RSM riconosce finanziamento dal NSF Graduate Research Fellowship. MBN riconosce finanziamenti da Lewis-Sigler Fellowship e il dono dotati di Peter Lewis. DB riconosce finanziamenti del NIH (GM046406), l&#39;Istituto Nazionale di General Medical Sciences Center for Quantitative Biology (GM071508). Riconosciamo Christina DeCoste per l&#39;assistenza con gli esperimenti di citometria a flusso.

La Figura 2 fornisce uno schema di protocollo sezioni 1-3. 1. Creazione di ATF <ol><li> Crea primers per PCR amplificare DNA binding domain di interesse. Omologia con il recettore promotore EFF1 e ormone (come descritto nelle figure 3 e 4) è aggiunto mediante PCR per facilitare la corretta ricombinazione nel ceppo yMN15. </li><li> PCR amplifica DBD di interesse utilizzando un polimerasi ad alta fedeltà. </li><li> Trasformazione&gt; 1 mg di prodotto di PCR purificato in lievito utilizzando il metodo acetato di litio 13. </li><li> A seguito di trasformazione, celle di rotazione alla massima velocità per 15 secondi in microcentrifuga e rimuovere trasformazione mix. </li><li> Risospendere in ~ 200 ml di acqua sterile e piatto su YPD. </li><li> Il giorno successivo, piastra replica da YPD su piastre 5-FOA (piastre 5-FOA sono fatti come descritto nel manuale di lievito Cold Spring Harbor) 13. </li><li> Consentire la crescita per 2-4 days, e restreak almeno 5-10 colonie su YPD. Eseguire una colonia PCR utilizzando i primer in Tabella 1 e la sequenza di verificare inclusione. </li></ol> 2. Creazione di ATF plasmidi Reporter <ol><li> Determinare il sito di legame ATF (più probabile che provengono dalla letteratura). </li><li> Nell&#39;ordine desiderato regione vincolante oligo (o Ultramers, se necessario). Ordine come top e filoni di fondo con sbalzi corretti per Notl &amp; XbaI come indicato nella Tabella 2. </li><li> Diluire oligo concentrazioni equimolari (100 micron). </li><li> Fosforilare utilizzando T4 polinucleotide chinasi e poi ricottura in un termociclatore. Le condizioni di reazione sono in Tabella 3. </li><li> Digest ~ 1-2 mg di pMN8 con NotI-HF e XbaI per 1 ora a 37 ° C (condizioni di reazione nella Tabella 4). </li><li> Gel purificare la fascia dorsale. </li><li> Diluire il backbone purificata a 10 ng / ml. </li><li> Diluire il doppio filamento, fosforileated sito di legame a 5 volte la concentrazione molare di backbone per microlitri. </li><li> Utilizzando T4 DNA ligasi, legare i siti di legame nella catena principale digerito a temperatura ambiente per 30 minuti (Tabella 5). </li><li> Per la trasformazione, aggiungere metà della reazione di ligazione a 50 ml di norma, chimicamente competenti Escherichia coli come XL1-Blue o DH5-Alpha. </li><li> Cellule scossa di calore per 45 secondi in un bagno d&#39;acqua a 42 ° e poi mettere in ghiaccio per 2 min. </li><li> Aggiungere 900 pl di mezzo SOC di reazione di trasformazione. </li><li> Crescere a 37 ° C per 1 ora su un tamburo rullo. </li><li> Stendere 100-200 cellule microlitri per LB + AMP (100 pg / ml) piastra e incubare una notte. </li><li> Crescere E. coli in LB + AMP liquido e la raccolta del DNA plasmide. Sequenza verificare nuovo plasmide reporter colonie legatura utilizzando il primer 5&#39;-GTACCTTATATTGAATTTTC-3 &#39;. </li><li> Trasforma nuovo plasmide reporter di in-ATF contenenti lievito strain dalla sezione 1 con litio trasformazione acetato. </li></ol> 3. Quantificare l&#39;effetto di ATF induzione sull&#39;espressione genica Uso GFP Reporter Preparazione dei campioni: <ol><li> Fai 25 mm magazzino β-estradiolo (10 ml di etanolo + 0,0681 g di β-estradiolo). Conservare in frigorifero. </li><li> Grow ATF + Reporter contenenti ceppo pernottamento in 5ml SC-URA. </li><li> Ottenere nove 250 ml scuotono palloni e aggiungere 25 ml di SC-URA a ciascuno. </li><li> Aggiungere 0 nM, 0.1 nM, 1 nM, 10 nM, 100 nM, 1 mM, o 10 mM β-estradiolo. Questo è più facilmente fatto facendo diluizioni seriali di 10 volte della β-estradiolo magazzino 25 mm. Per una concentrazione finale di 10 mM β-estradiolo, aggiungere 10 ml di β-estradiolo magazzino 25 mM a 25 ml di SC-URA. </li><li> Aggiungere 125 ml di culture durante la notte per fiaschi (1:200 diluizione). </li><li> Per i due rimanenti boccette, inoculare con un costitutiva GFP produzione strain ed un ceppo privo GFP. Questi sono necessari per la calibrazione del citometro a flusso. </li><li> Agitare a 200 rpm a 30 ° C per 12-18 ore. Nota: Il tempo ottimale di incubazione è determinata individuando quando induzione GFP non cambia più in seguito all&#39;aggiunta di β-estradiolo. </li><li> Prendete 500 ml di ogni cultura e spin giù in tubi di 1,7 ml microcentrifuga separate. </li><li> Aspirare SC-URA. </li><li> Risciacquare una volta in 1 ml di PBS +0,1% Tween-20 e aspirare. </li><li> Aggiungere 1 ml di PBS +0,1% di Tween-20 e risospendere. </li><li> Aggiungere 1 ml di PBS +0,1% Tween-20 per provette Falcon. </li><li> Aggiungere le cellule risospese a 5 ml provette (volume finale = 2 ml) (può essere conservato a 4 ° C per diversi giorni). </li><li> Optional: cellule Sonicare leggermente per rottura eventuali cellule clumped. Citometria a flusso: Descrizione: La fluorescenza delle cellule 10,000-100,000 è tipicamente analizzata per campione. I dati potranno essere trattati in FlowJo o utilizzare script personalizzati in MATLAB oR. Assicurarsi di calibrare tensione del canale GFP usando GFP controlli positivi e negativi. Una volta che i file FCS sono esportati, uno script come quello in figura 6 con le fca_readfcs funzionali ( <a href="http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader">http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader</a> ) può essere utilizzato per elaborare il dati. </li><li> Eseguire la citometria a flusso. <ol><li> Usa forward scatter (FSC) e side scatter (SSC) per identificare le cellule di lievito. </li><li> Impostare la portata di ~ 3.000 cellule / sec. </li><li> Misurare GFP (canale FITC). </li><li> ,. FCS file di esportazione volta che i dati vengono raccolti </li></ol></li><li> Caricare MATLAB. </li><li> Spostare i file. FCS, fcs_readfcs.m, e uno script simile a quella in figura 6 nella stessa cartella. </li><li> Cambiare la directory di lavoro alla cartella contenente i dati e gli script. </li><li> Eseguire lo script di Figura 6 (nota: l&#39;leggenda è stato inserito manualmente per produrre ciò che è visibile nella figura 7). </li></ol> 4. Quantificare l&#39;effetto di ATF induzione sulla crescita delle cellule <ol><li> Da scorte congelate, realizzato su entrambi (1) un ceppo-ATF contenimento e (2) un ceppo-ATF manca (come yMN15) su piastre YPD separati. </li><li> Dopo 2 giorni di crescita, inoculare provette di coltura separate contenenti 5 ml di liquido YPD con ogni ceppo e crescere per una notte a 30 ° C. </li><li> Eseguire 10-diluizioni seriali di una soluzione madre mM β-estradiolo 0,25 fino a 10.000 volte (0.025 mM β-estradiolo) in etanolo al 100%. </li><li> Aggiungere 40 ml di colture overnight a 10 ml di liquido YPD (1-250 diluizione). </li><li> Per ogni ceppo, aggiungere 96 ml di cellule diluite a 18 pozzetti di una piastra a 96 pozzetti. </li><li> Aggiungere 4 ml di β-estradiolo alle cellule. Un punto essenziale è assicurarsi ogni pozzetto ha la stessa quantità di etanolo totale. (In alternativa, un mo<html> re magazzino concentrata di β-estradiolo può essere utilizzato e successivamente diluite al punto gli effetti dell&#39;etanolo sulla crescita non è misurabile). </li><li> Eseguire in triplice copia. Tre dei pozzetti per ogni ceppo deve essere etanolo-solo controlli. </li><li> Coprire la piastra a 96 pozzetti del gas membrana permeabile. </li><li> Monitorare la crescita (OD 600) in lettore di piastre. </li><li> Quantificare i tassi di crescita utilizzando un qualsiasi numero di metodi standard come trovare la massima pendenza. Nota: Abbiamo avuto un buon successo con l&#39;open source software grofit 14, che viene eseguito in ambiente di programmazione R Vale la pena ricordare che, mentre i tassi di crescita calcolati da saggi piastra a 96 pozzetti rispetto a scuotere-palloni (25 ml culture). non sono necessariamente le stesse (a causa di entrambe le differenze nella fisiologia e nella strumentazione), abbiamo osservato che i tassi di crescita relativi sono simili (anche se questo può non essere sempre il caso). </li></ol>tle &quot;&gt; 5. Crea inducibili Genomica alleli <ol><li> Ottenere pMN10, un plasmide noncentromeric con il promotore ATF-reattiva da pMN8 fusa KanMX (con orientamento opposto). </li><li> Limitazione digerire il vettore backbone ed estratto gel come nella sezione 2. </li><li> Tempra, fosforilare, e oligo Legare contenenti appropriate siti di legame come descritto nella Sezione 2. </li><li> Sequenza di verifica. Questo plasmide servirà ora come stampo il DNA per creare l&#39;allele inducibile. </li><li> Ottenere il ceppo di lievito che esprime il corrispondente ATF di interesse. </li><li> PCR amplifica la cassetta KanMX-Promoter (~ 2 kb) utilizzando primer dalla tabella 6. </li><li> Trasformare il prodotto di PCR nel ceppo-ATF esprimere con il metodo acetato di litio. </li><li> Piatto su YPD e la piastra replica su YPD + G418 il giorno seguente. </li><li> Conferma appropriato inserimento del promotore utilizzando il primer forward (5&#39;-CTGCAGCGAGGAGCCGTAAT-3 &#39;) e un innesco inverso interna al secoloe gene il cui promotore è stato sostituito. L&#39;innesco inverso è in genere progettati per essere tra 200-300 bp a valle del primo ATG 15. Il prodotto finale di PCR è ~ 1,2 kb. </li></ol>

<ol>
	<li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic acids res. 41, e57 (2013).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast-acting+and+nearly+gratuitous+induction+of+gene+expression+and+protein+depletion+in+Saccharomyces+cerevisiae.">Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae.</a> Mol. Biol. cell. 22, 4447-4459 (2011).</li><li>Louvion, J. F., Havaux-Copf, B., Picard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+of+GAL4-VP16+to+a+steroid-binding+domain+provides+a+tool+for+gratuitous+induction+of+galactose-responsive+genes+in+yeast.">Fusion of GAL4-VP16 to a steroid-binding domain provides a tool for gratuitous induction of galactose-responsive genes in yeast.</a> Gene. 131, 129-134 (1993).</li><li>Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G., Evan, G. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+oestrogen+receptor+ligand-binding+domain+as+an+improved+switch+for+the+regulation+of+heterologous+proteins.">A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins.</a> Nucleic acids res. 23, 1686-1690 (1995).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+Analysis+of+mRNA+Molecules+Using+Fluorescence+In+Situ+Hybridization+in+Saccharomyces+cerevisiae.">Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae.</a> J. Vis. Exp. (76), e50382 (2013).</li><li>McIsaac, R. S., Petti, A. A., Bussemaker, H. J., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perturbation-based+analysis+and+modeling+of+combinatorial+regulation+in+the+yeast+sulfur+assimilation+pathway.">Perturbation-based analysis and modeling of combinatorial regulation in the yeast sulfur assimilation pathway.</a> Mol. Biol. cell. 23, 2993-3007 (2012).</li><li>Belli, G., Gari, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic acids res. 26, 942-947 (1998).</li><li>Baron, U., Bujard, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tet+repressor-based+system+for+regulated+gene+expression+in+eukaryotic+cells:+principles+and+advances.">Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances.</a> Meth. Enzymol. 327, 401-421 (2000).</li><li>Kodama, S., Okada, K., Akimoto, K., Inui, H., Ohkawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+aryl+hydrocarbon+receptors+for+bioassay+of+aryl+hydrocarbon+receptor+ligands+in+transgenic+tobacco+plants.">Recombinant aryl hydrocarbon receptors for bioassay of aryl hydrocarbon receptor ligands in transgenic tobacco plants.</a> Plant Biotechnol. J. 7, 119-128 (2009).</li><li>Hickman, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+regulation+of+sulfur+and+phospholipid+metabolism+reflects+the+importance+of+methylation+in+the+growth+of+yeast.">Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.</a> Mol. Biol. cell. 22, 4192-4204 (2011).</li><li>Taxis, C., Stier, G., Spadaccini, R., Knop, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+protein+depletion+by+genetically+controlled+deprotection+of+a+dormant+N-degron.">Efficient protein depletion by genetically controlled deprotection of a dormant N-degron.</a> Mol. Syst. Biol. 5, 267 (2009).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nat. methods. 6, 917-922 (2009).</li><li>Burke, D. J., Amberg, D. C., Strathern, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. , (2005).</li><li>Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J., Kschischo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=grofit:+Fitting+Biological+Growth+Curves+with+R.">grofit: Fitting Biological Growth Curves with R.</a> J. Stat. Softw. 33, 1-21 (2010).</li><li>Rozen, S., Skaletsky, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+on+the+WWW+for+general+users+and+for+biologist+programmers.">Primer3 on the WWW for general users and for biologist programmers.</a> Methods Mol. Biol. 132, 365-386 (2000).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150, 647-658 (2012).</li><li>Chockalingam, K., Chen, Z., Katzenellenbogen, J. A., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+specific+receptor-ligand+pairs+for+use+in+the+creation+of+gene+switches.">Directed evolution of specific receptor-ligand pairs for use in the creation of gene switches.</a> Proceedings of the National Academy of Sciences of the United States of America. 102, 5691-5696 (2005).</li><li>McLachlan, M. J., Chockalingam, K., Lai, K. C., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+orthogonal+ligand+specificity+in+a+single+scaffold.">Directed evolution of orthogonal ligand specificity in a single scaffold.</a> Angewandte Chemie. 48, 7783-7786 (2009).</li><li>Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., Tyers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+pathways+that+couple+cell+growth+and+division+in+yeast.">Systematic identification of pathways that couple cell growth and division in yeast.</a> Science. 297, 395-400 (2002).</li><li>Sopko, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+pathways+and+phenotypes+by+systematic+gene+overexpression.">Mapping pathways and phenotypes by systematic gene overexpression.</a> Mol. cell. 21, 319-330 (2006).</li><li>Shimizu-Sato, S., Huq, E., Tepperman, J. M., Quail, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+light-switchable+gene+promoter+system.">A light-switchable gene promoter system.</a> Nat. biotechnol. 20, 1041-1044 (2002).</li><li>Polstein, L. R., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light-inducible+spatiotemporal+control+of+gene+activation+by+customizable+zinc+finger+transcription+factors.">Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors.</a> J. Am. Chem. Soc. 134, 16480-16483 (2012).</li><li>Losi, A., Gartner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Old+chromophores,+new+photoactivation+paradigms,+trendy+applications:+flavins+in+blue+light-sensing+photoreceptors.">Old chromophores, new photoactivation paradigms, trendy applications: flavins in blue light-sensing photoreceptors.</a> Photochem. Photobiol. 87, 491-510 (2011).</li><li>Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond-timescale,+genetically+targeted+optical+control+of+neural+activity.">Millisecond-timescale, genetically targeted optical control of neural activity.</a> Nat. Neurosci. 8, 1263-1268 (2005).</li><li>Gradinaru, V., Mogri, M., Thompson, K. R., Henderson, J. M., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+deconstruction+of+parkinsonian+neural+circuitry.">Optical deconstruction of parkinsonian neural circuitry.</a> Science. 324, 354-359 (2009).</li><li>Milias-Argeitis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+feedback+for+in+vivo+regulation+of+a+gene+expression+circuit.">In silico feedback for in vivo regulation of a gene expression circuit.</a> Nat. biotechnol. 29, 1114-1116 (2011).</li></ol>

McIsaac, Noyes, e Botstein (con gli altri) hanno presentato parte di questo sistema come un Disclosure brevetti.

Gli interruttori a base di ormoni descritte hanno una miriade di applicazioni, dallo studio biologia cellulare nativo per valutare la capacità di un dominio di legame al DNA di interesse per indirizzare una sequenza di DNA in vivo. Il sistema ha molte caratteristiche desiderabili, tra cui una risposta graduata a induttore, azione veloce e stretta regolazione (cioè. Senza leakiness misurabile, vedi Figura 7). Tuttavia, c&#39;è ancora margine di miglioramento ed espansione. Un recente lavoro di biologia sintetica ha sottolineato sistemi sintetici di multiplazione e ampliando il repertorio di ben caratterizzati, parti di DNA programmabili 16. Indipendente, espressione condizionale di geni bersaglio distinti richiede sia più induttori e DNA domini di legame che mancano sovrapposizione specificità. La disponibilità di recettori ingegneria e naturali fornisce un ampio insieme di pezzi con cui sviluppare nuovi fattori di trascrizione artificiale. Ampliare ilrepertorio di interruttori mutuamente ortogonali è stato notevolmente aiutato dalla evoluzione diretta approcci 17,18. Gli attuali sforzi per riprogrammare la specificità-ligando dei nostri fattori di trascrizione artificiali saranno presentati in futuro. In precedenza, le conseguenze fenotipiche del gene delezione / iperespressione sono stati ampiamente studiati in lievito 19,20. Tuttavia, non è stato semplice per studiare l&#39;effetto di espressione su diversi fenotipi su una gamma di livelli di espressione. Una caratteristica principale del sistema qui presentato è la sua natura graduata (Figura 8). Mentre spesso si pensa, il rapporto tra l&#39;espressione genica e fenotipi di interesse può non necessariamente essere monotona. Fattori di trascrizione artificiali come Z 3 EV e Z 4 EV farà il compito di saggiare le risposte fenotipiche ai cambiamenti nell&#39;espressione genica semplice. Infine, i protocolli discutonoed in questo manoscritto sono per ingegneria e caratterizzare fattori trascrizionali artificiali che rispondono a β-estradiolo, tuttavia, un&#39;importante alternativa ai domini chimicamente reattivo è l&#39;uso di domini luce-responsive (come il PhyB/Pif3, LOV, e BLUF), attività di cui sono reversibili senza dover turbare il mezzo di crescita della coltura 21-23. Sistemi basati su luce facilitano il controllo spazio-temporale dell&#39;espressione genica, le interazioni proteina-proteina, trasporto di ioni, e l&#39;attività enzimatica, che hanno già dimostrato potente 21-26. In conclusione, abbiamo presentato metodi per la costruzione rapida di inducibili, fattori di trascrizione artificiali in lievito. Questo protocollo fornisce un modello per la loro costruzione in congiunzione con i reporter GFP affini, nonché metodi per analizzare i dati giornalista citometria a flusso e saggiando l&#39;effetto dell&#39;attivazione ATF sulla crescita.

Sviluppare interruttori genetici nel lievito è di grande interesse per la ricerca sia accademica che industriale. Nel caso ideale, interruttori genetici possono essere utilizzati per attivare un gene particolare (o insieme di geni) solo quando desiderato dallo sperimentatore. Sequenza codificante di un gene posto a valle di un promotore sintetico non è espresso in assenza di una molecola che induce: su induttore Inoltre il gene deve essere espresso rapidamente. E &#39;stato solo recentemente dimostrato che tale interruttore può essere progettato in lievito, quando, in assenza di induttore, il ceppo mostra un fenotipo delezione, ma in presenza di induttore, espressione viene attivato in proporzione al livello di induttore in tutte le cellule 1,2. Storicamente, sistemi di espressione condizionali in lievito hanno fatto affidamento su di sequenze di DNA di nutrienti-sensibile, tra cui il MET, PHO, e promotori GAL (le cui attività sono sensibili ai livelli extracellulari di metionina, fosfato egalattosio, rispettivamente). Mentre espressione condizionale può essere realizzato, si tratta a costo di significativi effetti pleiotropici. Recettori ormonali come i recettori degli estrogeni umani hanno dimostrato di essere efficaci interruttori in eucarioti 3,4. In assenza di ormone, una proteina fusa ad un recettore ormonale può essere sequestrato nel citoplasma dove interagisce con il complesso chaperone Hsp90. In seguito al legame del ligando appropriato, il recettore subisce un cambiamento conformazionale, facendolo essere rilasciato dal complesso chaperone Hsp90 e rivelare un segnale di localizzazione nucleare. Per osservare le dinamiche di localizzazione di una particolare proteina-recettore contenente ormone, abbiamo creato una fusione C-terminale di Gal4dbd.ER.VP16 (GEV, un fattore di trascrizione sintetico contenente il dominio di legame al DNA Gal4p, il dominio di legame del ligando del recettore di estrogeno umano , e VP16) con GFP 2. Localizzazione nucleare è stata osservata entro 8 minuti in seguito all&#39;aggiunta disaturando quantità di induttore, ß-estradiolo, alla quale tipo selvatico lievito è completamente inerte. A questo punto, la maggior parte delle cellule hanno chiaramente visibili siti attivi per la trascrizione di geni bersaglio GEV (dosati mediante ibridazione in situ fluorescente) e mRNA completamente maturi 2,5. GEV geni bersaglio aumento nell&#39;espressione&gt; 2 volte entro 2,5 min 2,6 (misurata utilizzando microarrays), dimostrando che essa impiega &lt;2,5 min per l&#39;attivatore chimerico di traslocare al nucleo, legare il DNA, e attivare la trascrizione. Mentre molti altri on-switch sono stati applicati in lievito che utilizzano varie piccole molecole o farmaci (inclusi i classici interruttori a base di doxiciclina da Escherichia coli 7,8 e un interruttore a base di indaco-9 da Arabidopsis thaliana), nessuno ha raggiunto la velocità, specificità, o tensione di regolamentazione esibito da interruttori a base di ormoni. Vale la pena ricordare tcappello rapido off-switch sono stati anche sviluppati nel lievito, e in genere funziona fondendo un gene per una proteasi o ubiquitina ligasi di targeting sequenza 2,10,11,12. La possibilità di rimuovere rapidamente una proteina bersaglio dalla cella facilita lo studio di geni essenziali e geni che sono inclini a soppressione genetica quando soppresso 10. I metodi descritti in questo protocollo sono per la costruzione e la caratterizzazione sintetica-switch nel lievito. In primo luogo, mostriamo come generare rapidamente proteine ​​di fusione genomically integrati costituiti da un dominio di legame al DNA di interesse, il ligando dominio del recettore degli estrogeni umani vincolante, e VP16 (DBD-EV). Seguendo il nostro protocollo, la proteina di fusione è espressa da un promotore ACT1. Abbiamo poi mostreremo come creare un reporter plasmide affine per l&#39;ATF e testare la sua funzionalità mediante citometria a flusso. Sebbene prevediamo questi plasmidi reporter in uso con nuove ATF (Figura 1), si possono be utilizzati come reporter per un attivatore trascrizionale nativo pure. Infine, vengono forniti dettagli per testare l&#39;effetto dell&#39;attivazione ATF sulla crescita delle cellule in piastre da 96 pozzetti e per l&#39;ingegneria inducibili alleli genomiche.

<table border="0" cellpadding="0" cellspacing="0" width="352">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Name of the Reagent</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments&#160;</td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Expand High Fidelity PCR System</td>
			<td style="width:88px;">Roche</td>
			<td style="width:88px;">11 732 650 001</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">T4 DNA Ligase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0202S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Competent E. coli</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">18258-012</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Estradiol</td>
			<td style="width:88px;">Tocris Biosciences</td>
			<td style="width:88px;">2824</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Ampicillin</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">BP1760-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">T4 Polynucleotide Kinase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0201</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">PBS</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">10010-23</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">Tween-20</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">9005-64-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">clonNAT</td>
			<td style="width:88px;">Jena Bioscience</td>
			<td style="width:88px;">AB-102L</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">XbaI</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R0145S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">NotI-HF</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R3189S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">CutSmart Buffer</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">B7204S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Glucose</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">D15-500</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Bacto-Peptone</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">211677</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Yeast Extract</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">210929</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Agarose</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">214010</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">100% Ethanol</td>
			<td style="width:88px;">Decon Laboratories</td>
			<td style="width:88px;">04-355-222</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">G418</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">11811-031</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:88px;">QIAGEN</td>
			<td style="width:88px;">27104</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Lithium acetate dihydrate</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">L-6883</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Salmon sperm DNA</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">93283</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">PEG 3350</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">P-3640</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plasmids pMN8 and pMN10; yeast strain yMN15</td>
			<td style="width:88px;">Noyes or Botstein labs</td>
			<td style="width:88px;"></td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Luria Broth</td>
			<td>Sigma-Aldrich</td>
			<td>L3397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EQUIPMENT:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Material Name</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments (optional)</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">LSRII Flow Cyometer&#160;</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">Various Models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="103">
			<td height="103" style="height:103px;width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">Software for analyzing .FCS files from flow cytometry experiments</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">R</td>
			<td style="width:88px;">Open Source</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">For analyzing growth-rate data from plate reader.&#160;</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Falcon Tubes</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">352052</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="52">
			<td height="52" style="height:52px;width:88px;">1.7 ml Eppendorf&#160; Tubes</td>
			<td style="width:88px;">GeneMate</td>
			<td style="width:88px;">C3262-1</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">250 ml Shake Flasks</td>
			<td style="width:88px;">Corning</td>
			<td style="width:88px;">4446-250</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">96-well, flat-bottom plates</td>
			<td style="width:88px;">Costar</td>
			<td style="width:88px;">3635</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plate Reader (Synergy H1 Multi-Mode Plate Reader)</td>
			<td style="width:88px;">BioTek</td>
			<td style="width:88px;">H1MG</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Breathe-Easy Membranes</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">Z380059-1PAK</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Thermocycler</td>
			<td style="width:88px;">various companies</td>
			<td style="width:88px;">Various models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">SC-Ura powder</td>
			<td style="width:88px;">MP Biomedicals</td>
			<td style="width:88px;">114410622</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">5-FOA</td>
			<td style="width:88px;">Zymo Research</td>
			<td style="width:88px;">F9001-1</td>
			<td style="width:88px;"></td>
		</tr>
	</tbody>
</table>

rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters

Biologia sintetica mira a progettare e costruire razionalmente circuiti sintetici con proprietà quantitativi desiderati, nonché fornire strumenti che consentono di analizzare la struttura dei circuiti di controllo native. In entrambi i casi, la possibilità di programmare l&#39;espressione genica in maniera rapida e sintonizzabile, senza effetti off bersaglio, può essere utile. Abbiamo costruito ceppi di lievito contenenti il promotore ACT1 monte di una cassetta URA3 seguito dal dominio di legame del ligando del recettore di estrogeno umano e VP16. Trasformando questo ceppo con un prodotto di PCR lineare contenente un dominio di legame al DNA e selezionando contro la presenza di URA3, un fattore di trascrizione artificiale costitutivamente espresso (ATF) può essere generato mediante ricombinazione omologa. ATF ingegnerizzati in questo modo può attivare un gene bersaglio unico in presenza di induttore, eliminando in tal modo sia l&#39;attivazione off-target e condizioni di crescita non fisiologici trovati con Conditi comunemente usatosistemi di espressione genica onal. Viene inoltre fornito un metodo semplice per la costruzione rapida di plasmidi reporter GFP che rispondono specificamente a un fattore di trascrizione nativo o artificiale di interesse.

<html> Figura 5 mostra l&#39;induzione di GFP da Z 3 EV, Z 4 EV, o GEV nel tempo. Nota l&#39;aumento della produzione GFP in risposta alle ATF contenenti domini di legame al DNA nonyeast. Recentemente abbiamo ipotizzato che questo risulta da questi fattori raggiungono singolo gene specificità nel genoma di lievito 1. Induzione GEV sola porta all&#39;attivazione / repressione di centinaia di geni, mentre solo 3 EV Z e Z 4 EV attivare l&#39;espressione di un gene bersaglio posto a valle di un promotore sintetico contenente opportuni siti di legame (5&#39;-GCGTGGGCG-3 &#39;e 5&#39;- GCGGCGGAGGAG-3 &#39;, rispettivamente) 1. Figura 7 illustra la stretta regolazione del sistema (risultati induttore in alcun rilevabile GFP) e che tutte le cellule vengono indotti in risposta ad induttore La capacità di Z 3 EV per indurre GFP attraverso una gamma di concentrazioni di β-estradiolo è mostrata in Figura 8. <html> ent &quot;fo: keep-together.within-page =&quot; always &quot;&gt; <img alt="Figura 1" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig1highres.jpg" src="/files/ftp_upload/51153/51153fig1.jpg" /> Figura 1. Fattori trascrizionali artificiali interagiscono con Hsp90 in assenza di β-estradiolo. Quando β-estradiolo si lega al ATF, Hsp90 dissocia, permettendo la ATF per entrare nel nucleo e attivare l&#39;espressione dal plasmide reporter. <img alt="Figura 2" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig2highres.jpg" src="/files/ftp_upload/51153/51153fig2.jpg" /> Figura 2. Schema di protocollo per i ceppi di ingegneria che contengono fattori di trascrizione artificiali e costruzione / collaudo reporter GFP affini. load/51153/51153fig3highres.jpg &quot;src =&quot; / files/ftp_upload/51153/51153fig3.jpg &quot;/&gt; Figura 3. La sequenza ACT1pr-URA3-EV nel ceppo yMN15 al locus LEU2. <img alt="Figura 4" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig4highres.jpg" src="/files/ftp_upload/51153/51153fig4.jpg" /> Figura 4. Progettazione di primer PCR per amplificare un dominio di legame al DNA di interesse con ulteriori omologia di sequenza per generare una nuova proteina di fusione quando trasformato con successo in yMN15. <img alt="Figura 5" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig5highres.jpg" src="/files/ftp_upload/51153/51153fig5.jpg" /> Figura 5. Induzione GFP da tre diverse coppie ATF-promotore in risposta a 1 mM β-estradiolo. &lt;/ P&gt; <img alt="Figura 6" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig6highres.jpg" src="/files/ftp_upload/51153/51153fig6.jpg" /> Figura 6. Uno script MATLAB per il flusso di elaborazione citometria di dati. Questo script è stato adattato da <a href="http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data">http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data</a> . <img alt="Figura 7" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig7highres.jpg" src="/files/ftp_upload/51153/51153fig7.jpg" /> Figura 7. Induzione di GFP da Z 3 EV in risposta a 0 μ M β-estradiolo e 1 mM β-estradiolo seguente 18 ore di induzione. Fluorescenza era anche meaassicurata da cellule prive GFP per illustrare la stretta regolazione del sistema EV Z 3. Questa figura è stata generata utilizzando il codice nella Figura 6. <img alt="Figura 8" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig8highres.jpg" src="/files/ftp_upload/51153/51153fig8.jpg" /> Figura 8. Il rapporto tra la concentrazione di induttore e uscita espressione è classificato con un coefficiente di Hill ~ 1. (A) Distribuzione di espressione GFP in funzione della concentrazione di β-estradiolo. (B) La fluorescenza media delle distribuzioni da (A). I dati erano idonei per la funzione G (D) = G min + (G max-min G) D n / (n + K D n) dove D è la dose β-estradiolo, G e G min max sono minime e GFP valori massimi, resture rispettivamente, n è il coefficiente di Hill, e K è la dose β-estradiolo che produce ½ (G max + G min). <table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always" width="176"><tbody><tr><td> Oligonucleotide Sequence </td><td> Nome </td></tr><tr><td> 5&#39;-TTGAAACCA AACTCGCCTCT-3 &#39; </td><td> DBD Verifica Forward </td></tr><tr><td> 5&#39;-tccagagac ttcagggtgct-3 &#39; </td><td> DBD partner di Reverse </td></tr></tbody></table> Tabella 1. Primer per confermare corretta fusione DBD di interesse al Estrogen Receptor. Il primer forward è omologa promotore EFF1 e l&#39;innesco inverso è omologo al recettore estrogeno. Per DBDS tipici (~ 300 bp), il prodotto di PCR è &lt;1,5 kb. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Oligonucleotide Sequence </td><td> Nome </td></tr><tr><td> 5&#39;-ggccgc ... site abbuffate DBD ... t-3 &#39; </td><td> Top oligo </td></tr><tr><td> 5&#39;-ctaga ... DNA sito di legame inverso ... gc-3 &#39; </td><td> In basso oligo </td></tr><tr><td> 5&#39;-gcc gcGTGGGCG T GCGTGGGCG G G CGTGGGCG T GCGTGGGCG G GCGTG GGCG T GCGTGGGCG t-3 &#39; </td><td> Top oligo + 6x zif268 siti di legame </td></tr><tr><td> 5&#39;-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3 &#39; </td><td> In basso oligo + 6x zif268 siti di legame </td></tr></tbody></table> Tabella 2. S truttura di primer per la creazione di dsDNA contenenti siti di legame di interesse. Per creare la Z 3 EV-reattiva promotore, + 6x Zif268 rilegatura sono stati usati gli oligonucleotidi Top oligo + 6x zif268 siti di legame e inferiore oligo.Sequenze per creare le corrette sbalzi di DNA sono in minuscolo. Il sito di legame Zif268 consenso, GCGTGGGCG, viene sottolineato nella oligo superiore. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reagente </td><td> Importo </td></tr><tr><td> T4 polinucleotide Kinase Buffer </td><td> 5 microlitri </td></tr><tr><td> T4 polinucleotide chinasi (@ 10.000 unità / ml) </td><td> 1 ml </td></tr><tr><td> Top oligo (100 micron) </td><td> 1,5 microlitri </td></tr><tr><td> In basso oligo (100 micron) </td><td> 1,5 microlitri </td></tr><tr><td> Acqua </td><td> 41 microlitri </td></tr></tbody></table> Tabella 3. Fosforilare e primer ricottura in un termociclatore con 50 microlitri di reazione descritto sopra. Esistono due passi termociclatore. Passo 1: 37 ° C 30 min (fosforilare), e il passaggio 2: 95 ° C 30 sec (dimettersi 1 ° C ogni 30 sec fino a 4 ° C; Anneal). <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reagente </td><td> Importo </td></tr><tr><td> XbaI </td><td> 1 ml </td></tr><tr><td> NotI-HF </td><td> 1 ml </td></tr><tr><td> DNA plasmidico </td><td> 5 microlitri (1-2 mcg) </td></tr><tr><td> 10x taglio intelligente Buffer </td><td> 5 microlitri </td></tr><tr><td> Acqua </td><td> 38 microlitri </td></tr></tbody></table> Tabella 4. Limitazione digest di plasmide pMN8 con XbaI e NotI. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr height="22" style="height:16.5pt"><td class="xl65" height="22" style="height:16.5pt;width:66pt" width="88"> Reagente </td><td class="xl66" style="width:66pt" width="88"> Importo </td></tr><tr height="43" style="height:32.25pt"><td> T4 ligasi Buffer </td><td> 2 microlitri </td></tr><tr height="22" style="height:16.5pt"><td> T4 ligasi </td><td> 0.2 microlitri </td></tr><tr height="43" style="height:32.25pt"><td> Backbone @ 10 ng / ml </td><td> 1 ml </td></tr><tr height="106" style="height:79.5pt"><td> Legatura Sequenze @ 5x molare concentrazione / ml </td><td> 1 ml </td></tr><tr height="22" style="height:16.5pt"><td> Acqua </td><td> 15.8 ml </td></tr></tbody></table> Tabella 5. Legare i siti di legame nel plasmide DNA. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Primer </td><td> Descrizione </td></tr><tr><td> ~ 40 bp a monte della ATG + CGCACTTAACTTCGCATCTG-3 &#39; </td><td> Forward primer per amplificare KanMX-Promoter </td></tr><tr><td> 5&#39;-reverse complemento (ATG + ~ 37bp) + TATAGTTTTTTCTCCTTGACG-3 &#39; </td><td> Reverse primer per amplificare KanMX-Promoter </td></tr><tr><td> 5&#39;-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3 &#39; </td><td> Primer avanti per rendere promotore GCN4 swap. </td></tr><tr><td> 5&#39;-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3 &#39; </td><td> Primer reverse per fare promotore GCN4 swap. </td></tr></tbody></table> Tabella 6. PCR amplifica KanMX-Promoter per fare allele titratible.

Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Questo protocollo descrive una procedura sperimentale per la rapida costruzione di fattori di trascrizione artificiali (ATF) con i reporter GFP cognate e la quantificazione della capacità ATF di stimolare l&#39;espressione della GFP mediante citometria a flusso.

Sintesi rapida e screening dei fattori di trascrizione attivati ​​chimicamente con i giornalisti a base di GFP-

Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the ...

rapid-synthesis-screening-chemically-activated-transcription-factors

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

14.4K Views.  Princeton University.  Questo protocollo descrive una procedura sperimentale per la rapida costruzione di fattori di trascrizione artificiali (ATF) con i reporter GFP cognate e la quantificazione della capacità ATF di stimolare l'espressione della GFP mediante citometria a flusso. 

Video: Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Generation of Human CD40-activated B cells

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer immunotherapy 1-3. Compared to Dendritic cells (DCs), the best characterized APC, CD40-B cells have several distinct biological and technical properties. Similar to DCs, B cells show an increased expression of MHC and co-stimulatory molecules (Fig.1b), exhibit a strong migratory capacity and present antigen presentation efficiently to T cells, after stimulation with interleukin-4 and CD40 ligand (CD40L). However, in contrast to immature or mature DCs, CD40-B cells express the full lymph node homing triad consisting of CD62L, CCR7/CXCR4, and leukocyte function antigen-1 (LFA1, CD11a/CD18), necessary for homing to secondary lymphoid organs (Fig.1a) 3. CD40-B cells can be generated without difficulties from very small amounts of peripheral blood which can be further expanded in vitro to very large amounts of highly-pure CD40-B cells (&gt;109 cells per patient) from healthy donors as well as cancer patients (Fig.1c,d) 1,4. 
In this protocol we demonstrate how to obtain fully activated CD40-B cells from human PBMC. Key molecules for the cell culture are CD40 ligand, interleukin-4 (IL-4) and cyclosporin A (CsA), which are replenished in a 3-4 day culture cycle. For laboratory purposes CD40-stimulation is provided by NIH/3T3 cells expressing recombinant human CD40 ligand (tCD40L NIH/3T3) 5. To avoid contamination with non-transfected cells, expression of the human CD40 ligand on the transfectants has to be checked regularly (Fig.2). 
After 14 days CD40-B cell cultures consist of more than 95% pure B cells and an expansion of CD40-B cells over 65 days is frequently possible without any loss of function 1, 4. CD40-B cells efficiently take up, process and present antigens to T cells 6. They do not only prime na&#970;ve, but also expand memory T cells 7,8. CD40-activated B cells can be used to study B-cell activation, differentiation and function. Moreover, they represent a promising tool for therapeutic or preventive vaccination against tumors 9.

In this video we present the ex vivo generation and expansion of human CD40-activated B cells (CD40-B) from peripheral blood mononuclear cells (PBMC) by stimulation with CD40 ligand and interleukin-4.

Generazione di Human CD40 delle cellule B attivate

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

Ricerca

Biologia

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Fluorescenza separazione delle cellule attivate delle protoplasti impianto

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

High-throughput screening e biopercezione con fluorescente C. elegans Ceppi

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron (dgn)-destabilized Green Fluorescent Protein (GFP)-based Reporter Protein

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. Maintenance of proteasome activity was implicated in many key cellular processes, like cell's stress response 3, cell cycle regulation and cellular differentiation 4 or in immune system response 5. The dysfunction of the ubiquitin-proteasome system has been related to the development of tumors and neurodegenerative diseases 4, 6. Additionally, a decrease in proteasome activity was found as a feature of cellular senescence and organismal aging 7, 8, 9, 10. Here, we present a method to measure ubiquitin-proteasome activity in living cells using a GFP-dgn fusion protein. To be able to monitor ubiquitin-proteasome activity in living primary cells, complementary DNA constructs coding for a green fluorescent protein (GFP)&#x2013;dgn fusion protein (GFP&#x2013;dgn, unstable) and a variant carrying a frameshift mutation (GFP&#x2013;dgnFS, stable 11) are inserted in lentiviral expression vectors. We prefer this technique over traditional transfection techniques because it guarantees a very high transfection efficiency independent of the cell type or the age of the donor. The difference between fluorescence displayed by the GFP&#x2013;dgnFS (stable) protein and the destabilized protein (GFP-dgn) in the absence or presence of proteasome inhibitor can be used to estimate ubiquitin-proteasome activity in each particular cell strain. These differences can be monitored by epifluorescence microscopy or can be measured by flow cytometry.

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron dgn-destabilized Green Fluorescent Protein GFP-based Reporter Protein

A method to monitor ubiquitin-proteasome activity in living cells is described. A degron-destabilized GFP- (GFP-dgn) and a stable GFP-dgnFS fusion protein are generated and transduced into the cell using a lentiviral expression vector. This technique allows to generate a stable GFP-dgn/GFP-dgnFS expressing cell line in which ubiquitin-proteasome activity can be easily assessed using epifluorescence or flow cytometry.

Monitoraggio del sistema ubiquitina-proteasoma attività nelle cellule viventi Utilizzando una degron (dgn)-destabilizzato proteina verde fluorescente (GFP) a base di proteine ​​Reporter

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. ...

Synthesis of Nine-atom Deltahedral Zintl Ions of Germanium and their Functionalization with Organic Groups

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 Their redox chemistry is even younger, just about ten years old, but despite this short history these deltahedral clusters ions E9n- (E = Si, Ge, Sn, Pb; n = 2, 3, 4) have already shown interesting and diverse reactivity and have been at the forefront of rapidly developing and exciting new chemistry.3-6 Notable milestones are the oxidative coupling of Ge94- clusters to oligomers and infinite chains,7-19 their metallation,14-16,20-25 capping by transition-metal organometallic fragments,26-34 insertion of a transition-metal atom at the center of the cluster which is sometimes combined with capping and oligomerization,35-47 addition of main-group organometallic fragments as exo-bonded substituents,48-50 and functionalization with various organic residues by reactions with organic halides and alkynes.51-58 
This latter development of attaching organic fragments directly to the clusters has opened up a new field, namely organo-Zintl chemistry, that is potentially fertile for further synthetic explorations, and it is the step-by-step procedure for the synthesis of germanium-divinyl clusters described herein. The initial steps outline the synthesis of an intermetallic precursor of K4Ge9 from which the Ge94- clusters are extracted later in solution. This involves fused-silica glass blowing, arc-welding of niobium containers, and handling of highly air-sensitive materials in a glove box. The air-sensitive K4Ge9 is then dissolved in ethylenediamine in the box and then alkenylated by a reaction with Me3SiC&equiv;CSiMe3. The reaction is followed by electrospray mass spectrometry while the resulting solution is used for obtaining single crystals containing the functionalized clusters [H2C=CH-Ge9-CH=CH2]2-. For this purpose the solution is centrifuged, filtered, and carefully layered with a toluene solution of 18-crown-6. Left undisturbed for a few days, the so-layered solutions produced orange crystalline blocks of [K(18-crown-6)]2[Ge9(HCCH2)2]&bull;en which were characterized by single-crystal X-ray diffraction. 
The process highlights standard reaction techniques, work-up, and analysis towards functionalized deltahedral Zintl clusters. It is hoped that it will help towards further development and understanding of these compounds in the community at large.

We present the high-temperature synthesis of intermetallic precursors K4Ge9, their dissolution in ethylenediamine to form Ge94- deltahedral Zintl ions, and the reaction of the clusters with alkynes to form organo-Zintl ions. The latter are characterized by electrospray mass spectrometry in solutions and by single-crystal X-ray diffraction in the solid state.

Sintesi di Nine-atomo ioni Deltahedral Zintl del germanio e la loro funzionalizzazione con gruppi organici

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

Cromatina Analisi Interazioni con Tag Sequencing appaiati-End (Chia-PET) per la mappatura Interazioni cromatina e comprensione del regolamento Trascrizione

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by secreting metabolites. These metabolites have the potential to modulate the physiology and differentiation of their microbial neighbors and are likely important factors in the establishment and maintenance of complex microbial communities. We have developed a fluorescence-based coculture screen to identify such chemically mediated microbial interactions. The screen involves combining a fluorescent transcriptional reporter strain with environmental microbes on solid media and allowing the colonies to grow in coculture. The fluorescent transcriptional reporter is designed so that the chosen bacterial strain fluoresces when it is expressing a particular phenotype of interest (i.e. biofilm formation, sporulation, virulence factor production, etc.) Screening is performed under growth conditions where this phenotype is not expressed (and therefore the reporter strain is typically nonfluorescent). When an environmental microbe secretes a metabolite that activates this phenotype, it diffuses through the agar and activates the fluorescent reporter construct. This allows the inducing-metabolite-producing microbe to be detected: they are the nonfluorescent colonies most proximal to the fluorescent colonies. Thus, this screen allows the identification of environmental microbes that produce diffusible metabolites that activate a particular physiological response in a reporter strain. This publication discusses how to: a) select appropriate coculture screening conditions, b) prepare the reporter and environmental microbes for screening, c) perform the coculture screen, d) isolate putative inducing organisms, and e) confirm their activity in a secondary screen. We developed this method to screen for soil organisms that activate biofilm matrix-production in Bacillus subtilis; however, we also discuss considerations for applying this approach to other genetically tractable bacteria.

Bacteria produce secreted compounds that have the potential to affect the physiology of their microbial neighbors. Here we describe a coculture screen that allows detection of such chemically mediated interspecies interactions by mixing soil microbes with fluorescent transcriptional reporter strains of Bacillus subtilis on solid media.

Utilizzo di co-coltura per rilevare chimicamente mediata interspecie Interazioni

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

Rapido ed efficiente Zebrafish genotipizzazione Uso PCR con ad alta risoluzione Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Screening ad alto rendimento per i modulatori chimici di Genes post-trascrizionale regolamentati

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR)

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder ALLIGATOR

Genetically encoded luciferase is a popular non-invasive reporter of gene expression. Use of an automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) enables longitudinal recording from bioluminescent cells under a wide range of conditions. Here we show how ALLIGATOR may be used in the context of circadian rhythms research.

Misura flessibile dei reporter bioluminescenti utilizzando un automatizzato Luciferase longitudinale Imaging ottimizzato di Gas e temperatura registratore (ALLIGATOR)

Sintesi rapida e screening dei fattori di trascrizione attivati ​​chimicamente con i giornalisti a base di GFP-

Sintesi rapida e screening dei fattori di trascrizione attivati chimicamente con i giornalisti a base di GFP-