAAS-ZDRW202203, CAAS-ZDRW202108), and Central Funds Guiding the Local Science and Technology Development (XZ202301YD0042C).

NOTE: See the Table of Materials for details related to all materials, instruments, software, and reagents used in this protocol.
1. Collection and maintenance of insect culture
<ol>
	<li>Adhere a group of ~5,000 eggs of Corcyra cephalonica (Stainton) onto a 9 cm by 16 cm card using a 1:5 (v/v) solution of gum arabic powder and water25,26. 
	NOTE: Avoid attaching too many host eggs to the card as overcrowding makes it impractical for subsequent transfer and dissection procedures.</li>
	<li>To prevent the hatching of host eggs, subject the host egg cards to 30 min of ultraviolet (UV) irradiation (Figure 1-i). Subsequently, cut the paper with inactivated eggs into egg cards measuring 1 cm thick and 8 cm in diameter, each containing approximately 300-500 eggs (Figure 1-ii)25,26,27.</li>
	<li>Introduce a cohort of 80-120 T. denrolimi wasps into a glass tube measuring 2 cm in diameter and 8 cm in length. Seal the tube with cotton. 
	NOTE: Maintain the wasps at a temperature of 25 &#177; 1 &#176;C, with a light/dark cycle of 16 h of light and 8 h of darkness and maintain a relative humidity of approximately 75%.</li>
	<li>Present a host egg card to the wasps for parasitization (Figure 1-ii). Permit the wasps to deposit their eggs into the host eggs for 6 h, after which promptly remove the wasps. 
	&#8203;NOTE: Avoid prolonging the parasitization period excessively as this can lead to overcrowding of T. denrolimi offspring within a host egg, resulting in increased offspring wasp mortality28,29.</li>
</ol>
2. Synthesis of dsRNA
<ol>
	<li>Design primer sets containing a T7 promoter for the synthesis of double-stranded RNA (dsRNA). Choose a 300-400 bp segment from the targeted gene (Ferhch) for dsRNA synthesis.</li>
	<li>Acquire commercially synthesized primer sets for the production of dsRNA for the targeted gene and dsGFP for use as a negative control.</li>
	<li>Extract RNA content from 100 T. denrolimi wasps using the referenced kit following the manufacturer&#39;s protocol9. Check the quality of RNA content; proceed if the value of OD260/OD280 ranges from 1.8 to 2.09.</li>
	<li>Purify the RNA content with 2 &#181;L of 5x buffer (1 U/50 &#181;L), 1 &#181;L of DNAse (1 U/50 &#181;L), and 6.5 &#181;L of RNA (~100 ng/&#181;L), 0.5 &#181;L of H2O at 42 &#176;C for 2 min.</li>
	<li>Perform reverse transcriptase polymerase chain reaction (RT-PCR) to generate a cDNA template with 10 &#181;L of purified RNA (~100 ng/&#181;L), 4 &#181;L of 5x buffer (1 U/50 &#181;L), 1 &#181;L of Enzyme Mix I (1 U/50 &#181;L), and 4 &#181;L of H2O. Perform RT-PCR using the following settings: 37 &#176;C for 15 min, 85 &#176;C for 5 s. Store the cDNA product at -4 &#176;C until use.</li>
	<li>Perform polymerase chain reaction (PCR) to amplify the dsRNA sequences in accordance with the referenced master mix (10 &#181;L of Taq II [1 U/50 &#181;L], 0.8 &#181;L of forward primer [0.4 &#181;M], 0.8 &#181;L of reverse primer [0.4 &#181;M], 0.8 &#181;L of DNA template [40 ng/&#181;L], and 7.6 &#181;L of H2O). Perform PCR using the following settings: 94 &#176;C for 2 min; 35 cycles with 94 &#176;C for 30 s, 60 &#176;C for 30 s, 72 &#176;C for 30; 72 &#176;C for 2 min.</li>
	<li>Assess the quality of PCR products by electrophoresis on a 2.0% agarose gel5,9 and confirm the target sequence through Sanger sequencing.</li>
	<li>Purify the PCR product using the Gel Extraction Kit as per the manufacturer&#39;s guidelines9,23.</li>
	<li>Utilize an RNAi System to synthesize dsRNA for the target gene with 10 &#181;L of 2x buffer (0.02 U/&#181;L), 8 &#181;L of DNA template (75 ng/&#181;L), and 2 &#181;L of enzyme mix (1 U/50 &#181;L) with the following settings: 37 &#176;C for 30 min, 70 &#176;C for 10 min, and 25 &#176;C for 20 min. Elute the synthesized dsRNA with 30 &#181;L of Nuclease-Free Water.</li>
	<li>Assess the quality of the dsRNA product by visualizing it on a 1.0% agarose gel5,9. Dilute the dsRNA to 7,000 ng/&#181;L. Check the quality of the dsRNA product; proceed if the value of OD260/OD280 ranges from 1.8 to 2.09. Store the dsRNA product at -20 &#176;C until use.</li>
</ol>
3. Transplantation of T. denrolimi pupae
<ol>
	<li>Cultivate the parasitized host eggs for approximately 8 days at 25 &#177; 1&#176;C, maintaining a 16 h light/8 h dark cycle and a relative humidity of ~75%. The parasitized host eggs will blacken after 5 days30 (Figure 1-iv,v).</li>
	<li>Transfer the host egg card to a dissecting microscope. Employ a pair of tungsten needles (Figure 1-vi) to meticulously remove the chorion from the host eggs (Figure 1-vii) and retrieve the pupa from within (Figure 1-viii)5,17,18. 
	NOTE: The tip of the dissecting needle should be less than 0.05 mm.</li>
	<li>Prepare a clean plate for the substrate. Pour out 10-15 mL of a 15 g/L agar solution, allowing it to naturally cool (Figure 2-i). 
	NOTE: Mix the agar solution with 0.5 g of streptomycin to inhibit the growth of contaminants in vitro.</li>
	<li>Employ a disinfected graver to etch several grooves measuring 0.2-0.3 mm in depth and 0.4-0.8 mm in width (Figure 2-ii).</li>
	<li>Use a small brush (Figure 2-iii) to transplant a pupa from the dissected host egg into one of the grooves on the agar substrate (Figure 2-iv).</li>
	<li>Repeat steps 3.4 and 3.5, transplanting 100-300 pupae individually into the grooves one by one (Figure 2-v).</li>
</ol>
4. Micro-injecting dsRNA into T. denrolimi pupa
<ol>
	<li>Use a glass needle puller to pull a glass capillary (Figure 3-i,ii). Set the Heat to 280, the Velocity to 170, the Delay to 250, and the Pull to 30 on a needle puller (Figure 3-iii). Prepare multiple capillary glass needles for microinjection (Figure 3-iv,v).</li>
	<li>Bevel the tip of the glass needle using an abrasive plate (Figure 3-vi). 
	NOTE: Ensure that the injection needle&#39;s tip remains sharp; otherwise, it may result in pupal mortality or impede reagent flow through the needle (Figure 3-vii).</li>
	<li>Load approximately 2 &#181;L of the dsRNA injection solution with 7,000 ng/&#181;L into the prepared injection needle using a micro-injection pump (Figure 3-vii).</li>
	<li>Transfer the agar substrate containing hundreds of pupae onto the platform of a compound microscope (Figure 3-viii).</li>
	<li>Carefully insert the injection needle into the abdomen of a T. denrolimi pupa at a ~30&#176; angle to the abdomen under the lens (Figure 3-ix).</li>
	<li>Gradually inject ~5 nL of the injection solution (step 4.3) into the T. denrolimi pupa as gently as possible. 
	NOTE: The T. denrolimi pupa may slightly swell as the dsRNA solution is injected. Injecting an excessive amount of solution into the pupa or using needles with overly large openings may result in premature pupal death. Change the needles when they become clogged after injecting several to tens of pupae.</li>
	<li>Repeat steps 4.5 and 4.6, injecting dsRNA into 600 pupae one by one. 
	&#8203;NOTE: For reliable RT-qPCR analysis, RNA content should be isolated from at least 100 pupae. Inject at least 600 pupae for three replicates in the dsRNA treatment and three replicates in the dsGFP negative control9.</li>
</ol>
5. Incubation of T. denrolimi pupae
<ol>
	<li>Transfer the substrate containing injected pupae to an incubator at 25 &#177; 1 &#176;C with a 16 h/8 h light/dark cycle and ~75% RH.</li>
	<li>Incubate approximately 700 T. denrolimi pupae per treatment for either 24 h or 48 h. Extract RNA content from a group of 100 pupae per replicate9. 
	&#8203;NOTE: Remove the shrunk pupae (dead pupae) from the samples; otherwise, it may result in errors in the detection of gene expression.</li>
	<li>Incubate ~50 T. denrolimi pupae per treatment until the wasps emerge (Figure 3-x). Record the emergence rate and deformity rate.</li>
</ol>
6. Detection of targeted gene expression
<ol>
	<li>Design the primer set for the target gene and reference genes for RT-qPCR using a design tool. 
	NOTE: Ensure that the sequences of the RT-qPCR primers do not overlap with the targeted region of dsRNA.</li>
	<li>Employ the gene forkhead box O (FoxO) as the reference gene in the RT-qPCR analysis; the primers of FoxO have been reported previously9.</li>
	<li>Obtain commercially synthesized primer sets. Perform RT-qPCR with 10 &#181;L of Taq II (1 U/50 &#181;L), 0.8 &#181;L of forward primer (0.4 &#181;M), 0.8 &#181;L of reverse primer (0.4 &#181;M), 0.8 &#181;L of template (10 ng/&#181;L), and 7.6 &#181;L of H2O. Perform RT-qPCR using the following settings: 95 &#176;C for 30 s; 35 cycles with 95 &#176;C for 5 s, 57 &#176;C for 30 s, 72 &#176;C for 30; 95 &#176;C for 10 s; 60 &#176;C for 5 s, and 95 &#176;C for 5 s.</li>
	<li>Calculate the expression value of the targeted gene by using the 2-&#916;&#916;Ct method9,25.</li>
	<li>Employ the Kruskal-Wallis test to analyze the expression of the target gene under the influence of different treatments (dsFerhch, dsGFP, non-injection). 
	NOTE: Avoid using parametric tests (e.g., t-test) for post-hoc comparisons as the data&#39;s heteroscedasticity and non-normality may lead to erroneous conclusions25.</li>
</ol>

Advancing RNAi Techniques in Trichogramma dendrolimi for Gene Function Analysis

<ol>
	<li>Zang, L. S., Wang, S., Zhang, F., Desneux, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+control+with+Trichogramma+in+China:+History,+present+status+and+perspectives.">Biological control with Trichogramma in China: History, present status and perspectives.</a> Annu Rev Entomol. 66, 463-484 (2020).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimal+clutch+size+for+quality+control+of+bisexual+and+Wolbachia-infected+thelytokous+lines+of+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+mass+reared+on+eggs+of+a+substitutive+host,+Antheraea+pernyi+Gu&#233;rin-M&#233;neville+(Lepidoptera:+Saturniidae).">Optimal clutch size for quality control of bisexual and Wolbachia-infected thelytokous lines of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) mass reared on eggs of a substitutive host, Antheraea pernyi Gu&#233;rin-M&#233;neville (Lepidoptera: Saturniidae).</a> Pest Manag Sci. 76 (8), 2635-2644 (2020).</li><li>Li, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+status+of+the+biological+control+of+the+fall+armyworm+Spodoptera+frugiperda+by+egg+parasitoids.">Current status of the biological control of the fall armyworm Spodoptera frugiperda by egg parasitoids.</a> J Pest Sci. 96, 1345-1363 (2023).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+temperature+and+superparasitism+on+quality+and+characteristics+of+thelytokous+Wolbachia-infected+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+during+mass+rearing.">Effects of temperature and superparasitism on quality and characteristics of thelytokous Wolbachia-infected Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) during mass rearing.</a> Sci Rep. 9 (1), 18114 (2019).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Penetrance+during+Wolbachia-mediated+parthenogenesis+of+Trichogramma+wasps+is+reduced+by+continuous+oviposition,+associated+with+exhaustion+of+Wolbachia+titers+in+ovary+and+offspring+eggs.">Penetrance during Wolbachia-mediated parthenogenesis of Trichogramma wasps is reduced by continuous oviposition, associated with exhaustion of Wolbachia titers in ovary and offspring eggs.</a> Pest Manag Sci. 78 (7), 3080-3089 (2022).</li><li>Huang, N. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+and+large-scale+releases+of+Trichogramma+promote+pesticide+decrease+in+maize+in+northeastern+China.">Long-term and large-scale releases of Trichogramma promote pesticide decrease in maize in northeastern China.</a> Entomol Gen. 40 (4), 331-335 (2020).</li><li>Wang, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+Trichogramma+japonicum+as+a+vector+of+Beauveria+bassiana+for+parasitizing+eggs+of+rice+striped+stem+borer,+Chilo+suppressalis.">Performance of Trichogramma japonicum as a vector of Beauveria bassiana for parasitizing eggs of rice striped stem borer, Chilo suppressalis.</a> Entomol Gen. 41 (2), 147-155 (2021).</li><li>Ning, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+identification+and+expression+pattern+of+the+sex+determination+genes+and+their+sex-specific+variants+in+the+egg+parasitoid+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae).">The identification and expression pattern of the sex determination genes and their sex-specific variants in the egg parasitoid Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae).</a> Front Physiol. 14, 1243753 (2023).</li><li>Huo, L. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+and+evaluation+of+RT-qPCR+reference+genes+for+expression+analysis+in+the+tiny+egg+parasitoid+wasp,+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae).">Selection and evaluation of RT-qPCR reference genes for expression analysis in the tiny egg parasitoid wasp, Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae).</a> J Asia Pac Entomol. 25 (2), 101883 (2022).</li><li>Leung, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+biological+control:+the+need+for+integrating+genetics+and+genomics.">Next-generation biological control: the need for integrating genetics and genomics.</a> Biol Rev Camb Philos Soc. 95 (6), 1838-1854 (2020).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Leonard, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+symbionts+activate+honey+bee+immunity+and+limit+pathogens.">Engineered symbionts activate honey bee immunity and limit pathogens.</a> Science. 367 (6477), 573-576 (2020).</li><li>Sun, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+an+essential+gene+involved+in+infestation+and+digestion+in+grain+aphid+through+plant-mediated+RNA+interference+generates+aphid-resistant+wheat+plants.">Silencing an essential gene involved in infestation and digestion in grain aphid through plant-mediated RNA interference generates aphid-resistant wheat plants.</a> Plant Biotechnol J. 17 (5), 852-854 (2019).</li><li>Li, M., Bui, M., Akbari, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryo+Microinjection+and+Transplantation+Technique+for+Nasonia+vitripennis+Genome+Manipulation.">Embryo Microinjection and Transplantation Technique for Nasonia vitripennis Genome Manipulation.</a> J Vis Exp. 130, e56990 (2017).</li><li>Dalla Benetta, E., Chaverra-Rodriguez, D., Rasgon, J. L., Akbari, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pupal+and+Adult+Injections+for+RNAi+and+CRISPR+Gene+Editing+in+Nasonia+vitripennis.">Pupal and Adult Injections for RNAi and CRISPR Gene Editing in Nasonia vitripennis.</a> J Vis Exp. 166, e61892 (2020).</li><li>Lynch, J. A., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+parental+RNA+interference+in+the+wasp+Nasonia+vitripennis.">A method for parental RNA interference in the wasp Nasonia vitripennis.</a> Nat Protoc. 1 (1), 486-494 (2006).</li><li>Zhu, K. Y., Palli, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms,+Applications,+and+Challenges+of+Insect+RNA+Interference.">Mechanisms, Applications, and Challenges of Insect RNA Interference.</a> Annu Rev Entomol. 65, 293-311 (2020).</li><li>Colinet, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+RNAi+in+a+Drosophila+endoparasitoid+wasp+and+demonstration+of+its+efficiency+in+impairing+venom+protein+production.">Development of RNAi in a Drosophila endoparasitoid wasp and demonstration of its efficiency in impairing venom protein production.</a> J Insect Physiol. 63, 56-61 (2014).</li><li>Wang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+digestive+tract+expressing+&#945;-amylase+influences+the+adult+lifespan+of+Pteromalus+puparum+revealed+through+RNAi+and+rescue+analyses.">A digestive tract expressing &#945;-amylase influences the adult lifespan of Pteromalus puparum revealed through RNAi and rescue analyses.</a> Pest Manag Sci. 75 (12), 3346-3355 (2019).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia-infected+Trichogramma+dendrolimi+is+outcompeted+by+its+uninfected+counterpart+in+superparasitism+but+does+not+have+developmental+delay.">Wolbachia-infected Trichogramma dendrolimi is outcompeted by its uninfected counterpart in superparasitism but does not have developmental delay.</a> Pest Manag Sci. 79 (3), 1005-1017 (2023).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posterior+concentration+of+Wolbachia+during+the+early+embryogenesis+of+the+host+dynamically+shapes+the+tissue+tropism+of+Wolbachia+in+host+Trichogramma+wasps.">Posterior concentration of Wolbachia during the early embryogenesis of the host dynamically shapes the tissue tropism of Wolbachia in host Trichogramma wasps.</a> Front Cell Infect Microbiol. 13, 1198428 (2023).</li><li>Lee, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+development+of+Trichogramma+evanescens+Westw.+and+its+influence+on+the+embryonic+development+of+its+host,+Attacus+cynthia+ricini+Boisd.">The development of Trichogramma evanescens Westw. and its influence on the embryonic development of its host, Attacus cynthia ricini Boisd.</a> Acta Entomol Sin Z. 11 (1), 89-119 (1961).</li><li>Shen, Y., Chen, Y. Z., Zhang, C. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+silencing+of+genes+in+the+brown+planthopper+Nilaparvata+lugens+affects+survival,+growth+and+female+fecundity.">RNAi-mediated silencing of genes in the brown planthopper Nilaparvata lugens affects survival, growth and female fecundity.</a> Pest Manag Sci. 77 (1), 365-377 (2021).</li><li>Wu, S., Yin, S., Zhou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+physiology+of+iron+trafficking+in+Drosophila+melanogaster.">Molecular physiology of iron trafficking in Drosophila melanogaster.</a> Curr Res Insect Sci. 50, 100888 (2022).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia-Driven+Memory+Loss+in+a+Parasitic+Wasp+Increases+Superparasitism+to+Enhance+Horizontal+Transmission.">Wolbachia-Driven Memory Loss in a Parasitic Wasp Increases Superparasitism to Enhance Horizontal Transmission.</a> mBio. 13 (6), e0236222 (2022).</li><li>Ning, S. F., Zhou, J. C., Liu, Q. Q., Zhao, Q., Dong, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gradual,+temperature-induced+change+of+secondary+sexual+characteristics+in+Trichogramma+pretiosum+infected+with+parthenogenesis-inducing+Wolbachia.">Gradual, temperature-induced change of secondary sexual characteristics in Trichogramma pretiosum infected with parthenogenesis-inducing Wolbachia.</a> PeerJ. 7, e7567 (2019).</li><li>Zhang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decreased+Wolbachia+titers+cause+gradual+change+in+masculinization+of+intersex+individuals+of+thelytokous+Trichogramma+dendrolimi.">Decreased Wolbachia titers cause gradual change in masculinization of intersex individuals of thelytokous Trichogramma dendrolimi.</a> Entomol Gen. 42 (5), 751-759 (2022).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-parasitism:+A+promising+approach+to+simultaneously+produce+Trichogramma+chilonis+and+T.+dendrolimi+on+eggs+of+Antheraea+pernyi.">Multi-parasitism: A promising approach to simultaneously produce Trichogramma chilonis and T. dendrolimi on eggs of Antheraea pernyi.</a> Entomol Gen. 41 (6), 627-636 (2021).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Thelytokous+parthenogenesis-inducing+Wolbachia+on+the+fitness+of+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+in+superparasitised+and+single-parasitised+hosts.">Effects of Thelytokous parthenogenesis-inducing Wolbachia on the fitness of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) in superparasitised and single-parasitised hosts.</a> Front Ecol Evol. 9, 730664 (2021).</li><li>Flanders, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notes+on+the+life+history+and+anatomy+of+Trichogramma.">Notes on the life history and anatomy of Trichogramma.</a> Ann Entomol Soc Am. 30 (2), 304-308 (1937).</li></ol>

The authors declare that they have no conflicts of interest.

Trichogramma wasps are recognized as effective biological control agents, specifically targeting a range of lepidopteran pests in agriculture and forestry1. These diminutive wasps undergo their immature stages within the host egg, a characteristic that presents challenges in conducting RNAi experiments5,18. This study offers a comprehensive visual guide for conducting RNAi experiments in T. denrolimi. Given the shared bio...

Trichogramma spp. are a group of egg parasitoids that have been extensively utilized as highly efficient biological control agents against a wide spectrum of lepidopteran pests in agricultural and forest ecosystems worldwide1,2,3,4. The application of mass-reared Trichogramma provides an environmentally friendly approach for the sustainable management of pests5,6,7. Understanding the molecular biology of Trichogramma wasps provides valuable insights into enhancing the mass-rearing efficiency and field performance of these biological control agents8,9by investigating the methodology of gene regulation and genome editing10.
Since the discovery of double-stranded RNA (dsRNA)-mediated specific genetic interference in Caenorhabditis elegans in 1998, the RNA-interference (RNAi) method has evolved into a vital genetic toolkit for exploring the regulatory mechanisms of organisms by suppressing the expression of target genes11. RNAi experiments have become a standard methodology widely applied to study gene function in numerous insect species12,13. Nevertheless, the manipulation of RNAi presents a formidable challenge in many parasitoid species, particularly among those belonging to the endoparasitic Chalcidoidea family14,15,16. The RNAi method has been documented in at least 13 parasitoid species14,15,16,17,18,19. Among these, the RNAi approach has been comprehensively conducted in Nasonia wasps and is applicable throughout the developmental stages, including embryos, larvae, pupae, and adults14,15,16. It is noteworthy that Nasonia wasps are ectoparasitoids, with their offspring developing in the interstitial space between the host pupa and the puparium, enabling their cultivation in vitro and making them tolerate certain treatments, such as micro-injection. Unlike Nasonia wasps, Trichogramma individuals undergo their entire embryonic, larval, and pupal development inner the host egg. The layer at embryo and larva stages (which may impede dsRNA permeability), vulnerability to damage, and the difficulty in surviving in vitro present formidable obstacles20,21,22. Additionally, the diminutive size of Trichogramma individuals, approximately ~0.5 mm in adult or pupal length, renders them exceedingly intricate to manipulate20,21,22.
In the present study, we outline a comprehensive procedure for conducting RNA interference (RNAi) experiments in Trichogramma denrolimi Matsumura. This procedure encompasses the following procedures: (1) the design and synthesis of double-stranded RNA (dsRNA), (2) microinjection of T. denrolimi pupae, (3) the transplantation and in vitro incubation of these pupae, and (4) the detection of target gene knockdown through RT-qPCR analysis. The target gene selected for the RNAi experiment is the ferritin heavy chain homology (Ferhch). FerHCH, an iron-binding protein, contains a ferroxidase center endowed with antioxidant capabilities, facilitating the oxidation of Fe2+ to Fe3+. It plays an indispensable role in the growth and development of various organisms by maintaining redox equilibrium and iron homeostasis. Depletion of FerHCH can result in the overaccumulation of iron, leading to irreversible tissue damage, and often culminating in significant phenotypic alterations, including growth defects, deformities, and mortality23,24. This study offers a step-by-step guide for conducting RNAi in T. denrolimi, which will be invaluable for investigating the gene functions within the broader context of Trichogramma wasps.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2x ES Taq MasterMix (Dye)</td>
			<td>Cowin Biotech, China</td>
			<td>CW0690H</td>
			<td>To amplify the dsRNA sequences</td>
		</tr>
		<tr>
			<td>20x PBS Buffer, DEPC treated (7.2-7.6)</td>
			<td>Sangon Biotech, China</td>
			<td>B540627-0500</td>
			<td>To dilute dsRNA</td>
		</tr>
		<tr>
			<td>Agar strip</td>
			<td>Shishi Globe Agar Industries Co.,Ltd, China</td>
			<td>n/a</td>
			<td>To make culture medium</td>
		</tr>
		<tr>
			<td>Ampicillin sodium</td>
			<td>Sangon Biotech, China</td>
			<td>A610028</td>
			<td>To make culture medium</td>
		</tr>
		<tr>
			<td>Bioer Constant temperature metal bath&#160;</td>
			<td>BIOER, China</td>
			<td>MB-102</td>
			<td>To synthesis dsRNA</td>
		</tr>
		<tr>
			<td>Borosilicate glass capillary&#160;</td>
			<td>WPI, USA</td>
			<td>1B100-4</td>
			<td>To pull capillary glass needle</td>
		</tr>
		<tr>
			<td>Clean bench&#160;</td>
			<td>Airtech, China</td>
			<td>SW-CJ-1FD</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Double distilled water</td>
			<td>Sangon Biotech, China</td>
			<td>A500197-0500</td>
			<td>To dilute cDNA</td>
		</tr>
		<tr>
			<td>Environmental Testing chamber&#160;</td>
			<td>Panasonic, Japan</td>
			<td>MLR-352H-PC</td>
			<td>To culture T. denrolimi</td>
		</tr>
		<tr>
			<td>Eppendorf Centrifuge&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>5418R</td>
			<td>To store RNA content</td>
		</tr>
		<tr>
			<td>Eppendorf FemtoJet 4i</td>
			<td>Eppendrof, Germany</td>
			<td>FemtoJet 4i</td>
			<td>To inject T. denrolimi</td>
		</tr>
		<tr>
			<td>Eppendorf Refrigerated Centrifuge&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>5810R</td>
			<td>Centrifuge</td>
		</tr>
		<tr>
			<td>Ethanol solution (75%, RNase-free)</td>
			<td>Aladdin, China</td>
			<td>M052131-500ml</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Gel Extraction Kit</td>
			<td>Omega, USA</td>
			<td>D25000-02</td>
			<td>To extract cDNA</td>
		</tr>
		<tr>
			<td>GUM Arabic</td>
			<td>Solarbio, China</td>
			<td>CG5991-500g</td>
			<td>To make egg card</td>
		</tr>
		<tr>
			<td>Isopropyl alchohol</td>
			<td>Aladdin, China</td>
			<td>80109218</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Laser-Based Micropipette Puller&#160;</td>
			<td>SUTTER, USA</td>
			<td>P-2000</td>
			<td>To pull capillary glass needle</td>
		</tr>
		<tr>
			<td>Microloader&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>20 &#181;L</td>
			<td>To load dsRNA</td>
		</tr>
		<tr>
			<td>Multi-sample tissue grinder&#160;</td>
			<td>LICHEN, China</td>
			<td>LC-TG-24</td>
			<td>To grind T. denrolimi</td>
		</tr>
		<tr>
			<td>Needle Grinder&#160;</td>
			<td>SUTTER, USA</td>
			<td>BV-10-E</td>
			<td>To grind capillary glass needle</td>
		</tr>
		<tr>
			<td>Nuclease-Free Water</td>
			<td>Sangon Biotech, China</td>
			<td></td>
			<td>To dilute RNA</td>
		</tr>
		<tr>
			<td>OLYMPUS Microscope</td>
			<td>OLYMPUS, Japan</td>
			<td>XZX16</td>
			<td>To observe T. denrolimi</td>
		</tr>
		<tr>
			<td>PCR machine&#160;</td>
			<td>Bio-rad, USA</td>
			<td>S-1000</td>
			<td>For DNA amplification</td>
		</tr>
		<tr>
			<td>PowerPac Basic</td>
			<td>Bio-rad, USA</td>
			<td>PowerPacTM Basic</td>
			<td>To detect the quality of dsRNA&#160;</td>
		</tr>
		<tr>
			<td>Primer of dsGFP (Forward)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			ACAAACCAAGGCAAGTAATA</td>
		</tr>
		<tr>
			<td>Primer of dsGFP (Reverse)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			CAGAGGCATCTTCAACG</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for qPCR (Forward)</td>
			<td></td>
			<td></td>
			<td>TGAAGAGATTCTGCGTTCTGCT</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for qPCR (Reverse)</td>
			<td></td>
			<td></td>
			<td>CTGTAGGAACATCAGCAGGCTT</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for RNAi (Reverse)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG]AG 
			TAGCCATCATCTTTCC</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for RNAi(Forward)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			ACACTGTCAATCGTCCTG</td>
		</tr>
		<tr>
			<td>Primer of FoxO for qPCR (Forward)</td>
			<td></td>
			<td></td>
			<td>CTACGCCGATCTCATAACGC</td>
		</tr>
		<tr>
			<td>Primer of FoxO for qPCR (Reverse)</td>
			<td></td>
			<td></td>
			<td>TGCTGTCGCCCTTGTCCT</td>
		</tr>
		<tr>
			<td>PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time)</td>
			<td>TaKaRa, Japan</td>
			<td>RR047A</td>
			<td></td>
		</tr>
		<tr>
			<td>Quantitative Real-time PCR&#160;</td>
			<td>Bio-rad, USA</td>
			<td>CFX 96 Touch</td>
			<td>To perform reverse transcriptase polymerase chain reaction (RT-PCR)&#160;</td>
		</tr>
		<tr>
			<td>Real-time PCR (TaqMan) Primer and Probes Design Tool</td>
			<td></td>
			<td></td>
			<td>https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool/</td>
		</tr>
		<tr>
			<td>T7 RiBoMAX Express RNAi System</td>
			<td>Promega, USA</td>
			<td>P1700</td>
			<td>To synthesis dsRNA &#160;in vitro&#160;</td>
		</tr>
		<tr>
			<td>TB Green Premix Ex TaqTM <img alt="Equation 1" src="/files/ftp_upload/66250/66250eq01.jpg" style="margin: auto;" /> (Til RnaseH Plus)</td>
			<td>TaKaRa, Japan</td>
			<td>RR820A</td>
			<td>To perform RT-qPCR</td>
		</tr>
		<tr>
			<td>Trichloromethane</td>
			<td>KESHI, China</td>
			<td>GB/T682-2002</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Ambion, USA</td>
			<td>15596018</td>
			<td>To extract total RNA content from samples</td>
		</tr>
		<tr>
			<td>Ultra-low Temperature Freezer&#160;</td>
			<td>Thermo, USA</td>
			<td>Forma 911</td>
			<td></td>
		</tr>
	</tbody>
</table>

rna interference in the egg parasitoid, trichogramma dendrolimi matsumura

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

The emergence rate of T. denrolimi pupae injected with dsFerhch was significantly lower than that of those injected with dsGFP or those without injection (Table 1). Among the emerged wasps, 51.85% of T. denrolimi wasps subjected to dsFerhch developed deformed small wings. The deformed wasps were not observed in the wasps injected with dsGFP or without any injection (Table 1). Moreover, the abdomens of T. denrolimi pupae injec...

Watch this Scientific Journal Video about RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura at JoVE.com

Author Spotlight: Investigating Wolbachia-Induced Thelytokous Parthenogenesis and Genetic Toolkit Development Through RNA Interference

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and ...

rna-interference-egg-parasitoid-trichogramma-dendrolimi

Microsoft Bing

Research

JoVE Journal

Biology

1.1K Views.  Shenyang Agricultural University. The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

Video: Author Spotlight: Investigating Wolbachia-Induced Thelytokous Parthenogenesis and Genetic Toolkit Development Through RNA Interference

In Vitro Nuclear Assembly Using Fractionated Xenopus Egg Extracts

Nuclear membrane assembly is an essential step in the cell division cycle; this process can be replicated in the test tube by combining Xenopus sperm chromatin, cytosol, and light membrane fractions. Complete nuclei are formed, including nuclear membranes with pore complexes, and these reconstituted nuclei are capable of normal nuclear processes.

Nuclear membrane assembly is an essential step in the cell division cycle; this process can be replicated in the test tube by combining Xenopus sperm chromatin, cytosol, and light membrane fractions. Complete nuclei are formed, including nuclear membranes with pore complexes, and these reconstituted nuclei are capable of normal nuclear processes.

Nuclear membrane assembly is an essential step in the cell division cycle; this process can be replicated in the test tube by combining Xenopus sperm ...

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence (T7, T3, SP6) and the gene to be transcribed (Figure 1A). A typical transcription reaction consists of the template DNA, RNA polymerase, ribonucleotide triphosphates, RNase inhibitor and buffer containing Mg2+ ions.
Large amounts of high quality RNA are often required for a variety of applications. Use of in vitro transcription has been reported for RNA structure and function studies such as splicing1, RNAi experiments in mammalian cells2, antisense RNA amplification by the "Eberwine method"3, microarray analysis4 and for RNA vaccine studies5. The technique can also be used for producing radiolabeled and dye labeled probes6. Warren, et al. recently reported reprogramming of human cells by transfection with in vitro transcribed capped RNA7. The T7 High Yield RNA Synthesis Kit from New England Biolabs has been designed to synthesize up to 180 &mu;g RNA per 20 &mu;l reaction. RNA of length up to 10kb has been successfully transcribed using this kit. Linearized plasmid DNA, PCR products and synthetic DNA oligonucleotides can be used as templates for transcription as long as they have the T7 promoter sequence upstream of the gene to be transcribed.
Addition of a 5' end cap structure to the RNA is an important process in eukaryotes. It is essential for RNA stability8, efficient translation9, nuclear transport10 and splicing11. The process involves addition of a 7-methylguanosine cap at the 5' triphosphate end of the RNA. RNA capping can be carried out post-transcriptionally using capping enzymes or co-transcriptionally using cap analogs. In the enzymatic method, the mRNA is capped using the Vaccinia virus capping enzyme12,13. The enzyme adds on a 7-methylguanosine cap at the 5' end of the RNA using GTP and S-adenosyl methionine as donors (cap 0 structure). Both methods yield functionally active capped RNA suitable for transfection or other applications14 such as generating viral genomic RNA for reverse-genetic systems15 and crystallographic studies of cap binding proteins such as eIF4E16.
In the method described below, the T7 High Yield RNA Synthesis Kit from NEB is used to synthesize capped and uncapped RNA transcripts of Gaussia luciferase (GLuc) and Cypridina luciferase (CLuc). A portion of the uncapped GLuc RNA is capped using the Vaccinia Capping System (NEB). A linearized plasmid containing the GLuc or CLuc gene and T7 promoter is used as the template DNA. The transcribed RNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity. Capped CLuc RNA is used as the internal control to normalize GLuc expression.

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

This method describes high yield in vitro synthesis of both capped and uncapped mRNA from a linearized plasmid containing the Gaussia luciferase (GLuc) gene. The RNA is purified and a fraction of the uncapped RNA is enzymatically capped using the Vaccinia virus capping enzyme. In the final step, the mRNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity.

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Chromatin Isolation by RNA Purification (ChIRP)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental gene expression 1,2,3,4,5,6,7. The recent discovery of thousands of lncRNAs in association with specific chromatin modification complexes, such as Polycomb Repressive Complex 2 (PRC2) that mediates histone H3 lysine 27 trimethylation (H3K27me3), suggests broad roles for numerous lncRNAs in managing chromatin states in a gene-specific fashion 8,9. While some lncRNAs are thought to work in cis on neighboring genes, other lncRNAs work in trans to regulate distantly located genes. For instance, Drosophila lncRNAs roX1 and roX2 bind numerous regions on the X chromosome of male cells, and are critical for dosage compensation 10,11. However, the exact locations of their binding sites are not known at high resolution. Similarly, human lncRNA HOTAIR can affect PRC2 occupancy on hundreds of genes genome-wide 3,12,13, but how specificity is achieved is unclear. LncRNAs can also serve as modular scaffolds to recruit the assembly of multiple protein complexes. The classic trans-acting RNA scaffold is the TERC RNA that serves as the template and scaffold for the telomerase complex 14; HOTAIR can also serve as a scaffold for PRC2 and a H3K4 demethylase complex 13.
Prior studies mapping RNA occupancy at chromatin have revealed substantial insights 15,16, but only at a single gene locus at a time. The occupancy sites of most lncRNAs are not known, and the roles of lncRNAs in chromatin regulation have been mostly inferred from the indirect effects of lncRNA perturbation. Just as chromatin immunoprecipitation followed by microarray or deep sequencing (ChIP-chip or ChIP-seq, respectively) has greatly improved our understanding of protein-DNA interactions on a genomic scale, here we illustrate a recently published strategy to map long RNA occupancy genome-wide at high resolution 17. This method, Chromatin Isolation by RNA Purification (ChIRP) (Figure 1), is based on affinity capture of target lncRNA:chromatin complex by tiling antisense-oligos, which then generates a map of genomic binding sites at a resolution of several hundred bases with high sensitivity and low background. ChIRP is applicable to many lncRNAs because the design of affinity-probes is straightforward given the RNA sequence and requires no knowledge of the RNA's structure or functional domains.

Chromatin Isolation by RNA Purification ChIRP

ChIRP is a novel and rapid technique to map genomic binding sites of long noncoding RNAs (lncRNAs). The method takes advantage of the specificity of anti-sense tiling oligonucleotides to allow the enumeration of lncRNA-bound genomic sites.

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems including plants, invertebrates and vertebrates. There are various methods to achieve RNAi in vivo4,5. For example, the target gene may be transformed into an RNAi vector, and then either permanently or transiently transformed into cell lines or primary cells to achieve gene knockdown effects; alternatively synthesized double-strand oligonucleotides from specific target genes (RNAi oligos) may be transiently transformed into cell lines or primary cells to silence target genes; or synthesized double-strand RNA molecules may be microinjected into an organism. Since the nematode C. elegans uses bacteria as a food source, feeding the animals with bacteria expressing double-strand RNA against target genes provides a viable strategy6. Here we present an RNAi feeding method to score body size phenotype. Body size in C. elegans is regulated primarily by the TGF- &beta; - like ligand DBL-1, so this assay is appropriate for identification of TGF-&beta; signaling components7. We used different strains including two RNAi hypersensitive strains to repeat the RNAi feeding experiments. Our results showed that rrf-3 strain gave us the best expected RNAi phenotype. The method is easy to perform, reproducible, and easily quantified. Furthermore, our protocol minimizes the use of specialized equipment, so it is suitable for smaller laboratories or those at predominantly undergraduate institutions.

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

We demonstrate how to use the RNAi feeding technique to knock down target genes and score body size phenotype in C. elegans. This method could be used for a large scale screen to identify potential genetic components of interest, such as those involved in body size regulation by DBL-1/TGF-&beta; signaling.

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems ...

Reconstitution Of &#946;-catenin Degradation In Xenopus Egg Extract

Xenopus laevis egg extract is a well-characterized, robust system for studying the biochemistry of diverse cellular processes. Xenopus egg extract has been used to study protein turnover in many cellular contexts, including the cell cycle and signal transduction pathways1-3. Herein, a method is described for isolating Xenopus egg extract that has been optimized to promote the degradation of the critical Wnt pathway component, &beta;-catenin. Two different methods are described to assess &beta;-catenin protein degradation in Xenopus egg extract. One method is visually informative ([35S]-radiolabeled proteins), while the other is more readily scaled for high-throughput assays (firefly luciferase-tagged fusion proteins). The techniques described can be used to, but are not limited to, assess &beta;-catenin protein turnover and identify molecular components contributing to its turnover. Additionally, the ability to purify large volumes of homogenous Xenopus egg extract combined with the quantitative and facile readout of luciferase-tagged proteins allows this system to be easily adapted for high-throughput screening for modulators of &beta;-catenin degradation.

Reconstitution Of &#946;-catenin Degradation In Xenopus Egg Extract

A method is described for analyzing protein degradation using radiolabeled and luciferase-fusion proteins in Xenopus egg extract and its adaptation for high-throughput screening for small molecule modulators of protein degradation.

Xenopus laevis egg extract is a well-characterized, robust system for studying the biochemistry of diverse cellular processes. Xenopus egg extract has ...

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle&#8217;s body cavity.
In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting.

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

RNA interference (RNAi)-based gene knockdown techniques are at the core of Tribolium research. Here, we provide an overview of our larval RNAi technique in Tribolium castaneum. Larval RNAi is a simple, but powerful technique that provides quick access to loss-of-function phenotypes, allowing researchers to study gene functions in diverse contexts.

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully ...

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool operating by disruption of essential gene expression. Although different methods, such as injection, feeding, and soaking, have been reported for successful delivery of double-stranded RNA (dsRNA), the efficiency of RNAi through oral delivery of dsRNA is highly variable among different insect groups. The German cockroach, Blattella germanica, is highly sensitive to the injection of dsRNA, as shown by many studies published previously. The present study describes a method to demonstrate that the dsRNA encapsulated with liposome carriers is sufficient to retard the degradation of dsRNA by midgut juice. Notably, the continuous feeding of dsRNA encapsulated by liposomes significantly reduces the tubulin expression in the midgut, and led to the death of cockroaches. In conclusion, the formulation and utilization of dsRNA lipoplexes, which protect dsRNA against nucleases, could be a practical use of RNAi for insect pest control in the future.

This manuscript demonstrates the depletion of gene expression in the midgut of the German cockroach through oral ingestion of double-stranded RNA encapsulated in liposomes.

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

Visualizing and Tracking Endogenous mRNAs in Live Drosophila melanogaster Egg Chambers

Fluorescence-based imaging techniques, in combination with developments in light microscopy, have revolutionized how cell biologists conduct live cell imaging studies. Methods for detecting RNAs have expanded greatly since seminal studies linked site-specific mRNA localization to gene expression regulation. Dynamic mRNA processes can now be visualized via approaches that detect mRNAs, coupled with microscopy set-ups that are fast enough to capture the dynamic range of molecular behavior. The molecular beacon technology is a hybridization-based approach capable of direct detection of endogenous transcripts in living cells. Molecular beacons are hairpin-shaped, internally quenched, single-nucleotide discriminating nucleic acid probes, which fluoresce only upon hybridization to a unique target sequence. When coupled with advanced fluorescence microscopy and high-resolution imaging, they enable one to perform spatial and temporal tracking of intracellular movement of mRNAs. Although this technology is the only method capable of detecting endogenous transcripts, cell biologists have not yet fully embraced this technology due to difficulties in designing such probes for live cell imaging. A new software application, PinMol, allows for enhanced and rapid design of probes best suited to efficiently hybridize to mRNA target regions within a living cell. In addition, high-resolution, real-time image acquisition and current, open source image analysis software allow for a refined data output, leading to a finer evaluation of the complexity underlying the dynamic processes involved in the mRNA&#39;s life cycle.
Here we present a comprehensive protocol for designing and delivering molecular beacons into Drosophila melanogaster egg chambers. Direct and highly specific detection and visualization of endogenous maternal mRNAs is performed via spinning disc confocal microscopy. Imaging data is processed and analyzed using object detection and tracking in Icy software to obtain details about the dynamic movement of mRNAs, which are transported and localized to specialized regions within the oocyte.

Visualizing and Tracking Endogenous mRNAs in Live Drosophila melanogaster Egg Chambers

Here, we present a protocol for the visualization, detection, analysis and tracking of endogenous mRNA trafficking in live Drosophila melanogaster egg chamber using molecular beacons, spinning disc confocal microscopy, and open-source analysis software.

Fluorescence-based imaging techniques, in combination with developments in light microscopy, have revolutionized how cell biologists conduct live cell ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also be utilized to explore other complex regulatory mechanisms at the exon level. Alternative splicing and polyadenylation play a crucial role in the functional diversity of a gene by generating different isoforms to regulate gene expression at the post-transcriptional level, and limiting analyses to the whole gene level can miss this important regulatory layer. Here, we demonstrate detailed step by step analyses for identification and visualization of differential exon and polyadenylation site usage across conditions, using Bioconductor and other packages and functions, including DEXSeq, diffSplice from the Limma package, and rMATS.

Alternative splicing (AS) and alternative polyadenylation (APA) expand the diversity of transcript isoforms and their products. Here, we describe bioinformatic protocols to analyze bulk RNA-seq and 3' end sequencing assays to detect and visualize AS and APA varying across experimental conditions.

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...