Name: isolating brown adipocytes from murine interscapular brown adipose tissue for gene and protein expression analysis
Uploaded: 2021-03-12T14:30:00
Description: Watch this Scientific Journal Video about Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis at JoVE.com

Z. Lin was supported by National Institutes of Health HL138454-01 and Masonic Medical Research Institute funds.

All mice were maintained in pathogen-free conditions, and all procedures were approved by Masonic Medical research Institutional Animal Care and Use Committee (IACUC). UCP1::Cre9 and Rosa 26tdTomato mice lines13 were reported previously. All mice were kept at room temperature with a 12 h light/dark cycle.
1. Preparing the Solutions and brown adipose tissue (BAT)
<ol>
	<li>Prepare digestion solution and separation solution in 15 mL ce...

<ol>
	<li>Zwick, R. K., Guerrero-Juarez, C. F., Horsley, V., Plikus, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anatomical,+physiological,+and+functional+diversity+of+adipose+tissue.">Anatomical, physiological, and functional diversity of adipose tissue.</a> Cell Metabolism. 27, 68-83 (2018).</li><li>Symonds, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue+growth+and+development.">Brown adipose tissue growth and development.</a> Scientifica. 2013, 305763 (2013).</li><li>Giralt, M., Villarroya, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=White,+brown,+beige/brite:+Different+adipose+cells+for+different+functions.">White, brown, beige/brite: Different adipose cells for different functions.</a> Endocrinology. 154, 2992-3000 (2013).</li><li>Cannon, B., Nedergaard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue:+function+and+physiological+significance.">Brown adipose tissue: function and physiological significance.</a> Physiological Reviews. 84, 277-359 (2004).</li><li>Cinti, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+adipose+organ.">The adipose organ.</a> Prostaglandins, Leukotrienes and Essential Fatty Acids. 73, 9-15 (2005).</li><li>Wu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beige+adipocytes+are+a+distinct+type+of+thermogenic+fat+cell+in+mouse+and+human.">Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human.</a> Cell. 150, 366-376 (2012).</li><li>Cypess, A. M., Kahn, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+fat+as+a+therapy+for+obesity+and+diabetes.">Brown fat as a therapy for obesity and diabetes.</a> Current Opinion in Endocrinology, Diabetes and Obesity. 17, 143-149 (2010).</li><li>Schoettl, T., Fischer, I. P., Ussar, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+adipose+tissue+in+development+and+metabolic+function.">Heterogeneity of adipose tissue in development and metabolic function.</a> Journal of Experimental Biology. 221, (2018).</li><li>Kong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRF4+is+a+key+thermogenic+transcriptional+partner+of+PGC-1&#945;.">IRF4 is a key thermogenic transcriptional partner of PGC-1&#945;.</a> Cell. 158, 69-83 (2014).</li><li>Lee, Y. H., Petkova, A. P., Konkar, A. A., Granneman, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+origins+of+cold-induced+brown+adipocytes+in+adult+mice.">Cellular origins of cold-induced brown adipocytes in adult mice.</a> The FASEB Journal. 29, 286-299 (2015).</li><li>Kim, W. -. S., Park, H. -. S., Sung, J. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pivotal+role+of+PDGF+and+its+receptor+isoforms+in+adipose-derived+stem+cells.">The pivotal role of PDGF and its receptor isoforms in adipose-derived stem cells.</a> Histology and Histopathology. 30 (7), 793-799 (2015).</li><li>Hagberg, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+of+mouse+and+human+adipocytes+for+the+analysis+of+browning+and+cellular+heterogeneity.">Flow cytometry of mouse and human adipocytes for the analysis of browning and cellular heterogeneity.</a> Cell Report. 24, 2746-2756 (2018).</li><li>Madisen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+and+high-throughput+Cre+reporting+and+characterization+system+for+the+whole+mouse+brain.">A robust and high-throughput Cre reporting and characterization system for the whole mouse brain.</a> Nature Neuroscience. 13, 133-140 (2010).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Analytical biochemistry. 150, 76-85 (1985).</li><li>Chey, S., Claus, C., Liebert, U. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+method+for+simultaneous+isolation+of+proteins+and+nucleic+acids.">Improved method for simultaneous isolation of proteins and nucleic acids.</a> Analytical Biochemistry. 411, 164-166 (2011).</li><li>Ford, T., Graham, J., Rickwood, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iodixanol:+A+nonionic+iso-osmotic+centrifugation+medium+for+the+formation+of+self-generated+gradients.">Iodixanol: A nonionic iso-osmotic centrifugation medium for the formation of self-generated gradients.</a> Analytical Biochemistry. 220, 360-366 (1994).</li><li>Kovacovicova, K., Vinciguerra, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+senescent+cells+by+iodixanol+(OptiPrep)+density+gradient-based+separation.">Isolation of senescent cells by iodixanol (OptiPrep) density gradient-based separation.</a> Cell Proliferation. 52, 12674 (2019).</li><li>Lock, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=versatile+manufacturing+of+recombinant+adeno-associated+viral+vectors+at+scale.">versatile manufacturing of recombinant adeno-associated viral vectors at scale.</a> Human Gene Therapy. 21, 1259-1271 (2010).</li><li>Marin, R. D., Crespo-Garcia, S., Wilson, A. M., Sapieha, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RELi+protocol:+Optimization+for+protein+extraction+from+white,+brown,+and+beige+adipose+tissues.">RELi protocol: Optimization for protein extraction from white, brown, and beige adipose tissues.</a> MethodsX. 6, 918-928 (2019).</li><li>Sonna, L. A., Fujita, J., Gaffin, S. L., Lilly, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invited+Review:+effects+of+heat+and+cold+stress+on+mammalian+gene+expression.">Invited Review: effects of heat and cold stress on mammalian gene expression.</a> Journal of Applied Physiology. 92, 1725-1742 (2002).</li><li>Gensch, N., Borchardt, T., Schneider, A., Riethmacher, D., Braun, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+autonomous+myogenic+cell+populations+revealed+by+ablation+of+Myf5-expressing+cells+during+mouse+embryogenesis.">Different autonomous myogenic cell populations revealed by ablation of Myf5-expressing cells during mouse embryogenesis.</a> Development. 135, 1597-1604 (2008).</li></ol>

In this study, a new method of isolating BAs for gene and protein expression analysis was developed.
In a published BAs isolation protocol, 3% BSA solution was used to enrich BAs12. Nevertheless, the enriched BAs achieved by this published protocol could not be directly used for protein expression analysis. This is because the concentrated BSA existing in the BAs solution interferes with following-up protein extraction. When the BAs enriched in the 3% BSA solution were ...

Both mice and humans have two types of adipose tissues: white adipose tissue (WAT) and brown adipose tissue (BAT)1. WAT stores energy in the form of triglycerides in white adipocytes, and the brown adipocytes (BAs) of BAT dissipate chemical energy as heat2. Based on their developmental origin, BAs are further categorized into classical BAs (cBAs) that formed during embryo development and white adipocytes derived BAs (beige/brite cells, converted from white adipocytes under stress conditions)3. BAs are multilocular and express the thermogenic protein uncoupling protein 1 (UCP1)4. Interscapular BAT (iBAT) depot is one of the primary cBAs depots in small mammals5, whereas beige cells are dispersed within WAT6. 
Due to their nature of dissipating energy, BAs have received much attention as a therapeutic target for reducing obesity7. To exploit BAs for the purpose of treating obesity, it is essential to understand the molecular mechanisms that control BAs function, survival, and recruitment. Adipose tissues including BAT and WAT are heterogeneous. Except for adipocytes, adipose tissues contain many other cell types, such as endothelial cells, mesenchymal stem cells and macrophages8. Although genetic tools to specifically deplete candidate genes in mice BAs are available, such as UCP1::Cre line9, techniques for purifying BAs from BAT or WAT are limited, making it hard to study BAs at a single-cell type level. Additionally, without obtaining pure BAs, the relationship between BAs and non-BAs will not be clearly delineated. For instance, platelet-derived growth factor receptor alpha (PDGFR&#945;) has been used as a marker for undifferentiated mesenchymal cells, and it is expressed in the endothelial and interstitial cells of BAT. In cold stressed BAT, PDGFR&#945; positive progenitor cells give rise to new BAs10. PDGFR&#945; is activated by its ligand PDGF, a growth factor that regulates the growth and proliferation of mesenchymal cells11; however, it is unclear whether BAs influence the behavior of PDGFR&#945; positive progenitor cells by secreting PDGF. 
Recently, a BAs isolation protocol has been published, which is based on fluorescence-activated cell sorting (FACS)12. In this protocol, 3% bovine serum albumin (BSA) solution was used to separate BAs from non-BAs, and the enriched BAs were further purified by FACS. The application of this protocol is limited by the requirement of FACS process, which relies on both equipment and FACS operation experiences. In this study, a new protocol for isolating BAs from BAT was developed. The BAs isolated by this protocol can be directly used for gene and protein expression studies. Furthermore, data from this study suggest that BAs are a major PDGF resource.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antigen</td>
			<td>Company</td>
			<td>Catalog</td>
			<td></td>
		</tr>
		<tr>
			<td>PPAR&#947;</td>
			<td>LSBio</td>
			<td>Ls-C368478</td>
			<td></td>
		</tr>
		<tr>
			<td>PDGFRa</td>
			<td>Santa Cruz</td>
			<td>sc-398206</td>
			<td></td>
		</tr>
		<tr>
			<td>UCP1</td>
			<td>R&#38;D system</td>
			<td>IC6158P</td>
			<td></td>
		</tr>
		<tr>
			<td>Chemical and solutions</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase, Type II</td>
			<td>Thermo Fisher Scientific</td>
			<td>17101015</td>
			<td></td>
		</tr>
		<tr>
			<td>1-Bromo-3-chloropropane</td>
			<td>Sigma-Aldrich</td>
			<td>B62404</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)&#160;</td>
			<td>Goldbio</td>
			<td>A-421-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium chloride</td>
			<td>Bio Basic</td>
			<td>CT1330</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>IBI Scientific</td>
			<td>IB05040</td>
			<td></td>
		</tr>
		<tr>
			<td>Dispase II, protease</td>
			<td>Sigma-Aldrich</td>
			<td>D5693</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Bio Basic</td>
			<td>EB0107</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>IBI Scientific</td>
			<td>IB15724</td>
			<td></td>
		</tr>
		<tr>
			<td>LiQuant Universal Green qPCR Master Mix</td>
			<td>LifeSct</td>
			<td>LS01131905Y</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium Chloride Hexahydrate</td>
			<td>Boston BioProducts</td>
			<td>P-855</td>
			<td></td>
		</tr>
		<tr>
			<td>OneScrip Plus cDNA Synthesis SuperMix</td>
			<td>ABM</td>
			<td>G454</td>
			<td></td>
		</tr>
		<tr>
			<td>OptiPrep (Iodixanol)</td>
			<td>Cosmo Bio USA</td>
			<td>AXS-1114542</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10x)</td>
			<td>Caisson Labs</td>
			<td>PBL07</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (1x)</td>
			<td>Caisson Labs</td>
			<td>PBL06</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce BCA Protein Assay Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>23227</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium Chloride</td>
			<td>Boston BioProducts</td>
			<td>P-1435</td>
			<td></td>
		</tr>
		<tr>
			<td>SimplyBlue safe Stain</td>
			<td>Invitrogen</td>
			<td>LC6060</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulfate (SDS)</td>
			<td>Sigma-Aldrich</td>
			<td>75746</td>
			<td></td>
		</tr>
		<tr>
			<td>Trizol reagent</td>
			<td>Life technoologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gene name (Species)&#160;</td>
			<td>Forward</td>
			<td>Reverse</td>
			<td></td>
		</tr>
		<tr>
			<td>Pdgfra (Mouse)</td>
			<td>CTCAGCTGTCTCCTCACAgG</td>
			<td>CAACGCATCTCAGAGAAAAGG</td>
			<td></td>
		</tr>
		<tr>
			<td>Pdgfa (Mouse)</td>
			<td>TGTGCCCATTCGCAGGAAGAG</td>
			<td>TTGGCCACCTTGACACTGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>36B4(Mouse)</td>
			<td>TGCTGAACATCTCCCCCTTCTC</td>
			<td colspan="2">TCTCCACAGACAATGCCAGGAC</td>
		</tr>
		<tr>
			<td>Ucp1</td>
			<td>ACTGCCACACCTCCAGTCATT</td>
			<td>CTTTGCCTCACTCAGGATTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Application</td>
			<td></td>
		</tr>
		<tr>
			<td>Keyence BZ-X700</td>
			<td>Keyence</td>
			<td colspan="2">Imaging brown adipocytes</td>
		</tr>
		<tr>
			<td>Magnetic stirrer</td>
			<td>VWR</td>
			<td>Dissociate BAT</td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio 6 Flex Real-Time PCR System</td>
			<td>Applied Biosystem</td>
			<td>Quantitative PCR</td>
			<td></td>
		</tr>
		<tr>
			<td>The Odyssey Fc Imaging system</td>
			<td>LI-COR</td>
			<td>Western blot immaging</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolating brown adipocytes from murine interscapular brown adipose tissue for gene and protein expression analysis

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs contain both multilocular lipid droplets and abundant mitochondria, and they express uncoupling protein 1 (UCP1). BAs are categorized into two sub-types based on their origin: embryo derived classical BAs (cBAs) and white adipocytes derived BAs. Due to their relatively low density, BAs cannot be isolated from BAT with traditional centrifugation method. In this study, a new method was developed to isolate BAs from mice for gene and protein expression analysis. In this protocol, interscapular BAT from adult mice was digested with Collagenase and Dispase solution, and the dissociated BAs were enriched with 6% iodixanol solution. Isolated BAs were then lysed with Trizol&#160;reagent for simultaneous isolation of RNA, DNA, and protein. After RNA isolation, the organic phase of the lysate was used for protein extraction. Our data showed that 6% iodixanol solution efficiently enriched BAs without interfering with follow-up gene and protein expression studies. Platelet-derived growth factor (PDGF) is a growth factor that regulates the growth and proliferation of mesenchymal cells. Compared to the brown adipose tissue, isolated BAs had significantly higher expression of Pdgfa. In summary, this new method provides a platform for studying the biology of brown adipocytes at a single cell-type level.

Preparation of interacapular BAT for brown adipocytes isolation 
The brown adipocytes (BAs) isolation process is depicted in Figure 1A. The whole process, from preparing BAT and digestion/separation solutions to obtaining isolated BAs will take around 4 h.
In adult mice, abundant BAT exists in the interscapular region. This interscapular BAT (iBAT) is covered by muscle layers and WAT (Figure 1B). Before starting ...

Watch this Scientific Journal Video about Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis at JoVE.com

Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis

This study describes a new method of isolating murine brown adipocytes for gene and protein expression analysis.

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs ...

To investigate the biology aspects of brown adipose tissue, it is essential to clear purified brown adipose size. Currently no came in brown adipose size purification and the masses are available. In this study, we developed a straightforward protocol to address this issue.Now, one skills are required for this protocol. It needs much fewer studying materials than other methods and the purified brown adipose size can be directly used for gene and protein expression analysis. This protocol provides a new method for studying the biology of classical brown adipose size.It can also be applied to study white adipocytes browning process. Demonstrating the procedure will be Amanda, a research assistant from my laboratory. Start by placing the flask with BAT and digestion solution on a magnetic stirrer at 60 rotations per minute in a 35 degree Celsius incubator for 30 minutes.Use a one milliliter pipette to disrupt the aggregated tissue clumps of BAT slices around the stirrer bar. After digestion, place a 70 micrometer strainer filter on top of a clean 50 milliliter centrifuge tube and pipette around four milliliters of cell suspension through the strainer. Then wash it with four milliliters of 12%iodixanol solution.Pipette up and down to mix the cells with iodixanol solution then transfer the cell mixture into two clear five milliliter polystyrene test tubes. Place the polystyrene tubes containing the cell mixture on ice for one hour, causing the BAs to form a layer on the top. Take out 20 microliters of the isolated BAs for microscope examination.For RNA and protein isolation, pipette the BA layer into two 1.7 milliliter microcenterfuge tubes. Then carefully remove the excessive iodixonal solution without disrupting the BA layer. Then add one milliliter of TRIzol into the cell solution to simultaneously isolate RNA, DNA, and protein and mix sufficiently to lyce the cells.To separate the phases, add 200 microliters of chloroform and centrifuge to the tube at 9, 981 G for 10 minutes at four degrees Celsius. After centrifugation, use the aqueous phase for RNA isolation. Transfer 300 microliters of the organic phase into a two milliliter microcentrifuge tube and add 750 microliters of 100%ethanol.After vortexing for 10 seconds, add 200 microliters of 1-Bromo-3-chloropropane and vortex again for 10 seconds. Add 600 microliters of double distilled water before vortexing for 10 seconds. Let the mixed solution stand for 10 minutes at room temperature.After centrifugation, add 9, 981 G for 10 minutes at four degrees Celsius. The phases will be separated with the protein phase localized in the middle layer. Remove the top aqueous solution and add one milliliter of 100%ethanol into the remaining solution.Following centrifugation at 9, 981 G for 10 minutes at four degrees Celsius, discard the supernatant and wash the pellet with one milliliter of 100%ethanol. Centrifuge at 9, 981 G for 10 minutes at four degrees Celsius. After removing the supernatant, air dry the pellet for 10 minutes at room temperature and measure the weight of the wet pellet.Add 1%SDS solution at a ratio of 20 microliters per milligram of pellet. Dissolve the pellet completely by putting the tube in a heated shaker at 55 degrees Celsius and 11 G for five to 10 minutes. In the protocol, PBS containing 3%BSA was used to separate BAs from BAT.The isolated cells were raspberry shaped with multilocular lipid droplets inside and were tdTom positive, confirming that they were BAs. Protein was isolated from the BAs with an improved GTPC protocol and was then examined with an SDS-PAGE gel. A dominant band associated with BSA was observed in the BA sample, suggesting its interference in protein extraction.To avoid BSA interference, a 6%iodixonal solution was used for the isolation of BAs, which had a typical raspberry shape and contained multilocular lipid droplets. Proteins extracted from these BAs were well separated in the SDS-PAGE gel. These cells were found to be tdTomato positive whereas cells recovered from the pellet were tdTomato negative with no obvious lipid droplets, suggesting efficient separation of the BAs from the non-fat cells.In gene expression analysis, the mRNA levels of UCP1 and PDGFA were significantly higher in the isolated BAs. But the mRNA of PDGFRA was only detected in BAT. UCP1 protein was found enriched in isolated BAs.EDGFR alpha was detected in BAT, but not in isolated BAs. These results confirm the efficiency of the method for isolating BAs and demonstrate that the isolated BAs are suitable for gene and protein expression studies. When attempting this protocol, use fresh digestion buffer to dissociate brown adipose tissue and avoid tissue clump formation during the digestion period.This new method makes it easy to investigate the biology of brown adipose tissue on a single cell tap level. By applying this method, one can perform GN and protein expression studies with pure brown adipocytes precisely dissecting brown adipocytes gene expression program, without worrying about contamination originally from nonfat cells.

Research

JoVE Journal

Immunology and Infection

Real-time Imaging of Leukotriene B4 Mediated Cell Migration and BLT1 Interactions with &beta;-arrestin

Real-time Imaging of Leukotriene B4 Mediated Cell Migration and BLT1 Interactions with &#946;-arrestin

G-protein coupled receptors (GPCRs) belong to the seven transmembrane protein family and mediate the transduction of extracellular signals to ...

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Differentiating Functional Roles of Gene Expression from Immune and Non-immune Cells in Mouse Colitis by Bone Marrow Transplantation

To understand the role of a gene in the development of colitis, we compared the responses of wild-type mice and gene-of-interest deficient knockout mice ...

Isolating And Immunostaining Lymphocytes and Dendritic Cells from Murine Peyer's Patches

Peyer's  patches (PPs) are integral components of the gut-associated lymphoid tissues  (GALT) and play a central role in intestinal immunosurveillance and ...

Isolation of Adipose Tissue Immune Cells

The discovery of increased macrophage infiltration in  the adipose tissue (AT) of obese rodents and humans has led to an  intensification of interest in ...

Isolation of Murine Peritoneal Macrophages to Carry Out Gene Expression Analysis Upon Toll-like Receptors Stimulation

During infection and inflammation, circulating monocytes leave the bloodstream and migrate into tissues, where they differentiate into macrophages. ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can ...

Isolating Lymphocytes from the Mouse Small Intestinal Immune System

The intestinal immune system plays an essential role in maintaining the barrier function of the gastrointestinal tract by generating tolerant responses to ...

Co-staining Blood Vessels and Nerve Fibers in Adipose Tissue

Recent studies have highlighted the critical role of angiogenesis and sympathetic innervation in adipose tissue remodeling during the development of ...