This research was funded by the Projects of the National Natural Science Foundation of China (32172476, 32102275), the Agricultural Science and Technology Innovation Program (CAAS-ZDRW202203, CAAS-ZDRW202108), and Central Funds Guiding the Local Science and Technology Development (XZ202301YD0042C).

NOTE: See the Table of Materials for details related to all materials, instruments, software, and reagents used in this protocol.
1. Collection and maintenance of insect culture
<ol>
	<li>Adhere a group of ~5,000 eggs of Corcyra cephalonica (Stainton) onto a 9 cm by 16 cm card using a 1:5 (v/v) solution of gum arabic powder and water25,26. 
	NOTE: Avoid attaching too many host eggs to the card as overcrowding makes it impractical for subsequent transfer and dissection procedures.</li>
	<li>To prevent the hatching of host eggs, subject the host egg cards to 30 min of ultraviolet (UV) irradiation (Figure 1-i). Subsequently, cut the paper with inactivated eggs into egg cards measuring 1 cm thick and 8 cm in diameter, each containing approximately 300-500 eggs (Figure 1-ii)25,26,27.</li>
	<li>Introduce a cohort of 80-120 T. denrolimi wasps into a glass tube measuring 2 cm in diameter and 8 cm in length. Seal the tube with cotton. 
	NOTE: Maintain the wasps at a temperature of 25 &#177; 1 &#176;C, with a light/dark cycle of 16 h of light and 8 h of darkness and maintain a relative humidity of approximately 75%.</li>
	<li>Present a host egg card to the wasps for parasitization (Figure 1-ii). Permit the wasps to deposit their eggs into the host eggs for 6 h, after which promptly remove the wasps. 
	&#8203;NOTE: Avoid prolonging the parasitization period excessively as this can lead to overcrowding of T. denrolimi offspring within a host egg, resulting in increased offspring wasp mortality28,29.</li>
</ol>
2. Synthesis of dsRNA
<ol>
	<li>Design primer sets containing a T7 promoter for the synthesis of double-stranded RNA (dsRNA). Choose a 300-400 bp segment from the targeted gene (Ferhch) for dsRNA synthesis.</li>
	<li>Acquire commercially synthesized primer sets for the production of dsRNA for the targeted gene and dsGFP for use as a negative control.</li>
	<li>Extract RNA content from 100 T. denrolimi wasps using the referenced kit following the manufacturer&#39;s protocol9. Check the quality of RNA content; proceed if the value of OD260/OD280 ranges from 1.8 to 2.09.</li>
	<li>Purify the RNA content with 2 &#181;L of 5x buffer (1 U/50 &#181;L), 1 &#181;L of DNAse (1 U/50 &#181;L), and 6.5 &#181;L of RNA (~100 ng/&#181;L), 0.5 &#181;L of H2O at 42 &#176;C for 2 min.</li>
	<li>Perform reverse transcriptase polymerase chain reaction (RT-PCR) to generate a cDNA template with 10 &#181;L of purified RNA (~100 ng/&#181;L), 4 &#181;L of 5x buffer (1 U/50 &#181;L), 1 &#181;L of Enzyme Mix I (1 U/50 &#181;L), and 4 &#181;L of H2O. Perform RT-PCR using the following settings: 37 &#176;C for 15 min, 85 &#176;C for 5 s. Store the cDNA product at -4 &#176;C until use.</li>
	<li>Perform polymerase chain reaction (PCR) to amplify the dsRNA sequences in accordance with the referenced master mix (10 &#181;L of Taq II [1 U/50 &#181;L], 0.8 &#181;L of forward primer [0.4 &#181;M], 0.8 &#181;L of reverse primer [0.4 &#181;M], 0.8 &#181;L of DNA template [40 ng/&#181;L], and 7.6 &#181;L of H2O). Perform PCR using the following settings: 94 &#176;C for 2 min; 35 cycles with 94 &#176;C for 30 s, 60 &#176;C for 30 s, 72 &#176;C for 30; 72 &#176;C for 2 min.</li>
	<li>Assess the quality of PCR products by electrophoresis on a 2.0% agarose gel5,9 and confirm the target sequence through Sanger sequencing.</li>
	<li>Purify the PCR product using the Gel Extraction Kit as per the manufacturer&#39;s guidelines9,23.</li>
	<li>Utilize an RNAi System to synthesize dsRNA for the target gene with 10 &#181;L of 2x buffer (0.02 U/&#181;L), 8 &#181;L of DNA template (75 ng/&#181;L), and 2 &#181;L of enzyme mix (1 U/50 &#181;L) with the following settings: 37 &#176;C for 30 min, 70 &#176;C for 10 min, and 25 &#176;C for 20 min. Elute the synthesized dsRNA with 30 &#181;L of Nuclease-Free Water.</li>
	<li>Assess the quality of the dsRNA product by visualizing it on a 1.0% agarose gel5,9. Dilute the dsRNA to 7,000 ng/&#181;L. Check the quality of the dsRNA product; proceed if the value of OD260/OD280 ranges from 1.8 to 2.09. Store the dsRNA product at -20 &#176;C until use.</li>
</ol>
3. Transplantation of T. denrolimi pupae
<ol>
	<li>Cultivate the parasitized host eggs for approximately 8 days at 25 &#177; 1&#176;C, maintaining a 16 h light/8 h dark cycle and a relative humidity of ~75%. The parasitized host eggs will blacken after 5 days30 (Figure 1-iv,v).</li>
	<li>Transfer the host egg card to a dissecting microscope. Employ a pair of tungsten needles (Figure 1-vi) to meticulously remove the chorion from the host eggs (Figure 1-vii) and retrieve the pupa from within (Figure 1-viii)5,17,18. 
	NOTE: The tip of the dissecting needle should be less than 0.05 mm.</li>
	<li>Prepare a clean plate for the substrate. Pour out 10-15 mL of a 15 g/L agar solution, allowing it to naturally cool (Figure 2-i). 
	NOTE: Mix the agar solution with 0.5 g of streptomycin to inhibit the growth of contaminants in vitro.</li>
	<li>Employ a disinfected graver to etch several grooves measuring 0.2-0.3 mm in depth and 0.4-0.8 mm in width (Figure 2-ii).</li>
	<li>Use a small brush (Figure 2-iii) to transplant a pupa from the dissected host egg into one of the grooves on the agar substrate (Figure 2-iv).</li>
	<li>Repeat steps 3.4 and 3.5, transplanting 100-300 pupae individually into the grooves one by one (Figure 2-v).</li>
</ol>
4. Micro-injecting dsRNA into T. denrolimi pupa
<ol>
	<li>Use a glass needle puller to pull a glass capillary (Figure 3-i,ii). Set the Heat to 280, the Velocity to 170, the Delay to 250, and the Pull to 30 on a needle puller (Figure 3-iii). Prepare multiple capillary glass needles for microinjection (Figure 3-iv,v).</li>
	<li>Bevel the tip of the glass needle using an abrasive plate (Figure 3-vi). 
	NOTE: Ensure that the injection needle&#39;s tip remains sharp; otherwise, it may result in pupal mortality or impede reagent flow through the needle (Figure 3-vii).</li>
	<li>Load approximately 2 &#181;L of the dsRNA injection solution with 7,000 ng/&#181;L into the prepared injection needle using a micro-injection pump (Figure 3-vii).</li>
	<li>Transfer the agar substrate containing hundreds of pupae onto the platform of a compound microscope (Figure 3-viii).</li>
	<li>Carefully insert the injection needle into the abdomen of a T. denrolimi pupa at a ~30&#176; angle to the abdomen under the lens (Figure 3-ix).</li>
	<li>Gradually inject ~5 nL of the injection solution (step 4.3) into the T. denrolimi pupa as gently as possible. 
	NOTE: The T. denrolimi pupa may slightly swell as the dsRNA solution is injected. Injecting an excessive amount of solution into the pupa or using needles with overly large openings may result in premature pupal death. Change the needles when they become clogged after injecting several to tens of pupae.</li>
	<li>Repeat steps 4.5 and 4.6, injecting dsRNA into 600 pupae one by one. 
	&#8203;NOTE: For reliable RT-qPCR analysis, RNA content should be isolated from at least 100 pupae. Inject at least 600 pupae for three replicates in the dsRNA treatment and three replicates in the dsGFP negative control9.</li>
</ol>
5. Incubation of T. denrolimi pupae
<ol>
	<li>Transfer the substrate containing injected pupae to an incubator at 25 &#177; 1 &#176;C with a 16 h/8 h light/dark cycle and ~75% RH.</li>
	<li>Incubate approximately 700 T. denrolimi pupae per treatment for either 24 h or 48 h. Extract RNA content from a group of 100 pupae per replicate9. 
	&#8203;NOTE: Remove the shrunk pupae (dead pupae) from the samples; otherwise, it may result in errors in the detection of gene expression.</li>
	<li>Incubate ~50 T. denrolimi pupae per treatment until the wasps emerge (Figure 3-x). Record the emergence rate and deformity rate.</li>
</ol>
6. Detection of targeted gene expression
<ol>
	<li>Design the primer set for the target gene and reference genes for RT-qPCR using a design tool. 
	NOTE: Ensure that the sequences of the RT-qPCR primers do not overlap with the targeted region of dsRNA.</li>
	<li>Employ the gene forkhead box O (FoxO) as the reference gene in the RT-qPCR analysis; the primers of FoxO have been reported previously9.</li>
	<li>Obtain commercially synthesized primer sets. Perform RT-qPCR with 10 &#181;L of Taq II (1 U/50 &#181;L), 0.8 &#181;L of forward primer (0.4 &#181;M), 0.8 &#181;L of reverse primer (0.4 &#181;M), 0.8 &#181;L of template (10 ng/&#181;L), and 7.6 &#181;L of H2O. Perform RT-qPCR using the following settings: 95 &#176;C for 30 s; 35 cycles with 95 &#176;C for 5 s, 57 &#176;C for 30 s, 72 &#176;C for 30; 95 &#176;C for 10 s; 60 &#176;C for 5 s, and 95 &#176;C for 5 s.</li>
	<li>Calculate the expression value of the targeted gene by using the 2-&#916;&#916;Ct method9,25.</li>
	<li>Employ the Kruskal-Wallis test to analyze the expression of the target gene under the influence of different treatments (dsFerhch, dsGFP, non-injection). 
	NOTE: Avoid using parametric tests (e.g., t-test) for post-hoc comparisons as the data&#39;s heteroscedasticity and non-normality may lead to erroneous conclusions25.</li>
</ol>

Advancing RNAi Techniques in Trichogramma dendrolimi for Gene Function Analysis

<ol><li>Zang, L. S., Wang, S., Zhang, F., Desneux, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Biological+control+with+Trichogramma+in+China%3A+History%2C+present+status+and+perspectives%5BTitle%5D)+AND+%22Annu+Rev+Entomol%22%5BJournal%5D)">Biological control with Trichogramma in China: History, present status and perspectives.</a> Annu Rev Entomol. 66, 463-484 (2020).</li>
<li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimal+clutch+size+for+quality+control+of+bisexual+and+Wolbachia-infected+thelytokous+lines+of+Trichogramma+dendrolimi+Matsumura+%28Hymenoptera%3A+Trichogrammatidae%29+mass+reared+on+eggs+of+a+substitutive+host%2C+Antheraea+pernyi+Gu%C3%A9rin-M%C3%A9neville+%28Lepidoptera%3A+Saturniidae%29%5BTitle%5D)+AND+%22Pest+Manag+Sci%22%5BJournal%5D)">Optimal clutch size for quality control of bisexual and Wolbachia-infected thelytokous lines of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) mass reared on eggs of a substitutive host, Antheraea pernyi Guérin-Méneville (Lepidoptera: Saturniidae).</a> Pest Manag Sci. 76 (8), 2635-2644 (2020).</li>
<li>Li, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Current+status+of+the+biological+control+of+the+fall+armyworm+Spodoptera+frugiperda+by+egg+parasitoids%5BTitle%5D)+AND+%22J+Pest+Sci%22%5BJournal%5D)">Current status of the biological control of the fall armyworm Spodoptera frugiperda by egg parasitoids.</a> J Pest Sci. 96, 1345-1363 (2023).</li>
<li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effects+of+temperature+and+superparasitism+on+quality+and+characteristics+of+thelytokous+Wolbachia-infected+Trichogramma+dendrolimi+Matsumura+%28Hymenoptera%3A+Trichogrammatidae%29+during+mass+rearing%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Effects of temperature and superparasitism on quality and characteristics of thelytokous Wolbachia-infected Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) during mass rearing.</a> Sci Rep. 9 (1), 18114(2019).</li>
<li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Penetrance+during+Wolbachia-mediated+parthenogenesis+of+Trichogramma+wasps+is+reduced+by+continuous+oviposition%2C+associated+with+exhaustion+of+Wolbachia+titers+in+ovary+and+offspring+eggs%5BTitle%5D)+AND+%22Pest+Manag+Sci%22%5BJournal%5D)">Penetrance during Wolbachia-mediated parthenogenesis of Trichogramma wasps is reduced by continuous oviposition, associated with exhaustion of Wolbachia titers in ovary and offspring eggs.</a> Pest Manag Sci. 78 (7), 3080-3089 (2022).</li>
<li>Huang, N. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long-term+and+large-scale+releases+of+Trichogramma+promote+pesticide+decrease+in+maize+in+northeastern+China%5BTitle%5D)+AND+%22Entomol+Gen%22%5BJournal%5D)">Long-term and large-scale releases of Trichogramma promote pesticide decrease in maize in northeastern China.</a> Entomol Gen. 40 (4), 331-335 (2020).</li>
<li>Wang, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Performance+of+Trichogramma+japonicum+as+a+vector+of+Beauveria+bassiana+for+parasitizing+eggs+of+rice+striped+stem+borer%2C+Chilo+suppressalis%5BTitle%5D)+AND+%22Entomol+Gen%22%5BJournal%5D)">Performance of Trichogramma japonicum as a vector of Beauveria bassiana for parasitizing eggs of rice striped stem borer, Chilo suppressalis.</a> Entomol Gen. 41 (2), 147-155 (2021).</li>
<li>Ning, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+identification+and+expression+pattern+of+the+sex+determination+genes+and+their+sex-specific+variants+in+the+egg+parasitoid+Trichogramma+dendrolimi+Matsumura+%28Hymenoptera%3A+Trichogrammatidae%29%5BTitle%5D)+AND+%22Front+Physiol%22%5BJournal%5D)">The identification and expression pattern of the sex determination genes and their sex-specific variants in the egg parasitoid Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae).</a> Front Physiol. 14, 1243753(2023).</li>
<li>Huo, L. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Selection+and+evaluation+of+RT-qPCR+reference+genes+for+expression+analysis+in+the+tiny+egg+parasitoid+wasp%2C+Trichogramma+dendrolimi+Matsumura+%28Hymenoptera%3A+Trichogrammatidae%29%5BTitle%5D)+AND+%22J+Asia+Pac+Entomol%22%5BJournal%5D)">Selection and evaluation of RT-qPCR reference genes for expression analysis in the tiny egg parasitoid wasp, Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae).</a> J Asia Pac Entomol. 25 (2), 101883(2022).</li>
<li>Leung, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Next-generation+biological+control%3A+the+need+for+integrating+genetics+and+genomics%5BTitle%5D)+AND+%22Biol+Rev+Camb+Philos+Soc%22%5BJournal%5D)">Next-generation biological control: the need for integrating genetics and genomics.</a> Biol Rev Camb Philos Soc. 95 (6), 1838-1854 (2020).</li>
<li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li>
<li>Leonard, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Engineered+symbionts+activate+honey+bee+immunity+and+limit+pathogens%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Engineered symbionts activate honey bee immunity and limit pathogens.</a> Science. 367 (6477), 573-576 (2020).</li>
<li>Sun, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Silencing+an+essential+gene+involved+in+infestation+and+digestion+in+grain+aphid+through+plant-mediated+RNA+interference+generates+aphid-resistant+wheat+plants%5BTitle%5D)+AND+%22Plant+Biotechnol+J%22%5BJournal%5D)">Silencing an essential gene involved in infestation and digestion in grain aphid through plant-mediated RNA interference generates aphid-resistant wheat plants.</a> Plant Biotechnol J. 17 (5), 852-854 (2019).</li>
<li>Li, M., Bui, M., Akbari, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Embryo+Microinjection+and+Transplantation+Technique+for+Nasonia+vitripennis+Genome+Manipulation%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Embryo Microinjection and Transplantation Technique for Nasonia vitripennis Genome Manipulation.</a> J Vis Exp. 130, e56990(2017).</li>
<li>Dalla Benetta, E., Chaverra-Rodriguez, D., Rasgon, J. L., Akbari, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pupal+and+Adult+Injections+for+RNAi+and+CRISPR+Gene+Editing+in+Nasonia+vitripennis%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Pupal and Adult Injections for RNAi and CRISPR Gene Editing in Nasonia vitripennis.</a> J Vis Exp. 166, e61892(2020).</li>
<li>Lynch, J. A., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+method+for+parental+RNA+interference+in+the+wasp+Nasonia+vitripennis%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">A method for parental RNA interference in the wasp Nasonia vitripennis.</a> Nat Protoc. 1 (1), 486-494 (2006).</li>
<li>Zhu, K. Y., Palli, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mechanisms%2C+Applications%2C+and+Challenges+of+Insect+RNA+Interference%5BTitle%5D)+AND+%22Annu+Rev+Entomol%22%5BJournal%5D)">Mechanisms, Applications, and Challenges of Insect RNA Interference.</a> Annu Rev Entomol. 65, 293-311 (2020).</li>
<li>Colinet, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Development+of+RNAi+in+a+Drosophila+endoparasitoid+wasp+and+demonstration+of+its+efficiency+in+impairing+venom+protein+production%5BTitle%5D)+AND+%22J+Insect+Physiol%22%5BJournal%5D)">Development of RNAi in a Drosophila endoparasitoid wasp and demonstration of its efficiency in impairing venom protein production.</a> J Insect Physiol. 63, 56-61 (2014).</li>
<li>Wang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+digestive+tract+expressing+%CE%B1-amylase+influences+the+adult+lifespan+of+Pteromalus+puparum+revealed+through+RNAi+and+rescue+analyses%5BTitle%5D)+AND+%22Pest+Manag+Sci%22%5BJournal%5D)">A digestive tract expressing α-amylase influences the adult lifespan of Pteromalus puparum revealed through RNAi and rescue analyses.</a> Pest Manag Sci. 75 (12), 3346-3355 (2019).</li>
<li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Wolbachia-infected+Trichogramma+dendrolimi+is+outcompeted+by+its+uninfected+counterpart+in+superparasitism+but+does+not+have+developmental+delay%5BTitle%5D)+AND+%22Pest+Manag+Sci%22%5BJournal%5D)">Wolbachia-infected Trichogramma dendrolimi is outcompeted by its uninfected counterpart in superparasitism but does not have developmental delay.</a> Pest Manag Sci. 79 (3), 1005-1017 (2023).</li>
<li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Posterior+concentration+of+Wolbachia+during+the+early+embryogenesis+of+the+host+dynamically+shapes+the+tissue+tropism+of+Wolbachia+in+host+Trichogramma+wasps%5BTitle%5D)+AND+%22Front+Cell+Infect+Microbiol%22%5BJournal%5D)">Posterior concentration of Wolbachia during the early embryogenesis of the host dynamically shapes the tissue tropism of Wolbachia in host Trichogramma wasps.</a> Front Cell Infect Microbiol. 13, 1198428(2023).</li>
<li>Lee, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+development+of+Trichogramma+evanescens+Westw.+and+its+influence+on+the+embryonic+development+of+its+host%2C+Attacus+cynthia+ricini+Boisd%5BTitle%5D)+AND+%22Acta+Entomol+Sin+Z%22%5BJournal%5D)">The development of Trichogramma evanescens Westw. and its influence on the embryonic development of its host, Attacus cynthia ricini Boisd.</a> Acta Entomol Sin Z. 11 (1), 89-119 (1961).</li>
<li>Shen, Y., Chen, Y. Z., Zhang, C. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNAi-mediated+silencing+of+genes+in+the+brown+planthopper+Nilaparvata+lugens+affects+survival%2C+growth+and+female+fecundity%5BTitle%5D)+AND+%22Pest+Manag+Sci%22%5BJournal%5D)">RNAi-mediated silencing of genes in the brown planthopper Nilaparvata lugens affects survival, growth and female fecundity.</a> Pest Manag Sci. 77 (1), 365-377 (2021).</li>
<li>Wu, S., Yin, S., Zhou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+physiology+of+iron+trafficking+in+Drosophila+melanogaster%5BTitle%5D)+AND+%22Curr+Res+Insect+Sci%22%5BJournal%5D)">Molecular physiology of iron trafficking in Drosophila melanogaster.</a> Curr Res Insect Sci. 50, 100888(2022).</li>
<li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Wolbachia-Driven+Memory+Loss+in+a+Parasitic+Wasp+Increases+Superparasitism+to+Enhance+Horizontal+Transmission%5BTitle%5D)+AND+%22mBio%22%5BJournal%5D)">Wolbachia-Driven Memory Loss in a Parasitic Wasp Increases Superparasitism to Enhance Horizontal Transmission.</a> mBio. 13 (6), e0236222(2022).</li>
<li>Ning, S. F., Zhou, J. C., Liu, Q. Q., Zhao, Q., Dong, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gradual%2C+temperature-induced+change+of+secondary+sexual+characteristics+in+Trichogramma+pretiosum+infected+with+parthenogenesis-inducing+Wolbachia%5BTitle%5D)+AND+%22PeerJ%22%5BJournal%5D)">Gradual, temperature-induced change of secondary sexual characteristics in Trichogramma pretiosum infected with parthenogenesis-inducing Wolbachia.</a> PeerJ. 7, e7567(2019).</li>
<li>Zhang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Decreased+Wolbachia+titers+cause+gradual+change+in+masculinization+of+intersex+individuals+of+thelytokous+Trichogramma+dendrolimi%5BTitle%5D)+AND+%22Entomol+Gen%22%5BJournal%5D)">Decreased Wolbachia titers cause gradual change in masculinization of intersex individuals of thelytokous Trichogramma dendrolimi.</a> Entomol Gen. 42 (5), 751-759 (2022).</li>
<li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multi-parasitism%3A+A+promising+approach+to+simultaneously+produce+Trichogramma+chilonis+and+T.+dendrolimi+on+eggs+of+Antheraea+pernyi%5BTitle%5D)+AND+%22Entomol+Gen%22%5BJournal%5D)">Multi-parasitism: A promising approach to simultaneously produce Trichogramma chilonis and T. dendrolimi on eggs of Antheraea pernyi.</a> Entomol Gen. 41 (6), 627-636 (2021).</li>
<li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effects+of+Thelytokous+parthenogenesis-inducing+Wolbachia+on+the+fitness+of+Trichogramma+dendrolimi+Matsumura+%28Hymenoptera%3A+Trichogrammatidae%29+in+superparasitised+and+single-parasitised+hosts%5BTitle%5D)+AND+%22Front+Ecol+Evol%22%5BJournal%5D)">Effects of Thelytokous parthenogenesis-inducing Wolbachia on the fitness of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) in superparasitised and single-parasitised hosts.</a> Front Ecol Evol. 9, 730664(2021).</li>
<li>Flanders, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Notes+on+the+life+history+and+anatomy+of+Trichogramma%5BTitle%5D)+AND+%22Ann+Entomol+Soc+Am%22%5BJournal%5D)">Notes on the life history and anatomy of Trichogramma.</a> Ann Entomol Soc Am. 30 (2), 304-308 (1937).</li>
</ol>

The authors declare that they have no conflicts of interest.

Trichogramma wasps are recognized as effective biological control agents, specifically targeting a range of lepidopteran pests in agriculture and forestry1. These diminutive wasps undergo their immature stages within the host egg, a characteristic that presents challenges in conducting RNAi experiments5,18. This study offers a comprehensive visual guide for conducting RNAi experiments in T. denrolimi. Given the shared bio...

Trichogramma spp. are a group of egg parasitoids that have been extensively utilized as highly efficient biological control agents against a wide spectrum of lepidopteran pests in agricultural and forest ecosystems worldwide1,2,3,4. The application of mass-reared Trichogramma provides an environmentally friendly approach for the sustainable management of pests5,6,7. Understanding the molecular biology of Trichogramma wasps provides valuable insights into enhancing the mass-rearing efficiency and field performance of these biological control agents8,9by investigating the methodology of gene regulation and genome editing10.
Since the discovery of double-stranded RNA (dsRNA)-mediated specific genetic interference in Caenorhabditis elegans in 1998, the RNA-interference (RNAi) method has evolved into a vital genetic toolkit for exploring the regulatory mechanisms of organisms by suppressing the expression of target genes11. RNAi experiments have become a standard methodology widely applied to study gene function in numerous insect species12,13. Nevertheless, the manipulation of RNAi presents a formidable challenge in many parasitoid species, particularly among those belonging to the endoparasitic Chalcidoidea family14,15,16. The RNAi method has been documented in at least 13 parasitoid species14,15,16,17,18,19. Among these, the RNAi approach has been comprehensively conducted in Nasonia wasps and is applicable throughout the developmental stages, including embryos, larvae, pupae, and adults14,15,16. It is noteworthy that Nasonia wasps are ectoparasitoids, with their offspring developing in the interstitial space between the host pupa and the puparium, enabling their cultivation in vitro and making them tolerate certain treatments, such as micro-injection. Unlike Nasonia wasps, Trichogramma individuals undergo their entire embryonic, larval, and pupal development inner the host egg. The layer at embryo and larva stages (which may impede dsRNA permeability), vulnerability to damage, and the difficulty in surviving in vitro present formidable obstacles20,21,22. Additionally, the diminutive size of Trichogramma individuals, approximately ~0.5 mm in adult or pupal length, renders them exceedingly intricate to manipulate20,21,22.
In the present study, we outline a comprehensive procedure for conducting RNA interference (RNAi) experiments in Trichogramma denrolimi Matsumura. This procedure encompasses the following procedures: (1) the design and synthesis of double-stranded RNA (dsRNA), (2) microinjection of T. denrolimi pupae, (3) the transplantation and in vitro incubation of these pupae, and (4) the detection of target gene knockdown through RT-qPCR analysis. The target gene selected for the RNAi experiment is the ferritin heavy chain homology (Ferhch). FerHCH, an iron-binding protein, contains a ferroxidase center endowed with antioxidant capabilities, facilitating the oxidation of Fe2+ to Fe3+. It plays an indispensable role in the growth and development of various organisms by maintaining redox equilibrium and iron homeostasis. Depletion of FerHCH can result in the overaccumulation of iron, leading to irreversible tissue damage, and often culminating in significant phenotypic alterations, including growth defects, deformities, and mortality23,24. This study offers a step-by-step guide for conducting RNAi in T. denrolimi, which will be invaluable for investigating the gene functions within the broader context of Trichogramma wasps.

<table><tbody><tr><td>2x ES Taq MasterMix (Dye)</td><td>Cowin Biotech, China</td><td>CW0690H</td><td>To amplify the dsRNA sequences</td></tr><tr><td>20x PBS Buffer, DEPC treated (7.2-7.6)</td><td>Sangon Biotech, China</td><td>B540627-0500</td><td>To dilute dsRNA</td></tr><tr><td>Agar strip</td><td>Shishi Globe Agar Industries Co.,Ltd, China</td><td>n/a</td><td>To make culture medium</td></tr><tr><td>Ampicillin sodium</td><td>Sangon Biotech, China</td><td>A610028</td><td>To make culture medium</td></tr><tr><td>Bioer Constant temperature metal bath&amp;nbsp;</td><td>BIOER, China</td><td>MB-102</td><td>To synthesis dsRNA</td></tr><tr><td>Borosilicate glass capillary&amp;nbsp;</td><td>WPI, USA</td><td>1B100-4</td><td>To pull capillary glass needle</td></tr><tr><td>Clean bench&amp;nbsp;</td><td>Airtech, China</td><td>SW-CJ-1FD</td><td>To extract RNA</td></tr><tr><td>Double distilled water</td><td>Sangon Biotech, China</td><td>A500197-0500</td><td>To dilute cDNA</td></tr><tr><td>Environmental Testing chamber&amp;nbsp;</td><td>Panasonic, Japan</td><td>MLR-352H-PC</td><td>To culture &lt;em&gt;T. denrolimi&lt;/em&gt;</td></tr><tr><td>Eppendorf Centrifuge&amp;nbsp;</td><td>Eppendrof, Germany</td><td>5418R</td><td>To store RNA content</td></tr><tr><td>Eppendorf FemtoJet 4i</td><td>Eppendrof, Germany</td><td>FemtoJet 4i</td><td>To inject &lt;em&gt;T. denrolimi&lt;/em&gt;</td></tr><tr><td>Eppendorf Refrigerated Centrifuge&amp;nbsp;</td><td>Eppendrof, Germany</td><td>5810R</td><td>Centrifuge</td></tr><tr><td>Ethanol solution (75%, RNase-free)</td><td>Aladdin, China</td><td>M052131-500ml</td><td>To extract RNA</td></tr><tr><td>Gel Extraction Kit</td><td>Omega, USA</td><td>D25000-02</td><td>To extract cDNA</td></tr><tr><td>GUM Arabic</td><td>Solarbio, China</td><td>CG5991-500g</td><td>To make egg card</td></tr><tr><td>Isopropyl alchohol</td><td>Aladdin, China</td><td>80109218</td><td>To extract RNA</td></tr><tr><td>Laser-Based Micropipette Puller&amp;nbsp;</td><td>SUTTER, USA</td><td>P-2000</td><td>To pull capillary glass needle</td></tr><tr><td>Microloader&amp;nbsp;</td><td>Eppendrof, Germany</td><td>20 &amp;micro;L</td><td>To load dsRNA</td></tr><tr><td>Multi-sample tissue grinder&amp;nbsp;</td><td>LICHEN, China</td><td>LC-TG-24</td><td>To grind &lt;em&gt;T. denrolimi&lt;/em&gt;</td></tr><tr><td>Needle Grinder&amp;nbsp;</td><td>SUTTER, USA</td><td>BV-10-E</td><td>To grind capillary glass needle</td></tr><tr><td>Nuclease-Free Water</td><td>Sangon Biotech, China</td><td></td><td>To dilute RNA</td></tr><tr><td>OLYMPUS Microscope</td><td>OLYMPUS, Japan</td><td>XZX16</td><td>To observe T. denrolimi</td></tr><tr><td>PCR machine&amp;nbsp;</td><td>Bio-rad, USA</td><td>S-1000</td><td>For DNA amplification</td></tr><tr><td>PowerPac Basic</td><td>Bio-rad, USA</td><td>PowerPacTM Basic</td><td>To detect the quality of dsRNA&amp;nbsp;</td></tr><tr><td>Primer of &lt;em&gt;dsGFP &lt;/em&gt;(Forward)</td><td></td><td></td><td>[TAATACGACTCACTATAGGG]&lt;br/&gt; ACAAACCAAGGCAAGTAATA</td></tr><tr><td>Primer of &lt;em&gt;dsGFP &lt;/em&gt;(Reverse)</td><td></td><td></td><td>[TAATACGACTCACTATAGGG]&lt;br/&gt; CAGAGGCATCTTCAACG</td></tr><tr><td>Primer of &lt;em&gt;Ferhch &lt;/em&gt;for qPCR (Forward)</td><td></td><td></td><td>TGAAGAGATTCTGCGTTCTGCT</td></tr><tr><td>Primer of &lt;em&gt;Ferhch &lt;/em&gt;for qPCR (Reverse)</td><td></td><td></td><td>CTGTAGGAACATCAGCAGGCTT</td></tr><tr><td>Primer of &lt;em&gt;Ferhch &lt;/em&gt;for RNAi (Reverse)</td><td></td><td></td><td>[TAATACGACTCACTATAGGG]AG&lt;br/&gt; TAGCCATCATCTTTCC</td></tr><tr><td>Primer of &lt;em&gt;Ferhch &lt;/em&gt;for RNAi(Forward)</td><td></td><td></td><td>[TAATACGACTCACTATAGGG]&lt;br/&gt; ACACTGTCAATCGTCCTG</td></tr><tr><td>Primer of &lt;em&gt;FoxO &lt;/em&gt;for qPCR (Forward)</td><td></td><td></td><td>CTACGCCGATCTCATAACGC</td></tr><tr><td>Primer of FoxO for qPCR (Reverse)</td><td></td><td></td><td>TGCTGTCGCCCTTGTCCT</td></tr><tr><td>PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time)</td><td>TaKaRa, Japan</td><td>RR047A</td><td></td></tr><tr><td>Quantitative Real-time PCR&amp;nbsp;</td><td>Bio-rad, USA</td><td>CFX 96 Touch</td><td>To perform reverse transcriptase polymerase chain reaction (RT-PCR)&amp;nbsp;</td></tr><tr><td>Real-time PCR (TaqMan) Primer and Probes Design Tool</td><td></td><td></td><td>https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool/</td></tr><tr><td>T7 RiBoMAX Express RNAi System</td><td>Promega, USA</td><td>P1700</td><td>To synthesis dsRNA &amp;nbsp;&lt;em&gt;in vitro&amp;nbsp;&lt;/em&gt;</td></tr><tr><td>TB Green Premix Ex TaqTM &lt;img alt=&quot;Equation 1&quot; src=&quot;/files/ftp_upload/66250/66250eq01.jpg&quot; style=&quot;margin: auto;&quot;/&gt; (Til RnaseH Plus)</td><td>TaKaRa, Japan</td><td>RR820A</td><td>To perform RT-qPCR</td></tr><tr><td>Trichloromethane</td><td>KESHI, China</td><td>GB/T682-2002</td><td>To extract RNA</td></tr><tr><td>TRIzol Reagent</td><td>Ambion, USA</td><td>15596018</td><td>To extract total RNA content from samples</td></tr><tr><td>Ultra-low Temperature Freezer&amp;nbsp;</td><td>Thermo, USA</td><td>Forma 911</td><td></td></tr></tbody></table>

rna interference in the egg parasitoid, trichogramma dendrolimi matsumura

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

The emergence rate of T. denrolimi pupae injected with dsFerhch was significantly lower than that of those injected with dsGFP or those without injection (Table 1). Among the emerged wasps, 51.85% of T. denrolimi wasps subjected to dsFerhch developed deformed small wings. The deformed wasps were not observed in the wasps injected with dsGFP or without any injection (Table 1). Moreover, the abdomens of T. denrolimi pupae injec...

Watch this Scientific Journal Video about RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura at JoVE.com

Author Spotlight: Investigating Wolbachia-Induced Thelytokous Parthenogenesis and Genetic Toolkit Development Through RNA Interference

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and ...

rna-interference-egg-parasitoid-trichogramma-dendrolimi

Research

JoVE Journal

Biology

1.3K Views.  Shenyang Agricultural University. The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

Video: Author Spotlight: Investigating Wolbachia-Induced Thelytokous Parthenogenesis and Genetic Toolkit Development Through RNA Interference

Determining the Egg Fertilization Rate of Bemisia tabaci Using a Cytogenetic Technique

A few species of sap-sucking whiteflies are some of the most damaging terrestrial pests worldwide because of the crop damage they inflict and plant viruses they vector. Despite numerous studies of the biology of these species in different environments, a key life history parameter, offspring sex ratios, has received little attention, yet is important for predicting population dynamics. The primary sex ratio (sex ratio at oviposition) of Bemisia tabaci has never been reported but can be found by determining the egg fertilization rate of this haplodiploid insect. The technique involves the dechorionation of eggs with bleach, a series of fixation steps, and the application of the general DNA fluorescent stain, DAPI (4&#8242;,6-diamidino-2-phenylindole, a DNA-binding fluorescent dye), to bind to female and male pronuclei. Here, we present the technique, and an example of its application, to test whether an endosymbiotic bacterium, Rickettsia sp. nr. bellii, influenced the primary sex ratio of B. tabaci. This method may assist in population studies of whiteflies, or in determining if sex allocation exists with certain environmental stimuli.

Determining the Egg Fertilization Rate of Bemisia tabaci Using a Cytogenetic Technique

We present a simple cytogenetic technique using 4&#8242;,6-diamidino-2-phenylindole (DAPI) to determine the fertilization rate and primary sex ratio of the haplodiploid invasive pest Bemisia tabaci.

A few species of sap-sucking whiteflies are some of the most damaging terrestrial pests worldwide because of the crop damage they inflict and plant ...

Genetics

In Vitro Nuclear Assembly Using Fractionated Xenopus Egg Extracts

Nuclear membrane assembly is an essential step in the cell division cycle; this process can be replicated in the test tube by combining Xenopus sperm chromatin, cytosol, and light membrane fractions. Complete nuclei are formed, including nuclear membranes with pore complexes, and these reconstituted nuclei are capable of normal nuclear processes.

Nuclear membrane assembly is an essential step in the cell division cycle; this process can be replicated in the test tube by combining Xenopus sperm chromatin, cytosol, and light membrane fractions. Complete nuclei are formed, including nuclear membranes with pore complexes, and these reconstituted nuclei are capable of normal nuclear processes.

Nuclear membrane assembly is an essential step in the cell division cycle; this process can be replicated in the test tube by combining Xenopus sperm ...

Mass-Rearing and Molecular Studies in Tortricidae Pest Insects

Tortricidae (Lepidoptera), commonly known as tortrix or leafroller moths, comprises many agricultural and forestry pests, which cause serious agricultural losses. To understand the biology of such pest moths, fundamental techniques have been in high demand. Here, methods for mass-rearing, observations, and molecular studies are developed using two tea tortrix, Homona magnanima and Adoxophyes honmai (Lepidoptera: Tortricidae). Insects were mass-reared with sliced artificial diet and maintained by inbreeding for over 100 generations by considering their biological characteristics. Insects have various sex dimorphisms; hence it is difficult to distinguish the sex during the developing stages, which have prevented subsequent assays. The present work highlighted that the sex of tortricids larvae could be determined by observing testes or lactic-acetic orcein staining to visualize the female-specific W chromosome. Moreover, using the sex determination methods, the present study enabled nucleic acid extractions from sex determined embryos and application toward high throughput sequencing. These tips are applicable for other pest insects and will facilitate further morphological and genetic studies.

The present protocol describes the rearing method of tortricid pest insects in the laboratories. The procedures to distinguish insects' sex and extract nucleic acids for high throughput sequencing are established using two tortricid pests.

Tortricidae (Lepidoptera), commonly known as tortrix or leafroller moths, comprises many agricultural and forestry pests, which cause serious agricultural ...

Environment

Injecting Gryllus bimaculatus Eggs

Altering gene function in a developing organism is central to different kinds of experiments. While tremendously powerful genetic tools have been developed in traditional model systems, it is difficult to manipulate genes or messenger RNA (mRNA) in most other organisms. At the same time, evolutionary and comparative approaches rely on an exploration of gene function in many different species, necessitating the development and adaptation of techniques for manipulating expression outside currently genetically tractable species. This protocol describes a method for injecting reagents into cricket eggs to assay the effects of a given manipulation on embryonic or larval development. Instructions for how to collect and inject eggs with beveled needles are described. This relatively straightforward technique is flexible and potentially adaptable to other insects. One can gather and inject dozens of eggs in a single experiment, and survival rates for buffer-only injections improve with practice and can be as high as 80%. This technique will support several types of experimental approaches including injection of pharmacological agents, in vitro capped mRNA to express genes of interest, double-stranded RNA (dsRNA) to achieve RNA interference, use of clustered regularly interspaced short palindromic repeats (CRISPR) in concert with CRISPR-associated protein 9 (Cas9) reagents for genomic modification, and transposable elements to generate transient or stable transgenic lines.

Injecting Gryllus bimaculatus Eggs

Here we present a protocol to inject cricket eggs, a technique which serves as a foundational method in many experiments in the cricket, including, but not limited to, RNA interference and genomic manipulation.

Altering gene function in a developing organism is central to different kinds of experiments. While tremendously powerful genetic tools have been ...

Developmental Biology

Egg Microinjection and Efficient Mating for Genome Editing in the Firebrat Thermobia domestica

The firebrat Thermobia domestica is an ametabolous, wingless species that is suitable for studying the developmental mechanisms of insects that led to their successful evolutionary radiation on the earth. The application of genetic tools such as genome editing is the key to understanding genetic changes that are responsible for evolutionary transitions in an Evo-Devo approach. In this article, we describe our current protocol for generating and maintaining mutant strains of T. domestica. We report a dry injection method, as an alternative to the reported wet injection method, that allows us to obtain stably high survival rates in injected embryos. We also report an optimized environment setting to mate adults and obtain subsequent generations with high efficiency. Our method underlines the importance of taking each species&#8217; unique biology into account for the successful application of genome editing methods to non-traditional model organisms. We predict that these genome editing protocols will help in implementing T. domestica as a laboratory model and to further accelerate the development and application of useful genetic tools in this species.

Egg Microinjection and Efficient Mating for Genome Editing in the Firebrat Thermobia domestica

We provide a detailed protocol for rearing, microinjection of eggs and for efficient mating of the firebrat Thermobia domestica to generate and maintain mutant strains after genome editing.

The firebrat Thermobia domestica is an ametabolous, wingless species that is suitable for studying the developmental mechanisms of insects that led to ...

Artificial Host Parasitization by Trichogramma dendrolimi and Venom Extraction

Extracting Venom from the Parasitoid Wasp Trichogramma dendrolimi Using an Artificial Host

Parasitoid wasps are a diverse group of hymenopteran insects that serve as invaluable resources for pest biocontrol. To ensure successful parasitism, parasitoid wasps inject venom into their hosts to suppress their hosts&#39; immunity, modulate hosts&#39; development, metabolism, and even behavior. With over 600,000 estimated species, the diversity of parasitoid wasps surpasses that of other venomous animals, such as snakes, cone snails, and spiders. Parasitoid wasp venom is an underexplored source of bioactive molecules with potential applications in pest control and medicine. However, collecting parasitoid venom is challenging due to the inability to use direct or electrical stimulation and the difficulty in dissection because of their small size. Trichogramma is a genus of tiny (~0.5 mm) egg parasitoid wasps that are widely used for the biological control of lepidopteran pests in both agriculture and forests. Here, we report a method for extracting venom from T. dendrolimi using artificial hosts. These artificial hosts are created with polyethylene film and amino acid solutions and then inoculated with Trichogramma wasps for parasitism. The venom was subsequently collected and concentrated. This method enables the extraction of large amounts of Trichogramma venom while avoiding contamination from other tissues caused by dissection, a common issue in venom reservoir dissection protocols. This innovative approach facilitates the study of Trichogramma venom, paving the way for new research and potential applications.

Author Spotlight: Efficient Venom Extraction Method from Trichogramma Parasitoid Wasps 

Here, we present a protocol for extracting venom from Trichogramma dendrolimi using an artificial host created with polyethylene film and amino acid solution.

Parasitoid wasps are a diverse group of hymenopteran insects that serve as invaluable resources for pest biocontrol. To ensure successful parasitism, ...

Biochemistry

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence (T7, T3, SP6) and the gene to be transcribed (Figure 1A). A typical transcription reaction consists of the template DNA, RNA polymerase, ribonucleotide triphosphates, RNase inhibitor and buffer containing Mg2+ ions.
Large amounts of high quality RNA are often required for a variety of applications. Use of in vitro transcription has been reported for RNA structure and function studies such as splicing1, RNAi experiments in mammalian cells2, antisense RNA amplification by the "Eberwine method"3, microarray analysis4 and for RNA vaccine studies5. The technique can also be used for producing radiolabeled and dye labeled probes6. Warren, et al. recently reported reprogramming of human cells by transfection with in vitro transcribed capped RNA7. The T7 High Yield RNA Synthesis Kit from New England Biolabs has been designed to synthesize up to 180 &mu;g RNA per 20 &mu;l reaction. RNA of length up to 10kb has been successfully transcribed using this kit. Linearized plasmid DNA, PCR products and synthetic DNA oligonucleotides can be used as templates for transcription as long as they have the T7 promoter sequence upstream of the gene to be transcribed.
Addition of a 5' end cap structure to the RNA is an important process in eukaryotes. It is essential for RNA stability8, efficient translation9, nuclear transport10 and splicing11. The process involves addition of a 7-methylguanosine cap at the 5' triphosphate end of the RNA. RNA capping can be carried out post-transcriptionally using capping enzymes or co-transcriptionally using cap analogs. In the enzymatic method, the mRNA is capped using the Vaccinia virus capping enzyme12,13. The enzyme adds on a 7-methylguanosine cap at the 5' end of the RNA using GTP and S-adenosyl methionine as donors (cap 0 structure). Both methods yield functionally active capped RNA suitable for transfection or other applications14 such as generating viral genomic RNA for reverse-genetic systems15 and crystallographic studies of cap binding proteins such as eIF4E16.
In the method described below, the T7 High Yield RNA Synthesis Kit from NEB is used to synthesize capped and uncapped RNA transcripts of Gaussia luciferase (GLuc) and Cypridina luciferase (CLuc). A portion of the uncapped GLuc RNA is capped using the Vaccinia Capping System (NEB). A linearized plasmid containing the GLuc or CLuc gene and T7 promoter is used as the template DNA. The transcribed RNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity. Capped CLuc RNA is used as the internal control to normalize GLuc expression.

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

This method describes high yield in vitro synthesis of both capped and uncapped mRNA from a linearized plasmid containing the Gaussia luciferase (GLuc) gene. The RNA is purified and a fraction of the uncapped RNA is enzymatically capped using the Vaccinia virus capping enzyme. In the final step, the mRNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity.

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Chromatin Isolation by RNA Purification (ChIRP)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental gene expression 1,2,3,4,5,6,7. The recent discovery of thousands of lncRNAs in association with specific chromatin modification complexes, such as Polycomb Repressive Complex 2 (PRC2) that mediates histone H3 lysine 27 trimethylation (H3K27me3), suggests broad roles for numerous lncRNAs in managing chromatin states in a gene-specific fashion 8,9. While some lncRNAs are thought to work in cis on neighboring genes, other lncRNAs work in trans to regulate distantly located genes. For instance, Drosophila lncRNAs roX1 and roX2 bind numerous regions on the X chromosome of male cells, and are critical for dosage compensation 10,11. However, the exact locations of their binding sites are not known at high resolution. Similarly, human lncRNA HOTAIR can affect PRC2 occupancy on hundreds of genes genome-wide 3,12,13, but how specificity is achieved is unclear. LncRNAs can also serve as modular scaffolds to recruit the assembly of multiple protein complexes. The classic trans-acting RNA scaffold is the TERC RNA that serves as the template and scaffold for the telomerase complex 14; HOTAIR can also serve as a scaffold for PRC2 and a H3K4 demethylase complex 13.
Prior studies mapping RNA occupancy at chromatin have revealed substantial insights 15,16, but only at a single gene locus at a time. The occupancy sites of most lncRNAs are not known, and the roles of lncRNAs in chromatin regulation have been mostly inferred from the indirect effects of lncRNA perturbation. Just as chromatin immunoprecipitation followed by microarray or deep sequencing (ChIP-chip or ChIP-seq, respectively) has greatly improved our understanding of protein-DNA interactions on a genomic scale, here we illustrate a recently published strategy to map long RNA occupancy genome-wide at high resolution 17. This method, Chromatin Isolation by RNA Purification (ChIRP) (Figure 1), is based on affinity capture of target lncRNA:chromatin complex by tiling antisense-oligos, which then generates a map of genomic binding sites at a resolution of several hundred bases with high sensitivity and low background. ChIRP is applicable to many lncRNAs because the design of affinity-probes is straightforward given the RNA sequence and requires no knowledge of the RNA's structure or functional domains.

Chromatin Isolation by RNA Purification ChIRP

ChIRP is a novel and rapid technique to map genomic binding sites of long noncoding RNAs (lncRNAs). The method takes advantage of the specificity of anti-sense tiling oligonucleotides to allow the enumeration of lncRNA-bound genomic sites.

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle&#8217;s body cavity.
In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting.

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

RNA interference (RNAi)-based gene knockdown techniques are at the core of Tribolium research. Here, we provide an overview of our larval RNAi technique in Tribolium castaneum. Larval RNAi is a simple, but powerful technique that provides quick access to loss-of-function phenotypes, allowing researchers to study gene functions in diverse contexts.

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully ...

Nanoparticle-Mediated dsRNA Feeding for Gene Silencing in Silkworm Larvae

Larval RNA Interference in Silkworm Bombyx mori through Chitosan/dsRNA Nanoparticle Delivery

The silkworm, Bombyx mori, is an important economic insect with thousands of years of history in China. Meanwhile, the silkworm is the model insect of Lepidoptera with a good accumulation of basic research. It is also the first insect in Lepidoptera with its complete genome sequenced and assembled, which provides a solid foundation for gene functional study. Although RNA interference (RNAi) is widely used in reverse gene functional study, it is refractory in silkworms and other Lepidopteran species. Previous successful RNAi-related research to deliver double-stranded RNA (dsRNA) was performed through injection only. Delivery of dsRNA through feeding is never reported. In this article, we describe step-by-step procedures to prepare the chitosan/dsRNA nanoparticles, which are fed to the silkworm larvae by ingestion. The protocol includes (i) selection of the proper stage of silkworm larvae, (ii) synthesis of dsRNA, (iii) preparation of the chitosan/dsRNA nanoparticles, and (iv) feeding the silkworm larvae with chitosan/dsRNA nanoparticles. Representative results, including gene transcript confirmation and phenotype observation, are presented. dsRNA feeding is a simple technique for RNAi in silkworm larvae. Since silkworm larvae are easy to rear and large enough to operate, it provides a good model to demonstrate larval RNAi in insects. In addition, the simplicity of this technique stimulates more student involvement in research, making silkworm larvae an ideal genetic system for use in a classroom setting.

Author Spotlight: Advancing Gene Silencing Research in Silkworms with dsRNA Delivery Through Feeding Chitosan Nanoparticles

Presented here is a protocol for chitosan/dsRNA nanoparticle delivery in silkworm Bombyx mori larvae to induce gene silencing through ingestion.

The silkworm, Bombyx mori, is an important economic insect with thousands of years of history in China. Meanwhile, the silkworm is the model insect of ...

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

Summary

Explore More Videos

Determining the Egg Fertilization Rate of Bemisia tabaci Using a Cytogenetic Technique

In Vitro Nuclear Assembly Using Fractionated Xenopus Egg Extracts

Mass-Rearing and Molecular Studies in Tortricidae Pest Insects

Injecting Gryllus bimaculatus Eggs

Egg Microinjection and Efficient Mating for Genome Editing in the Firebrat Thermobia domestica

Extracting Venom from the Parasitoid Wasp Trichogramma dendrolimi Using an Artificial Host

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

Chromatin Isolation by RNA Purification (ChIRP)

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

Larval RNA Interference in Silkworm Bombyx mori through Chitosan/dsRNA Nanoparticle Delivery