تم تمويل هذا البحث من قبل مشاريع المؤسسة الوطنية للعلوم الطبيعية في الصين (32172476 ، 32102275) ، وبرنامج ابتكار العلوم والتكنولوجيا الزراعية (CAAS-ZDRW202203 ، CAAS-ZDRW202108) ، والصناديق المركزية التي توجه تطوير العلوم والتكنولوجيا المحلية (XZ202301YD0042C).

ملاحظة: راجع جدول المواد للحصول على التفاصيل المتعلقة بجميع المواد والأدوات والبرامج والكواشف المستخدمة في هذا البروتوكول.
1. جمع وصيانة زراعة الحشرات
<ol><li>قم بلصق مجموعة من ~ 5000 بيضة من Corcyra cephalonica (Stainton) على بطاقة 9 سم × 16 سم باستخدام محلول 1: 5 (v / v) من مسحوق الصمغ العربي والماء25,26. ملاحظة: تجنب إرفاق الكثير من بيض المضيف بالبطاقة لأن الاكتظاظ يجعلها غير عملية لإجراءات النقل والتشريح اللاحقة.</li>
	<li>لمنع فقس بيض المضيف ، قم بإخضاع بطاقات البيض المضيفة لمدة 30 دقيقة من الأشعة فوق البنفسجية (الشكل 1-i). بعد ذلك ، قم بتقطيع الورق بالبيض المعطل إلى بطاقات بيض يبلغ سمكها 1 سم وقطرها 8 سم ، تحتوي كل منها على حوالي 300-500 بيضة (الشكل 1-ii)25،26،27.</li>
	<li>أدخل مجموعة من الدبابير 80-120 T. denrolimi في أنبوب زجاجي يبلغ قطره 2 سم وطوله 8 سم. ختم الأنبوب بالقطن. ملاحظة: الحفاظ على الدبابير عند درجة حرارة 25 ± 1 درجة مئوية ، مع دورة الضوء / الظلام من 16 ساعة من الضوء و 8 ساعات من الظلام والحفاظ على رطوبة نسبية تبلغ حوالي 75٪.</li>
	<li>قدم بطاقة بيضة مضيفة إلى الدبابير للتطفل (الشكل 1-ii). اسمح للدبابير بإيداع بيضها في البيض المضيف لمدة 6 ساعات ، وبعد ذلك قم بإزالة الدبابير على الفور. ملاحظة: تجنب إطالة فترة التطفل بشكل مفرط لأن هذا يمكن أن يؤدي إلى اكتظاظ نسل T. denrolimi داخل البويضة المضيفة ، مما يؤدي إلى زيادة معدل وفيات دبابير النسل28,29.</li>
</ol>2. تخليق dsRNA
<ol><li>تصميم مجموعات التمهيدي التي تحتوي على مروج T7 لتوليف الحمض النووي الريبي المزدوج الذي تقطعت به السبل (dsRNA). اختر شريحة 300-400 bp من الجين المستهدف (Ferhch) لتخليق dsRNA.</li>
	<li>الحصول على مجموعات أولية مركبة تجاريا لإنتاج dsRNA للجين المستهدف و dsGFP لاستخدامها كعنصر تحكم سلبي.</li>
	<li>استخرج محتوى الحمض النووي الريبي من 100 دبابير T. denrolimi باستخدام المجموعة المشار إليها باتباع بروتوكولالشركة المصنعة 9. تحقق من جودة محتوى الحمض النووي الريبي ؛ تابع إذا كانت قيمة OD260 / OD280 تتراوح من 1.8 إلى 2.09.</li>
	<li>قم بتنقية محتوى الحمض النووي الريبي باستخدام 2 ميكرولتر من المخزن المؤقت 5x (1 وحدة / 50 ميكرولتر) ، و 1 ميكرولتر من DNAse (1 وحدة / 50 ميكرولتر) ، و 6.5 ميكرولتر من الحمض النووي الريبي (~ 100 نانوغرام / ميكرولتر) ، 0.5 ميكرولتر من H2O عند 42 درجة مئوية لمدة دقيقتين.</li>
	<li>إجراء تفاعل البوليميراز المتسلسل للنسخ العكسي (RT-PCR) لإنشاء قالب cDNA مع 10 ميكرولتر من الحمض النووي الريبي المنقى (~ 100 نانوغرام / ميكرولتر) ، 4 ميكرولتر من 5x buffer (1 U / 50 μL) ، 1 ميكرولتر من مزيج الإنزيم I (1 U / 50 μL) ، و 4 ميكرولتر من H2O. قم بإجراء RT-PCR باستخدام الإعدادات التالية: 37 درجة مئوية لمدة 15 دقيقة ، 85 درجة مئوية لمدة 5 ثوان. قم بتخزين منتج cDNA في درجة حرارة -4 درجة مئوية حتى الاستخدام.</li>
	<li>إجراء تفاعل البوليميراز المتسلسل (PCR) لتضخيم تسلسلات dsRNA وفقا للمزيج الرئيسي المشار إليه (10 ميكرولتر من Taq II [1 U / 50 μL] ، 0.8 ميكرولتر من التمهيدي الأمامي [0.4 μM] ، 0.8 ميكرولتر من التمهيدي العكسي [0.4 ميكرومتر] ، 0.8 ميكرولتر من قالب الحمض النووي [40 نانوغرام / ميكرولتر] ، و 7.6 ميكرولتر من H2O). إجراء PCR باستخدام الإعدادات التالية: 94 درجة مئوية لمدة 2 دقيقة ؛ 35 دورة مع 94 درجة مئوية لمدة 30 ثانية ، 60 درجة مئوية لمدة 30 ثانية ، 72 درجة مئوية لمدة 30 ؛ 72 درجة مئوية لمدة 2 دقيقة.</li>
	<li>تقييم جودة منتجات تفاعل البوليميراز المتسلسل عن طريق الكهربائي على هلام الأغاروز 2.0٪ 5,9 وتأكيد التسلسل المستهدف من خلال تسلسل سانجر.</li>
	<li>قم بتنقية منتج PCR باستخدام مجموعة استخراج الجل وفقا لإرشادات الشركة المصنعة 9,23.</li>
	<li>استخدم نظام RNAi لتجميع dsRNA للجين المستهدف مع 10 ميكرولتر من 2x buffer (0.02 وحدة / ميكرولتر) ، و 8 ميكرولتر من قالب الحمض النووي (75 نانوغرام / ميكرولتر) ، و 2 ميكرولتر من مزيج الإنزيم (1 وحدة / 50 ميكرولتر) مع الإعدادات التالية: 37 درجة مئوية لمدة 30 دقيقة ، 70 درجة مئوية لمدة 10 دقائق ، و 25 درجة مئوية لمدة 20 دقيقة. تخلص من dsRNA المركب ب 30 ميكرولتر من الماء الخالي من النيوكلياز.</li>
	<li>قم بتقييم جودة منتج dsRNA من خلال تصوره على هلام أغاروز 1.0٪ 5,9. تمييع dsRNA إلى 7000 نانوغرام / ميكرولتر. تحقق من جودة منتج dsRNA ؛ تابع إذا كانت قيمة OD260 / OD280 تتراوح من 1.8 إلى 2.09. قم بتخزين منتج dsRNA في -20 درجة مئوية حتى الاستخدام.</li>
</ol>3. زرع الشرانق T. denrolimi 
<ol><li>قم بزراعة بيض المضيف المتطفل لمدة 8 أيام تقريبا عند 25 ± 1 درجة مئوية ، مع الحفاظ على دورة مظلمة لمدة 16 ساعة / 8 ساعات ورطوبة نسبية ~ 75٪. سوف يتحول لون البيض المضيف المتطفل إلى اللون الأسود بعد 5 أيام30 (الشكل 1-iv ، v).</li>
	<li>نقل بطاقة البيض المضيف إلى المجهر تشريح. استخدم زوجا من إبر التنغستن (الشكل 1-السادس) لإزالة المشيم بدقة من البيض المضيف (الشكل 1-السابع) واستعادة الخادرة من الداخل (الشكل 1-الثامن)5،17،18. ملاحظة: يجب أن يكون طرف إبرة التشريح أقل من 0.05 مم.</li>
	<li>إعداد لوحة نظيفة للركيزة. اسكب 10-15 مل من محلول أجار 15 جم / لتر ، مما يسمح له بالتبريد بشكل طبيعي (الشكل 2-ط). ملاحظة: امزج محلول أجار مع 0.5 جم من الستربتومايسين لمنع نمو الملوثات في المختبر.</li>
	<li>استخدم جرافا مطهرا لحفر عدة أخاديد بعمق 0.2-0.3 مم وعرض 0.4-0.8 مم (الشكل 2-ii).</li>
	<li>استخدم فرشاة صغيرة (الشكل 2-iii) لزرع خادرة من البويضة المضيفة المشرحة في أحد الأخاديد الموجودة على ركيزة الآجار (الشكل 2-iv).</li>
	<li>كرر الخطوتين 3.4 و 3.5 ، وزرع 100-300 خادرة بشكل فردي في الأخاديد واحدة تلو الأخرى (الشكل 2-v).</li>
</ol>4. حقن دقيق ل dsRNA في T. denrolimi pupa
<ol><li>استخدم مجتذب إبرة زجاجية لسحب الشعيرات الدموية الزجاجية (الشكل 3-i ، ii). اضبط الحرارة على 280 ، والسرعة على 170 ، والتأخير على 250 ، والسحب على 30 على مجتذب الإبرة (الشكل 3-iii). تحضير إبر زجاجية شعرية متعددة للحقن المجهري (الشكل 3-iv ، v).</li>
	<li>شطبة طرف الإبرة الزجاجية باستخدام لوحة كاشطة (الشكل 3-السادس). ملاحظة: تأكد من أن طرف إبرة الحقن لا يزال حادا ؛ خلاف ذلك ، قد يؤدي إلى وفيات العذراء أو إعاقة تدفق الكاشف عبر الإبرة (الشكل 3-السابع).</li>
	<li>قم بتحميل ما يقرب من 2 ميكرولتر من محلول حقن dsRNA مع 7000 نانوغرام / ميكرولتر في إبرة الحقن المعدة باستخدام مضخة حقن دقيقة (الشكل 3-السابع).</li>
	<li>انقل ركيزة الآجار التي تحتوي على مئات الشرانق إلى منصة المجهر المركب (الشكل 3-الثامن).</li>
	<li>أدخل إبرة الحقن بعناية في بطن خادرة T. denrolimi بزاوية ~ 30 درجة إلى البطن تحت العدسة (الشكل 3-التاسع).</li>
	<li>حقن تدريجيا ~ 5 nL من محلول الحقن (الخطوة 4.3) في خادرة T. denrolimi بلطف قدر الإمكان. ملاحظة: قد تنتفخ خادرة T. denrolimi قليلا عند حقن محلول dsRNA. قد يؤدي حقن كمية زائدة من المحلول في الخادرة أو استخدام الإبر ذات الفتحات الكبيرة جدا إلى موت العذراء المبكر. قم بتغيير الإبر عندما تصبح مسدودة بعد حقن عدة إلى عشرات الشرانق.</li>
	<li>كرر الخطوتين 4.5 و 4.6 ، حقن dsRNA في 600 خادرة واحدة تلو الأخرى. ملاحظة: لتحليل RT-qPCR الموثوق به ، يجب عزل محتوى الحمض النووي الريبي من 100 خادرة على الأقل. حقن ما لا يقل عن 600 خادرة لثلاث تكرارات في علاج dsRNA وثلاثة مكررات في التحكم السلبي dsGFP 9.</li>
</ol>5. حضانة الشرانق T. denrolimi 
<ol><li>نقل الركيزة التي تحتوي على الشرانق المحقونة إلى حاضنة عند 25 ± 1 درجة مئوية مع دورة ضوء / ظلام 16 ساعة / 8 ساعات و ~ 75٪ رطوبة نسبية.</li>
	<li>احتضان ما يقرب من 700 T. denrolimi الشرانق لكل علاج لمدة 24 ساعة أو 48 ساعة. استخراج محتوى الحمض النووي الريبي من مجموعة من 100 خادرة لكل نسخة مكررة9. ملاحظة: إزالة الشرانق المنكمشة (الشرانق الميتة) من العينات; خلاف ذلك ، قد يؤدي إلى أخطاء في الكشف عن التعبير الجيني.</li>
	<li>احتضان ~ 50 T. denrolimi الشرانق لكل علاج حتى تظهر الدبابير (الشكل 3-x). سجل معدل الظهور ومعدل التشوه.</li>
</ol>6. الكشف عن التعبير الجيني المستهدف
<ol><li>صمم مجموعة التمهيدي للجين المستهدف والجينات المرجعية ل RT-qPCR باستخدام أداة تصميم. ملاحظة: تأكد من عدم تداخل تسلسلات بادئات RT-qPCR مع المنطقة المستهدفة من dsRNA.</li>
	<li>استخدام صندوق شوكة الجين O (FoxO) كجين مرجعي في تحليل RT-qPCR ؛ تم الإبلاغ عن الاشعال من FoxO سابقا9.</li>
	<li>الحصول على مجموعات التمهيدي توليفها تجاريا. قم بإجراء RT-qPCR مع 10 ميكرولتر من Taq II (1 U / 50 μL) ، 0.8 ميكرولتر من التمهيدي الأمامي (0.4 μM) ، 0.8 ميكرولتر من التمهيدي العكسي (0.4 ميكرومتر) ، 0.8 ميكرولتر من القالب (10 نانوغرام / ميكرولتر) ، و 7.6 ميكرولتر من H2O. قم بإجراء RT-qPCR باستخدام الإعدادات التالية: 95 درجة مئوية لمدة 30 ثانية ؛ 35 دورة مع 95 درجة مئوية لمدة 5 ثوان ، 57 درجة مئوية لمدة 30 ثانية ، 72 درجة مئوية لمدة 30 ؛ 95 درجة مئوية لمدة 10 ثوان ؛ 60 درجة مئوية لمدة 5 ثوان ، و 95 درجة مئوية لمدة 5 ثوان.</li>
	<li>احسب قيمة التعبير للجين المستهدف باستخدام طريقة 2-ΔΔCt 9,25.</li>
	<li>استخدم اختبار Kruskal-Wallis لتحليل التعبير عن الجين المستهدف تحت تأثير العلاجات المختلفة (dsFerhch ، dsGFP ، عدم الحقن). ملاحظة: تجنب استخدام الاختبارات البارامترية (على سبيل المثال ، اختبار t) للمقارنات اللاحقة لأن عدم تجانس البيانات وعدم طبيعتها قد يؤدي إلى استنتاجات خاطئة25.</li>
</ol>

تطوير تقنيات الحمض النووي الريبي في Trichogramma dendrolimi لتحليل وظيفة الجينات

<ol>
	<li>Zang, L. S., Wang, S., Zhang, F., Desneux, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+control+with+Trichogramma+in+China:+History,+present+status+and+perspectives.">Biological control with Trichogramma in China: History, present status and perspectives.</a> Annu Rev Entomol. 66, 463-484 (2020).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimal+clutch+size+for+quality+control+of+bisexual+and+Wolbachia-infected+thelytokous+lines+of+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+mass+reared+on+eggs+of+a+substitutive+host,+Antheraea+pernyi+Gu&#233;rin-M&#233;neville+(Lepidoptera:+Saturniidae).">Optimal clutch size for quality control of bisexual and Wolbachia-infected thelytokous lines of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) mass reared on eggs of a substitutive host, Antheraea pernyi Gu&#233;rin-M&#233;neville (Lepidoptera: Saturniidae).</a> Pest Manag Sci. 76 (8), 2635-2644 (2020).</li><li>Li, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+status+of+the+biological+control+of+the+fall+armyworm+Spodoptera+frugiperda+by+egg+parasitoids.">Current status of the biological control of the fall armyworm Spodoptera frugiperda by egg parasitoids.</a> J Pest Sci. 96, 1345-1363 (2023).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+temperature+and+superparasitism+on+quality+and+characteristics+of+thelytokous+Wolbachia-infected+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+during+mass+rearing.">Effects of temperature and superparasitism on quality and characteristics of thelytokous Wolbachia-infected Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) during mass rearing.</a> Sci Rep. 9 (1), 18114 (2019).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Penetrance+during+Wolbachia-mediated+parthenogenesis+of+Trichogramma+wasps+is+reduced+by+continuous+oviposition,+associated+with+exhaustion+of+Wolbachia+titers+in+ovary+and+offspring+eggs.">Penetrance during Wolbachia-mediated parthenogenesis of Trichogramma wasps is reduced by continuous oviposition, associated with exhaustion of Wolbachia titers in ovary and offspring eggs.</a> Pest Manag Sci. 78 (7), 3080-3089 (2022).</li><li>Huang, N. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+and+large-scale+releases+of+Trichogramma+promote+pesticide+decrease+in+maize+in+northeastern+China.">Long-term and large-scale releases of Trichogramma promote pesticide decrease in maize in northeastern China.</a> Entomol Gen. 40 (4), 331-335 (2020).</li><li>Wang, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+Trichogramma+japonicum+as+a+vector+of+Beauveria+bassiana+for+parasitizing+eggs+of+rice+striped+stem+borer,+Chilo+suppressalis.">Performance of Trichogramma japonicum as a vector of Beauveria bassiana for parasitizing eggs of rice striped stem borer, Chilo suppressalis.</a> Entomol Gen. 41 (2), 147-155 (2021).</li><li>Ning, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+identification+and+expression+pattern+of+the+sex+determination+genes+and+their+sex-specific+variants+in+the+egg+parasitoid+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae).">The identification and expression pattern of the sex determination genes and their sex-specific variants in the egg parasitoid Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae).</a> Front Physiol. 14, 1243753 (2023).</li><li>Huo, L. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+and+evaluation+of+RT-qPCR+reference+genes+for+expression+analysis+in+the+tiny+egg+parasitoid+wasp,+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae).">Selection and evaluation of RT-qPCR reference genes for expression analysis in the tiny egg parasitoid wasp, Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae).</a> J Asia Pac Entomol. 25 (2), 101883 (2022).</li><li>Leung, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+biological+control:+the+need+for+integrating+genetics+and+genomics.">Next-generation biological control: the need for integrating genetics and genomics.</a> Biol Rev Camb Philos Soc. 95 (6), 1838-1854 (2020).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Leonard, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+symbionts+activate+honey+bee+immunity+and+limit+pathogens.">Engineered symbionts activate honey bee immunity and limit pathogens.</a> Science. 367 (6477), 573-576 (2020).</li><li>Sun, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+an+essential+gene+involved+in+infestation+and+digestion+in+grain+aphid+through+plant-mediated+RNA+interference+generates+aphid-resistant+wheat+plants.">Silencing an essential gene involved in infestation and digestion in grain aphid through plant-mediated RNA interference generates aphid-resistant wheat plants.</a> Plant Biotechnol J. 17 (5), 852-854 (2019).</li><li>Li, M., Bui, M., Akbari, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryo+Microinjection+and+Transplantation+Technique+for+Nasonia+vitripennis+Genome+Manipulation.">Embryo Microinjection and Transplantation Technique for Nasonia vitripennis Genome Manipulation.</a> J Vis Exp. 130, e56990 (2017).</li><li>Dalla Benetta, E., Chaverra-Rodriguez, D., Rasgon, J. L., Akbari, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pupal+and+Adult+Injections+for+RNAi+and+CRISPR+Gene+Editing+in+Nasonia+vitripennis.">Pupal and Adult Injections for RNAi and CRISPR Gene Editing in Nasonia vitripennis.</a> J Vis Exp. 166, e61892 (2020).</li><li>Lynch, J. A., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+parental+RNA+interference+in+the+wasp+Nasonia+vitripennis.">A method for parental RNA interference in the wasp Nasonia vitripennis.</a> Nat Protoc. 1 (1), 486-494 (2006).</li><li>Zhu, K. Y., Palli, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms,+Applications,+and+Challenges+of+Insect+RNA+Interference.">Mechanisms, Applications, and Challenges of Insect RNA Interference.</a> Annu Rev Entomol. 65, 293-311 (2020).</li><li>Colinet, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+RNAi+in+a+Drosophila+endoparasitoid+wasp+and+demonstration+of+its+efficiency+in+impairing+venom+protein+production.">Development of RNAi in a Drosophila endoparasitoid wasp and demonstration of its efficiency in impairing venom protein production.</a> J Insect Physiol. 63, 56-61 (2014).</li><li>Wang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+digestive+tract+expressing+&#945;-amylase+influences+the+adult+lifespan+of+Pteromalus+puparum+revealed+through+RNAi+and+rescue+analyses.">A digestive tract expressing &#945;-amylase influences the adult lifespan of Pteromalus puparum revealed through RNAi and rescue analyses.</a> Pest Manag Sci. 75 (12), 3346-3355 (2019).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia-infected+Trichogramma+dendrolimi+is+outcompeted+by+its+uninfected+counterpart+in+superparasitism+but+does+not+have+developmental+delay.">Wolbachia-infected Trichogramma dendrolimi is outcompeted by its uninfected counterpart in superparasitism but does not have developmental delay.</a> Pest Manag Sci. 79 (3), 1005-1017 (2023).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posterior+concentration+of+Wolbachia+during+the+early+embryogenesis+of+the+host+dynamically+shapes+the+tissue+tropism+of+Wolbachia+in+host+Trichogramma+wasps.">Posterior concentration of Wolbachia during the early embryogenesis of the host dynamically shapes the tissue tropism of Wolbachia in host Trichogramma wasps.</a> Front Cell Infect Microbiol. 13, 1198428 (2023).</li><li>Lee, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+development+of+Trichogramma+evanescens+Westw.+and+its+influence+on+the+embryonic+development+of+its+host,+Attacus+cynthia+ricini+Boisd.">The development of Trichogramma evanescens Westw. and its influence on the embryonic development of its host, Attacus cynthia ricini Boisd.</a> Acta Entomol Sin Z. 11 (1), 89-119 (1961).</li><li>Shen, Y., Chen, Y. Z., Zhang, C. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+silencing+of+genes+in+the+brown+planthopper+Nilaparvata+lugens+affects+survival,+growth+and+female+fecundity.">RNAi-mediated silencing of genes in the brown planthopper Nilaparvata lugens affects survival, growth and female fecundity.</a> Pest Manag Sci. 77 (1), 365-377 (2021).</li><li>Wu, S., Yin, S., Zhou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+physiology+of+iron+trafficking+in+Drosophila+melanogaster.">Molecular physiology of iron trafficking in Drosophila melanogaster.</a> Curr Res Insect Sci. 50, 100888 (2022).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia-Driven+Memory+Loss+in+a+Parasitic+Wasp+Increases+Superparasitism+to+Enhance+Horizontal+Transmission.">Wolbachia-Driven Memory Loss in a Parasitic Wasp Increases Superparasitism to Enhance Horizontal Transmission.</a> mBio. 13 (6), e0236222 (2022).</li><li>Ning, S. F., Zhou, J. C., Liu, Q. Q., Zhao, Q., Dong, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gradual,+temperature-induced+change+of+secondary+sexual+characteristics+in+Trichogramma+pretiosum+infected+with+parthenogenesis-inducing+Wolbachia.">Gradual, temperature-induced change of secondary sexual characteristics in Trichogramma pretiosum infected with parthenogenesis-inducing Wolbachia.</a> PeerJ. 7, e7567 (2019).</li><li>Zhang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decreased+Wolbachia+titers+cause+gradual+change+in+masculinization+of+intersex+individuals+of+thelytokous+Trichogramma+dendrolimi.">Decreased Wolbachia titers cause gradual change in masculinization of intersex individuals of thelytokous Trichogramma dendrolimi.</a> Entomol Gen. 42 (5), 751-759 (2022).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-parasitism:+A+promising+approach+to+simultaneously+produce+Trichogramma+chilonis+and+T.+dendrolimi+on+eggs+of+Antheraea+pernyi.">Multi-parasitism: A promising approach to simultaneously produce Trichogramma chilonis and T. dendrolimi on eggs of Antheraea pernyi.</a> Entomol Gen. 41 (6), 627-636 (2021).</li><li>Zhou, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Thelytokous+parthenogenesis-inducing+Wolbachia+on+the+fitness+of+Trichogramma+dendrolimi+Matsumura+(Hymenoptera:+Trichogrammatidae)+in+superparasitised+and+single-parasitised+hosts.">Effects of Thelytokous parthenogenesis-inducing Wolbachia on the fitness of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) in superparasitised and single-parasitised hosts.</a> Front Ecol Evol. 9, 730664 (2021).</li><li>Flanders, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notes+on+the+life+history+and+anatomy+of+Trichogramma.">Notes on the life history and anatomy of Trichogramma.</a> Ann Entomol Soc Am. 30 (2), 304-308 (1937).</li></ol>

يعلن أصحاب البلاغ أنه ليس لديهم تضارب في المصالح.

ومن المسلم به أن الدبابير Trichogramma هي عوامل مكافحة بيولوجية فعالة، وتستهدف على وجه التحديد مجموعة من الآفات حرشفية الأجنحة في الزراعة والحراجة1. تخضع هذه الدبابير الصغيرة لمراحلها غير الناضجة داخل البويضة المضيفة ، وهي خاصية تمثل تحديات في إجراء تجارب RNAi 5,...

Trichogramma spp. هي مجموعة من طفيليات البيض التي تم استخدامها على نطاق واسع كعوامل مكافحة بيولوجية عالية الكفاءة ضد مجموعة واسعة من الآفات حرشفية الأجنحة في النظم الإيكولوجية الزراعية والغابات في جميع أنحاء العالم1،2،3،4. يوفر تطبيق Trichogramma الذي يتم تربيته على نطاق واسع نهجا صديقا للبيئة للإدارة المستدامة للآفات5،6،7. يوفر فهم البيولوجيا الجزيئية لدبابير Trichogramma رؤى قيمة لتعزيز كفاءة التربية الجماعية والأداء الميداني لعوامل المكافحة البيولوجية هذه 8,9 من خلال التحقيق في منهجية تنظيم الجينات وتحرير الجينوم10.
منذ اكتشاف التداخل الجيني المحدد المزدوج الشريط (dsRNA) بوساطة Caenorhabditis elegans في عام 1998 ، تطورت طريقة تداخل الحمض النووي الريبي (RNAi) إلى مجموعة أدوات وراثية حيوية لاستكشاف الآليات التنظيمية للكائنات الحية عن طريق قمع التعبير عن الجينات المستهدفة11. أصبحت تجارب RNAi منهجية قياسية مطبقة على نطاق واسع لدراسة وظيفة الجينات في العديد من أنواع الحشرات12,13. ومع ذلك ، فإن التلاعب بالحمض النووي الريبي يمثل تحديا هائلا في العديد من الأنواع الطفيلية ، لا سيما بين تلك التي تنتمي إلى عائلة Chalcidoidea الطفيليةالداخلية 14،15،16. تم توثيق طريقة RNAi في ما لا يقل عن 13 نوعا طفيليا14،15،16،17،18،19. من بين هذه ، تم إجراء نهج RNAi بشكل شامل في دبابير Nasonia وهو قابل للتطبيق طوال مراحل النمو ، بما في ذلك الأجنة واليرقات والشرانق والبالغين14،15،16. من الجدير بالذكر أن دبابير Nasonia هي طفيليات خارجية ، حيث يتطور نسلها في الفضاء الخلالي بين الخادرة المضيفة و puparium ، مما يتيح زراعتها في المختبر ويجعلها تتحمل علاجات معينة ، مثل الحقن الدقيق. على عكس دبابير ناسونيا ، يخضع أفراد Trichogramma لتطورهم الجنيني واليرقات والعذراء بالكامل داخل البويضة المضيفة. تمثل الطبقة في مراحل الجنين واليرقات (التي قد تعيق نفاذية dsRNA) ، والتعرض للتلف ، وصعوبة البقاء على قيد الحياة في المختبر عقبات هائلة20،21،22. بالإضافة إلى ذلك ، فإن الحجم الصغير لأفراد Trichogramma ، حوالي ~ 0.5 مم في طول البالغين أو العذراء ، يجعلهم معقدين للغاية للتلاعبب 20،21،22.
في هذه الدراسة ، نحدد إجراء شاملا لإجراء تجارب تداخل الحمض النووي الريبي (RNAi) في Trichogramma denrolimi Matsumura. يشمل هذا الإجراء الإجراءات التالية: (1) تصميم وتوليف الحمض النووي الريبي المزدوج الذي تقطعت به السبل (dsRNA) ، (2) الحقن المجهري لشرانق T. denrolimi ، (3) زرع هذه الشرانق وتحضينها في المختبر ، و (4) الكشف عن ضربة قاضية للجين المستهدف من خلال تحليل RT-qPCR. الجين المستهدف المختار لتجربة RNAi هو تماثل سلسلة الفيريتين الثقيلة (Ferhch). يحتوي FerHCH ، وهو بروتين ملزم للحديد ، على مركز فيروكسيديز يتمتع بقدرات مضادة للأكسدة ، مما يسهل أكسدة Fe2+ إلى Fe3+. يلعب دورا لا غنى عنه في نمو وتطور الكائنات الحية المختلفة من خلال الحفاظ على توازن الأكسدة والاختزال وتوازن الحديد. ويمكن أن يؤدي استنفاد سداسي كلور حلقي الهكسان إلى الإفراط في تراكم الحديد، مما يؤدي إلى تلف الأنسجة بشكل لا رجعة فيه، وغالبا ما يبلغ ذروته في تغيرات كبيرة في النمط الظاهري، بما في ذلك عيوب النمو والتشوهات والوفيات23 و24. تقدم هذه الدراسة دليلا خطوة بخطوة لإجراء RNAi في T. denrolimi ، والذي سيكون لا يقدر بثمن للتحقيق في وظائف الجينات في السياق الأوسع لدبابير Trichogramma.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2x ES Taq MasterMix (Dye)</td>
			<td>Cowin Biotech, China</td>
			<td>CW0690H</td>
			<td>To amplify the dsRNA sequences</td>
		</tr>
		<tr>
			<td>20x PBS Buffer, DEPC treated (7.2-7.6)</td>
			<td>Sangon Biotech, China</td>
			<td>B540627-0500</td>
			<td>To dilute dsRNA</td>
		</tr>
		<tr>
			<td>Agar strip</td>
			<td>Shishi Globe Agar Industries Co.,Ltd, China</td>
			<td>n/a</td>
			<td>To make culture medium</td>
		</tr>
		<tr>
			<td>Ampicillin sodium</td>
			<td>Sangon Biotech, China</td>
			<td>A610028</td>
			<td>To make culture medium</td>
		</tr>
		<tr>
			<td>Bioer Constant temperature metal bath&#160;</td>
			<td>BIOER, China</td>
			<td>MB-102</td>
			<td>To synthesis dsRNA</td>
		</tr>
		<tr>
			<td>Borosilicate glass capillary&#160;</td>
			<td>WPI, USA</td>
			<td>1B100-4</td>
			<td>To pull capillary glass needle</td>
		</tr>
		<tr>
			<td>Clean bench&#160;</td>
			<td>Airtech, China</td>
			<td>SW-CJ-1FD</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Double distilled water</td>
			<td>Sangon Biotech, China</td>
			<td>A500197-0500</td>
			<td>To dilute cDNA</td>
		</tr>
		<tr>
			<td>Environmental Testing chamber&#160;</td>
			<td>Panasonic, Japan</td>
			<td>MLR-352H-PC</td>
			<td>To culture T. denrolimi</td>
		</tr>
		<tr>
			<td>Eppendorf Centrifuge&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>5418R</td>
			<td>To store RNA content</td>
		</tr>
		<tr>
			<td>Eppendorf FemtoJet 4i</td>
			<td>Eppendrof, Germany</td>
			<td>FemtoJet 4i</td>
			<td>To inject T. denrolimi</td>
		</tr>
		<tr>
			<td>Eppendorf Refrigerated Centrifuge&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>5810R</td>
			<td>Centrifuge</td>
		</tr>
		<tr>
			<td>Ethanol solution (75%, RNase-free)</td>
			<td>Aladdin, China</td>
			<td>M052131-500ml</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Gel Extraction Kit</td>
			<td>Omega, USA</td>
			<td>D25000-02</td>
			<td>To extract cDNA</td>
		</tr>
		<tr>
			<td>GUM Arabic</td>
			<td>Solarbio, China</td>
			<td>CG5991-500g</td>
			<td>To make egg card</td>
		</tr>
		<tr>
			<td>Isopropyl alchohol</td>
			<td>Aladdin, China</td>
			<td>80109218</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>Laser-Based Micropipette Puller&#160;</td>
			<td>SUTTER, USA</td>
			<td>P-2000</td>
			<td>To pull capillary glass needle</td>
		</tr>
		<tr>
			<td>Microloader&#160;</td>
			<td>Eppendrof, Germany</td>
			<td>20 &#181;L</td>
			<td>To load dsRNA</td>
		</tr>
		<tr>
			<td>Multi-sample tissue grinder&#160;</td>
			<td>LICHEN, China</td>
			<td>LC-TG-24</td>
			<td>To grind T. denrolimi</td>
		</tr>
		<tr>
			<td>Needle Grinder&#160;</td>
			<td>SUTTER, USA</td>
			<td>BV-10-E</td>
			<td>To grind capillary glass needle</td>
		</tr>
		<tr>
			<td>Nuclease-Free Water</td>
			<td>Sangon Biotech, China</td>
			<td></td>
			<td>To dilute RNA</td>
		</tr>
		<tr>
			<td>OLYMPUS Microscope</td>
			<td>OLYMPUS, Japan</td>
			<td>XZX16</td>
			<td>To observe T. denrolimi</td>
		</tr>
		<tr>
			<td>PCR machine&#160;</td>
			<td>Bio-rad, USA</td>
			<td>S-1000</td>
			<td>For DNA amplification</td>
		</tr>
		<tr>
			<td>PowerPac Basic</td>
			<td>Bio-rad, USA</td>
			<td>PowerPacTM Basic</td>
			<td>To detect the quality of dsRNA&#160;</td>
		</tr>
		<tr>
			<td>Primer of dsGFP (Forward)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			ACAAACCAAGGCAAGTAATA</td>
		</tr>
		<tr>
			<td>Primer of dsGFP (Reverse)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			CAGAGGCATCTTCAACG</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for qPCR (Forward)</td>
			<td></td>
			<td></td>
			<td>TGAAGAGATTCTGCGTTCTGCT</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for qPCR (Reverse)</td>
			<td></td>
			<td></td>
			<td>CTGTAGGAACATCAGCAGGCTT</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for RNAi (Reverse)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG]AG 
			TAGCCATCATCTTTCC</td>
		</tr>
		<tr>
			<td>Primer of Ferhch for RNAi(Forward)</td>
			<td></td>
			<td></td>
			<td>[TAATACGACTCACTATAGGG] 
			ACACTGTCAATCGTCCTG</td>
		</tr>
		<tr>
			<td>Primer of FoxO for qPCR (Forward)</td>
			<td></td>
			<td></td>
			<td>CTACGCCGATCTCATAACGC</td>
		</tr>
		<tr>
			<td>Primer of FoxO for qPCR (Reverse)</td>
			<td></td>
			<td></td>
			<td>TGCTGTCGCCCTTGTCCT</td>
		</tr>
		<tr>
			<td>PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time)</td>
			<td>TaKaRa, Japan</td>
			<td>RR047A</td>
			<td></td>
		</tr>
		<tr>
			<td>Quantitative Real-time PCR&#160;</td>
			<td>Bio-rad, USA</td>
			<td>CFX 96 Touch</td>
			<td>To perform reverse transcriptase polymerase chain reaction (RT-PCR)&#160;</td>
		</tr>
		<tr>
			<td>Real-time PCR (TaqMan) Primer and Probes Design Tool</td>
			<td></td>
			<td></td>
			<td>https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool/</td>
		</tr>
		<tr>
			<td>T7 RiBoMAX Express RNAi System</td>
			<td>Promega, USA</td>
			<td>P1700</td>
			<td>To synthesis dsRNA &#160;in vitro&#160;</td>
		</tr>
		<tr>
			<td>TB Green Premix Ex TaqTM <img alt="Equation 1" src="/files/ftp_upload/66250/66250eq01.jpg" style="margin: auto;" /> (Til RnaseH Plus)</td>
			<td>TaKaRa, Japan</td>
			<td>RR820A</td>
			<td>To perform RT-qPCR</td>
		</tr>
		<tr>
			<td>Trichloromethane</td>
			<td>KESHI, China</td>
			<td>GB/T682-2002</td>
			<td>To extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Ambion, USA</td>
			<td>15596018</td>
			<td>To extract total RNA content from samples</td>
		</tr>
		<tr>
			<td>Ultra-low Temperature Freezer&#160;</td>
			<td>Thermo, USA</td>
			<td>Forma 911</td>
			<td></td>
		</tr>
	</tbody>
</table>

rna interference in the egg parasitoid, trichogramma dendrolimi matsumura

يتم التعرف على طفيليات البيض ، Trichogramma spp ، كعوامل مكافحة بيولوجية فعالة ضد مختلف آفات حرشفيات الأجنحة في الزراعة والغابات. تتطور المراحل غير الناضجة من نسل Trichogramma داخل البويضة المضيفة ، وتظهر ضآلة ملحوظة (حوالي 0.5 مم في طول البالغين). برزت منهجية تداخل الحمض النووي الريبي (RNAi) كأداة حاسمة لتوضيح وظائف الجينات في العديد من الكائنات الحية. ومع ذلك ، فإن التلاعب بالحمض النووي الريبي في بعض الأنواع الطفيلية الصغيرة ، مثل Trichogramma ، قد شكل تحديات كبيرة بشكل عام. في هذه الدراسة ، نقدم طريقة RNAi فعالة في Trichogramma denrolimi. يشمل الإجراء المحدد الحصول على عينات T. dendrolimi الفردية وعزلها من بيض المضيف ، وتصميم وتوليف الحمض النووي الريبي المزدوج الذي تقطعت به السبل (dsRNA) ، وزرع وزراعة الشرانق T. dendrolimi في المختبر ، والحقن الدقيق ل dsRNA ، والتقييم اللاحق للضربة القاضية الجينية المستهدفة من خلال تحليل RT-qPCR. توفر هذه الدراسة إجراء شاملا ومفصلا بصريا لإجراء تجارب RNAi في T. dendrolimi ، مما يمكن الباحثين من التحقيق في تنظيم الجينات في هذا النوع. علاوة على ذلك ، فإن هذه المنهجية قابلة للتكيف مع دراسات RNAi أو الحقن الدقيقة في أنواع Trichogramma الأخرى مع تعديلات طفيفة ، مما يجعلها مرجعا قيما لإجراء تجارب RNAi في الأنواع الطفيلية الداخلية الأخرى.

Trichogramma spp. are a group of egg parasitoids that have been extensively utilized as highly efficient biological control agents against a wide spectrum of lepidopteran pests in agricultural and forest ecosystems worldwide1,2,3,4. The application of mass-reared Trichogramma provides an environmentally friendly approach for the sustainable management of pests5,6,7. Understanding the molecular biology of Trichogramma wasps provides valuable insights into enhancing the mass-rearing efficiency and field performance of these biological control agents8,9by investigating the methodology of gene regulation and genome editing10.
Since the discovery of double-stranded RNA (dsRNA)-mediated specific genetic interference in Caenorhabditis elegans in 1998, the RNA-interference (RNAi) method has evolved into a vital genetic toolkit for exploring the regulatory mechanisms of organisms by suppressing the expression of target genes11. RNAi experiments have become a standard methodology widely applied to study gene function in numerous insect species12,13. Nevertheless, the manipulation of RNAi presents a formidable challenge in many parasitoid species, particularly among those belonging to the endoparasitic Chalcidoidea family14,15,16. The RNAi method has been documented in at least 13 parasitoid species14,15,16,17,18,19. Among these, the RNAi approach has been comprehensively conducted in Nasonia wasps and is applicable throughout the developmental stages, including embryos, larvae, pupae, and adults14,15,16. It is noteworthy that Nasonia wasps are ectoparasitoids, with their offspring developing in the interstitial space between the host pupa and the puparium, enabling their cultivation in vitro and making them tolerate certain treatments, such as micro-injection. Unlike Nasonia wasps, Trichogramma individuals undergo their entire embryonic, larval, and pupal development inner the host egg. The layer at embryo and larva stages (which may impede dsRNA permeability), vulnerability to damage, and the difficulty in surviving in vitro present formidable obstacles20,21,22. Additionally, the diminutive size of Trichogramma individuals, approximately ~0.5 mm in adult or pupal length, renders them exceedingly intricate to manipulate20,21,22.
In the present study, we outline a comprehensive procedure for conducting RNA interference (RNAi) experiments in Trichogramma denrolimi Matsumura. This procedure encompasses the following procedures: (1) the design and synthesis of double-stranded RNA (dsRNA), (2) microinjection of T. denrolimi pupae, (3) the transplantation and in vitro incubation of these pupae, and (4) the detection of target gene knockdown through RT-qPCR analysis. The target gene selected for the RNAi experiment is the ferritin heavy chain homology (Ferhch). FerHCH, an iron-binding protein, contains a ferroxidase center endowed with antioxidant capabilities, facilitating the oxidation of Fe2+ to Fe3+. It plays an indispensable role in the growth and development of various organisms by maintaining redox equilibrium and iron homeostasis. Depletion of FerHCH can result in the overaccumulation of iron, leading to irreversible tissue damage, and often culminating in significant phenotypic alterations, including growth defects, deformities, and mortality23,24. This study offers a step-by-step guide for conducting RNAi in T. denrolimi, which will be invaluable for investigating the gene functions within the broader context of Trichogramma wasps.

تسليط الضوء على المؤلف: التحقيق في التوالد العذري Thelytokous الناجم عن الولبخية وتطوير مجموعة الأدوات الجينية من خلال تداخل الحمض النووي الريبي

تدخل الحمض النووي الريبي في طفيلي البيض ، Trichogramma dendrolimi Matsumura

Trichogramma wasps are a group of egg parasitoids used to control lepidopteran pests in agriculture. The intracellular bacteria Wolbachia induces thelytokous parthenogenesis in some Trichogramma wasps. We are trying to answer the mechanism of Wolbachia and sex-determination systems in Trichogramma wasps.We have developed the RNA interference method in Trichogramma wasps. This method is a vital genetic toolkit for investigating the gene functions of Trichogramma. The immature stages of Trichogramma offspring develop within the host egg.The body size of Trichogramma is extremely small and is approximately 0.5 millimeter in adult length. The manipulation of genetic tools such as RNA interference and genome editing presents a formidable challenge for these tiny parasitoid wasps. For decades, gene functions within the entire Trichogramma genus have been rarely explored.The present methodology provides a robust model for investigating gene regulation during developmental and physiological activities in Trichogramma wasps.

كان معدل ظهور الشرانق T. denrolimi المحقونة ب dsFerhch أقل بكثير من أولئك الذين تم حقنهم ب dsGFP أو أولئك الذين لم يحقنوا (الجدول 1). من بين الدبابير الناشئة ، 51.85 ٪ من الدبابير T. denrolimi التي تعرضت ل dsFerhch وضعت أجنحة صغيرة مشوهة. لم تلاحظ الدبابير المشوهة في الدبابير المحقو?...

Watch this Scientific Journal Video about RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura at JoVE.com

يمثل التلاعب بتداخل الحمض النووي الريبي (RNAi) تحديا هائلا في العديد من الأنواع الطفيلية ذات الحجم الصغير ، مثل دبابير Trichogramma . حددت هذه الدراسة طريقة RNAi فعالة في Trichogramma denrolimi. توفر المنهجية الحالية نموذجا قويا للتحقيق في تنظيم الجينات في دبابير Trichogramma .

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and ...

الدبابير Trichogramma هي مجموعة من طفيليات البيض المستخدمة للسيطرة على آفات حرشفيات الأجنحة في الزراعة. البكتيريا داخل الخلايا Wolbachia يحفز thelytokous parthenogenesis في بعض الدبابير Trichogramma. نحن نحاول الإجابة على آلية Wolbachia وأنظمة تحديد الجنس في الدبابير Trichogramma.لقد طورنا طريقة تداخل الحمض النووي الريبي في الدبابير Trichogramma. هذه الطريقة هي مجموعة أدوات وراثية حيوية للتحقيق في وظائف الجينات في Trichogramma. تتطور المراحل غير الناضجة من نسل Trichogramma داخل البويضة المضيفة.حجم جسم Trichogramma صغير للغاية ويبلغ طوله حوالي 0.5 ملليمتر في البالغين. يمثل التلاعب بالأدوات الوراثية مثل تداخل الحمض النووي الريبي وتحرير الجينوم تحديا هائلا لهذه الدبابير الطفيلية الصغيرة. لعقود من الزمان ، نادرا ما تم استكشاف وظائف الجينات داخل جنس Trichogramma بأكمله.توفر المنهجية الحالية نموذجا قويا للتحقيق في تنظيم الجينات أثناء الأنشطة التنموية والفسيولوجية في دبابير Trichogramma.

rna-interference-egg-parasitoid-trichogramma-dendrolimi

Research

JoVE Journal

Biology

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

1.0K Views.  Shenyang Agricultural University. الدبابير Trichogramma هي مجموعة من طفيليات البيض المستخدمة للسيطرة على آفات حرشفيات الأجنحة في الزراعة. البكتيريا داخل الخلايا Wolbachia يحفز thelytokous parthenogenesis في بعض الدبابير Trichogramma. نحن نحاول الإجابة على آلية Wolbachia وأنظمة تحديد الجنس في الدبابير Trichogramma.لقد طورنا طريقة تداخل الحم...

Video: تسليط الضوء على المؤلف: التحقيق في التوالد العذري Thelytokous الناجم عن الولبخية وتطوير مجموعة الأدوات الجينية من خلال تداخل الحمض النووي الريبي

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

Cultivation and Transplantation of Trichogramma dendrolimi Pupae Using Corcyra cephalonica Eggs

To begin, add a solution of gum Arabic powder and water to a nine centimeter by 16 centimeter card. Then place approximately 5, 000 eggs of Corcyra cephalonica onto the card. Subject the host egg cards to 30 minutes of ultraviolet irradiation to prevent the hatching of eggs.Subsequently, cut the paper with inactivated eggs into egg cards, each containing approximately 300 to 500 eggs. Next, introduce a cohort of 80 to 120 Trichogramma dendrolimi wasps into a glass tube. Seal the tube with cotton.For parasitization, allow the wasps to deposit their eggs into the host eggs for six hours. Then promptly remove the wasps. Cultivate the parasitized host eggs for approximately eight days at 25 degrees Celsius.After five days, the parasitized host eggs turned black. Transfer the host egg card to a dissecting microscope. Using a pair of tungsten needles, meticulously remove the chorion from the host eggs and retrieve the pupa from within.Next, prepare a plate with 1.5%agar as substrate. Using a disinfected graver, etch several grooves on the agar. Now using a small brush, transplant a pupa from the dissected host egg into one of the grooves on the agar substrate.

زراعة وزرع الشرانق Trichogramma dendrolimi باستخدام بيض Corcyra cephalonica

Microinjecting dsRNA into Trichogramma dendrolimi Pupae and Monitoring Developmental Outcomes

To begin, turn on the glass needle puller, then set the heat to 280, the velocity to 170, the delay to 250, and the pole to 30. Bevel the tip of the capillary glass needle. Then using a micro injection pump, load approximately two microliters of ferritin heavy chain homology double-stranded RNA solution into the injection needle.Transfer the agar plate containing Trichogramma dendrolimi pupae onto the compound microscope stage. Carefully insert the injection needle into the abdomen of a pupa at an approximately 30 degree angle and gradually inject five nanoliters of ferritin heavy chain homology double-stranded RNA solution. Incubate approximately 700 pupae per treatment at 25 degrees Celsius for 24 or 48 hours.Extract RNA content from 100 pupae per replicate. From approximately 50 pupae per treatment, observe the wasps emergence. Finally, record the wasps emergence rate and deformity rate.T.dendrolimi pupae injected with double-stranded ferritin heavy chain homology exhibited a significantly lower emergence rate compared to those injected with double-stranded GFP or without injection. In emerged wasps, 51.85%of T.dendrolimi wasps subjected to double-stranded ferritin heavy chain homology developed deformed small wings. This deformation was absent in wasps injected with double-stranded GFP or those without any injection.Additionally, T.dendrolimi pupae injected with double-stranded ferritin heavy chain homology showed melanism, indicative of abnormal iron metabolism. The melanin was not observed in wasps injected with double-stranded GFP or those without any injection.