High-Speed Atomic Force Microscopy Imaging of DNA Three-Point-Star Motif Self Assembly Using Photothermal Off-Resonance Tapping

Riepilogo

Here, we show the imaging protocol for observing biomolecular interactions with photothermal off-resonance tapping (PORT), where we optimized imaging parameters, identified system limits, and investigated potential improvements in imaging three-point-star DNA motif assembly.

Abstract

High-speed atomic force microscopy (HS-AFM) is a popular molecular imaging technique for visualizing single-molecule biological processes in real-time due to its ability to image under physiological conditions in liquid environments. The photothermal off-resonance tapping (PORT) mode uses a drive laser to oscillate the cantilever in a controlled manner. This direct cantilever actuation is effective in the MHz range. Combined with operating the feedback loop on the time domain force curve rather than the resonant amplitude, PORT enables high-speed imaging at up to ten frames per second with direct control over tip-sample forces. PORT has been shown to enable imaging of delicate assembly dynamics and precise monitoring of patterns formed by biomolecules. Thus far, the technique has been used for a variety of dynamic in vitro studies, including the DNA 3-point-star motif assembly patterns shown in this work. Through a series of experiments, this protocol systematically identifies the optimal imaging parameter settings and ultimate limits of the HS-PORT AFM imaging system and how they affect biomolecular assembly processes. Additionally, it investigates potential undesired thermal effects induced by the drive laser on the sample and surrounding liquid, particularly when the scanning is limited to small areas. These findings provide valuable insights that will drive the advancement of PORT mode's application in studying complex biological systems.

Introduzione

High-speed atomic force microscopy (HS-AFM) is a rapidly growing imaging technique^1,2,3,4. It operates at speeds that allow researchers to visualize biomolecular interactions in real time^5,6,7,8,9. Photothermal off-resonance tapping (PORT) is an off-resonance imaging mode similar to peak force tapping^10,11, pulsed force mode^12,13, or jumping mode¹⁴. However, rather than vertically oscillating the scanner, PORT vertically oscillates only the cantilever through an excitation laser focused on the cantilever (usually close to the clamping point). The cantilever deforms due to the bimorph effect: a power-modulated excitation laser periodically heats the coated cantilever, which bends due to the different thermal expansion coefficients of the cantilever and the coating materials¹⁵. Cantilever and sample heating can be minimized by using a drive laser that is periodically switched off and back on during each oscillation cycle, rather than using a full sinusoidal drive⁵.

DNA has been used to form biologically relevant, structurally interesting, and biochemically useful motifs for a number of years^{16,17,18,19,20}. In addition, DNA structures have been proven ideally suited to characterize AFM imaging quality²¹ and to assess the tip-effect of high speed AFM²². Blunt-end DNA three-point-stars (3PS) became practical as a programmable model system for investigating the supramolecular organization of similarly structured molecules in otherwise complex biological systems¹⁹. Previously, the self-assembly of lattices formed by blunt-ended trimeric DNA monomers was tracked via HS-AFM²³. Eventually, these organize into large networks with hexagonal order. Here, the self-assembly of DNA 3-point stars¹⁹ is imaged with the PORT technique at scanning speeds fast enough to track the self-assembly and its correction mechanisms²⁴ while assuring minimal disruption of the process or sample damage. As with any HS-AFM mode, there is a trade-off between achievable imaging quality, imaging speed, and the unwanted disturbance of the sample. By choosing the right compromise, one can better understand the self-organization patterns of supramolecular assemblies. This protocol will, therefore, use a similar setup with DNA 3PS as a model system to optimize the parameters specific to PORT. This will allow operation at fast imaging speeds at large enough scan sizes while minimizing sample damage.

Protocollo

1. Sample and buffers

NOTE: The DNA tile used in this study is the 3-point-star motif developed at the Mao laboratory at Purdue University^19,25. All oligonucleotides used in this study were purchased from Integrated DNA Technologies, Inc. Gather the necessary materials and reagents.

1. Mix the single-stranded DNAs (ssDNAs) at a 1:3:3 molar ratio (S1 0.6 µM, 1.8 µM for S2, and 1.8 µM for S3) in the annealing buffer (5 mM TRIS, 1 mM EDTA, and 10 mM MgAc₂). The final concentration of the DNA motif must be 0.6 µM (49 ng/µL with the molecular weight of 3PS being 82020.3 g/mol).
2. Place the DNA solution in a heat-resistant container and heat it to 80 °C. Slowly cool the DNA solution from 80 °C to 20 °C over a period of 4 h. This annealing process helps the ssDNA oligonucleotides to form the desired double-stranded DNA motif.
3. For purification, load the annealed DNA solution onto a 3% agarose gel to remove the excess ssDNAs and any unwanted side product. Run the 3% gel at 60 V for ca. 2.5 h in a running buffer containing 0.5x Tris-Borate-EDTA (TBE) and 10 mM Mg(CH₃COO)₂.
4. Identify and locate the band on the gel that contains the DNA motif. Ensure that the band has migrated to a specific position based on its size.
5. Excise the band containing the DNA motif from the gel carefully. Extract the DNA motif from the excised gel fragment by placing it in a gel extraction spin column and centrifuging at 3,000 x g and 4 °C for 10 min.
6. Replace the buffer in the extracted DNA motif with the annealing buffer using a centrifugal concentrator. Centrifuge at 3000 x g at room temperature (or lower) until the concentrated solution is less than 100 µL. Then, add 300 µL of annealing buffer and repeat this step twice to ensure the buffer is replaced.
7. Dilute the DNA motif to 6 nM for imaging purposes. Use a spectrophotometer or other appropriate methods to accurately determine and adjust the concentration. The DNA motif is now ready for imaging.
   NOTE: All buffers in the protocol are of pH 8.0. The sequence information for the three respective bands is as follows:
   S1: AGGCACCATCGTAGGTTTCTTGCCAGGCACCATCGT
   AGGTTTCTTGCCAGGCACCATCGTAGGTTTCTTGCC
   S2: ACTATGCAACCTGCCTGGCAAGCCTACGATGGACA
   CGGTAACG
   S3: CGTTACCGTGTGGTTGCATAGT

2. Cantilever tip growth

1. Cantilever mounting on the SEM cantilever holder: Ensure that cantilevers are clean and free from any contaminants. Mount the cantilevers onto a suitable holder compatible with the SEM system. The custom-built cantilever holder design can be shared upon request.
2. Gas injection: Heat up the precursor gas (e.g., phenanthrene C₁₄H₁₀ precursor for amorphous carbon tips) to be used on the gas injection system to grow the new tip. As soon as the vacuum is below 10^-5 mbar, purge the gas injection line 10 times for 2 s to be sure no undesired remnant air is in the nozzle line (that must be done with the valve to the gun chamber closed).
3. Tip position adjustment: Use scanning electron microscopy (SEM) to locate the end of the cantilever. Tilt the cantilever holder to an angle (e.g., 11° in this case) equivalent to the one the cantilever will present when placed on the AFM cantilever holder with respect to the surface so the grown tip will be perpendicular to the surface while imaging. Adjust the position and focus of the SEM to obtain a clear view of the cantilever's tip, where a sharp carbon nano-tip will be grown.
4. Focused electron beam-induced deposition (FEBID):
   1. Set the deposition parameters on the selected software (in this case, SmartFIB), such as beam current (I) and acceleration voltage (V), working distance (WD), magnification, exposed shape, dose/deposition time, and dwell time. The following parameters were used to grow amorphous carbon tips, which present good mechanical properties for AFM imaging, leading to lengths around 130 nm and radii in the range of 2-4 nm:
      Select spot/dot as exposed shape
      WD = 5 mm
      I = 78 pA, and V = 5 kV
      Dwell time = 1 µs
      Dose = 0.05 nC, and deposition time = 0.64 s
      Magnification = 20000x
   2. Begin the deposition process to grow the tip by irradiating the electron beam in a spot onto the cantilever tip while simultaneously injecting the precursor gas, closing the gas when the deposition is done. In this case, the SmartFIB software performs this automatically after setting up the recipe mentioned above.
5. Post-growth analysis: Perform post-growth SEM imaging to examine the newly grown tip and ensure its quality and characteristics (tip radius and length). Wait 1-2 min after tip growth to be sure all the precursor gas is pumped out to avoid re-deposition during the SEM imaging. Remove the sample holder from the SEM chamber.
6. Cantilever recycling: In case the SEM system also has a combined focused ion beam (FIB) installed, remove a damaged or dirty previously grown tip by milling it with the FIB system using low FIB currents (e.g., 1 pA, to avoid cantilever damage). Perform the tip removal by milling in a cross-section form, from tip end to base, to avoid tip collapse. This will let re-growing a new one.

3. HS-AFM hardware

1. The imaging setup is composed of the custom-built PORT head^{5, 26} (Figure 1A), high-speed scanner²⁶ with a sample disc with mica on top, compatible controller²⁷, high voltage amplifier with the high bandwidth required for high-speed imaging, AFM base, and PC with the required software to control the before mentioned equipment²⁷.
   NOTE: In this case, these are open-source components for which plans can be obtained from the Laboratory for Bio- and Nano- Instrumentation at EPFL^{27, 28}. It is also possible to attend workshops on how to build the PORT head and controller²⁹, as well as to download and use the LabView based software.
2. Carefully place an ultra-short cantilever (e.g., AC10DS or equivalent) under the spring clip on the cantilever holder using tweezers. Assure that the cantilever chip is fixed and stable.
3. Add 50 µL of liquid using a syringe through the left fluid access port, as demonstrated in Figure 1B. With the excitation laser still off, align the read-out laser on the cantilever using the three dedicated knobs on the AFM head shown in Figure 1A. Do this by observing the shadow of the cantilever on a white paper while maximizing the sum (shadow method). Then, center the laser spot on the photodiode using the two dedicated knobs.
4. Switch on and align the drive laser by checking the Excitation Enable box in Excitation VI, so it actuates and oscillates the cantilever. Show the cantilever excitation signal and the cantilever deflection signal on a connected oscilloscope. If the deflection oscillation is too low (or not existent) it might be that the drive laser is very far off from the cantilever. In that case, use the shadow method and turn off the deflection laser for easier alignment. Maximize the oscillation amplitude using the drive laser adjustment knobs shown in Figure 1A.
5. To adjust the cantilever oscillation amplitude in PORT, input in the corresponding control of the software the peak-to-peak voltage sent to the laser diode control circuit (from now on, peak-to-peak AC input) in Excitation VI. To keep the laser diode in the conduction regime and, therefore, lasing, add a DC voltage to the laser diode control circuit (from now on, DC offset input), which is also done from a configuration box in Excitation VI. Both will also affect the laser power, which can be measured with a laser power meter and is used to tune the cantilever oscillation amplitude.
6. Determine the maximum photothermal excitation frequency that can be applied to the cantilever, which must be below the resonance frequency of the cantilever. Determine the resonance frequency by a thermal tune or a frequency sweep. The cantilevers used in this study (AC10DS), whose resonance frequency in liquids is around 400 kHz (1 MHz in air)³⁰, have a quasistatic bending region below 300 kHz⁵. Thus, PORT frequencies below that limit (around 100-200 kHz) must be used.
7. Adjust the imaging parameters and settings for PORT rate and scan rate to the required values in the Excitation and Scan Vis respectively (the parameters used in this article are stated in the figure descriptions). Once the setup and imaging parameters are configured, perform the required imaging experiments to observe and track the molecular interactions.
   NOTE: Since AC10DS cantilevers are no longer sold, an alternative such as Fastscan D or BioLever³¹ may need to be used until an equivalent is available.

4. Obtaining proper interaction curves

1. Initially, approach the sample surface in contact mode by clicking Start on the Z-controller VI set to Contact Mode.
   1. In this mode, the AFM tip comes into direct contact with the sample. Once the surface is reached, perform a force versus distance curve in Ramp VI to obtain the cantilever deflection sensitivity calibration.
   2. Also, estimate the cantilever spring constant, either from cantilever provider specifications (less accurately), obtained with an interferometer, or through a thermal tune-based calibration after the deflection sensitivity calibration. A precise cantilever calibration is essential for an accurate tip-sample force control.
2. After completely retracting the Z-piezo from the surface where the tip cannot reach the surface by clicking Up in the Z controller VI, switch to the PORT mode in the Z controller VI, and turn on the excitation laser in the Excitation VI checkbox. To begin, set the PORT mode to operate at the desired frequency in Excitation VI, which, in this experimental case, is 100 kHz, using an AC10DS cantilever.
3. Record the cantilever-free oscillation close but not touching the surface. Then, turn the Feedback in the Z controller ON in contact with the surface to record and click Correct to obtain the oscillation of the cantilever when the cantilever is intermittently in contact with the surface, both in nanometers. Subtract the free oscillation curve from the intermittent contact curve to obtain the true interaction curve, converting them to pN using the cantilever spring constant (in this case, 0.1 N/m).

5. HS-AFM imaging

1. Prepare a solution of Mg(CH₃COO)₂ at a concentration of 10 mM. Using a Hamilton syringe, inject 50 µL of the prepared 10 mM Mg(CH₃COO)₂ solution into the fluidic channel of the cantilever holder, creating a drop of liquid that englobes the cantilever.
2. Gradually approach the cantilever to the surface by clicking Start on the Z Controller VI. Once the surface is detected, turn the Feedback ON, and find the peak of the interaction curve in the ORT Force Curves VI. Find the lowest force setpoint that allows proper tracking (below 300 pN to avoid the damaging of fragile bio-samples).
3. Set the Scan Size in the Scan VI to 800 nm by 800 nm and the Line Rate to 100 Hz. Scan the surface by clicking the Frame (down) arrow in Scan VI to check the surface quality. If any contaminations are detected, address the issue by cleaning the surface, cantilever, and/or cantilever holder before proceeding.
4. After scanning, retract the cantilever from the surface by clicking Withdraw in the Z controller VI. Remove the buffer solution from the hole in the cantilever holder with a Hamilton syringe to prevent dead volume issues.
5. Prepare a diluted DNA 3PS solution from part 1 of the protocol. Inject 50 µL of the diluted DNA 3PS solution into the dedicated channel of the cantilever holder.
6. Start the imaging process by repeating steps 5.2-5.3, scanning an 800 nm by 800 nm area at a default line rate of 100 Hz (256 lines × 256 pixels). After the initial scan, adjust the imaging size and speed in Scan VI to the specified values for further data acquisition.
7. Keep the input force setpoint of the tip-sample interaction in the Z Controller VI Setpoint box at the lowest level required for proper tracking (below 300 pN) throughout the imaging process to minimize sample damaging/disturbance unless otherwise specified. Repeat this process for all the required sample areas.

6. Image processing

1. Set up the environment for running the customized Pygwy (Python for Gwyddion) batch processing code, ensuring that Python and all the necessary libraries. More information can be found on Gwyddion's website³² are properly installed on the system. This ensures that the code runs smoothly and can access the required functionalities.
2. Open the customized Pygwy batch processing code (provided on request). This will provide access to the tools and functionalities needed for image processing and analysis.
3. Begin the image processing by performing horizontal median line correction on the images. This step aims to remove any irregularities or artifacts present in the scan lines, ensuring that subsequent processing steps are based on accurate data. After plane background removal, apply the line correction. Use scar removal to further enhance the images by eliminating any unwanted marks or imperfections caused by external factors. This step improves the overall visual appearance of the images.
4. Enhance the visibility and contrast of the images by adjusting the color height map. This ensures that features of interest are clearly visualized and stand out in the images.
5. Select the processed images that need to be combined into a video. Determine the desired frame rate for the video. In this case, set it to 7 frames per second (fps).
6. Calculate the duration of each frame. Use Fiji (ImageJ) to combine the processed images into a video. Ensure that the frame rate and frame duration are correctly set.

Risultati

In this investigation, the dynamic assembly process of DNA 3-point-star motifs into stable islands was successfully observed utilizing the capabilities of the HS-PORT AFM. This technique allowed us to capture the assembly of these structures in real-time. In Figure 2A,B, we get a clear image scanning at 100 Hz and 200 Hz line rates, respectively, for 100 kHz PORT rate (800 nm by 800 nm scan size). This corresponds to 3.9 and 1.95 oscillation cycles per pixel, respectively. H...

Discussione

When imaging delicate biological samples, off-resonance tapping imaging modes in AFM are particularly useful since they can directly control the tip-sample interaction forces¹⁰. Among them, the PORT mode stands out due to the higher oscillation rates it can reach, which enables higher scan rates. As PORT directly and only actuates the cantilever with a laser, it allows excitation at much higher frequencies than conventional off-resonance tapping modes, particularly when using ultrashort cantilever...

Materiali

Name	Company	Catalog Number	Comments
AC10DS	Olympus	BL-AC10FS-A2	Discontinued
Biometra Compact XS/S	Biometra GmbH	846-025-199	Electrophoresis  unit
Biometra TRIO	Biometra GmbH	207072X	thermocycler for annealing
Custom AFM setup	Laboratory for Bio-Nano Instrumentation, Interfaculty Bioengineering Institute, School of Engineering, Ecole Polytechnique Fédérale Lausanne		Obtainable through Laboratory for Bio-Nano Instrumentation
EDTA	ITW Reagents	A5097	In annealing buffer
Laser Power Meter	Thorlabs	PM100D	Digital Handheld Optical Power and Energy Meter Console
Lively 3AP Power Supply, MP-310	Major Science	MP-310	Electrophoresis Power Supply
MgAc2	ABCR GmbH	AB544692	In annealing buffer
TBE	Thermo Scientific	327330010	Running buffer for electrophoresis
TRIS	Bio-Rad	1610719	In annealing buffer