Name: generation of rna/dna hybrids in genomic dna by transformation using rna-containing oligonucleotides
Uploaded: 2010-11-24T18:00:00.000+00:00
Duration: 16 min 42 s
Description: Watch this Scientific Journal Video about Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides at JoVE.com

이 작품은 조지아 암 연합 부여 - R9028에 의해 지원되었다.

이론적 해석 80 mers에 써모 과학 Dharmacon oligos, 50의 사용을 악용, 여기 우리는 oligos는 대상 염색체 DNA와 어닐링 다음, 효모 세포의 게놈 DNA에 유전 정보를 전송할 수있는 유전자 보정 분석에 따라, 절차를 제시한다. oligos 타겟팅 성공이 예상 표현형을 표시 효모 식민지의 모양에 의해 채점됩니다. 원하는 유전자 조작이 oligo 순서에 통합 하나 이상의 ribonucleotides 이내에 실시하면, 유전 정보는 따라서 염색체 대상 DNA, 타겟팅 과정에서 염색체 수준에서 RNA / DNA 하이브리드 형태의 RNA 트랙트에서 직접 흐르고 있습니다. 써모 사이 언티픽 Dharmacon RNA 함유 oligo의 ribonucleotide / S는 DNA 복구 유전자 합성을 통해 대상에 대한 템플릿으로 제공하거나 DNA에 내장된 수 있으며, DNA 복제 중에 템플릿으로 제공하고 있습니다. 이 실험에서 우리는 효모 / Saccharomyces cerevisiae의 / 진핵세포 모델 시스템을 이용하지만, 이와 유사한 접근 방법은 다른 생물 또는 셀 유형에도 적용할 수 있습니다. 이 비디오에서는, 우리는 대상 효모 게놈의 로커스에 상동 설계 써모 과학 Dharmacon oligo를 사용하여 대상 유전자의 돌연변를 해결하기 위해 중간에 한 ribonucleotide를 포함. RNA 함유 oligo로 변환 후, 우리는 oligo의 RNA의 넓이는 염색체 DNA에 통합하여 DNA를 복제하는 동안 DNA 합성을위한 템플릿으로 사용할 수있다는 것을 나타냅니다 특정 주파수에서 대상 사이트의 수정을 관찰합니다. RNA 넓이 내에서 실행 유전 정보가 안정적으로 다음과 같은 셀 세대로 전송됩니다. 여기 우리는 염색체 DNA에 전송 RNA 정보를 감지하는 열 과학 Dharmacon RNA 함유 oligo와 방식으로 효모 세포 변화의 단계를 설명합니다. RNA 함유 Oligo의 A. 디자인이 실험에 사용된 우리는 효모에서 유전자 결함을 해결하기 위해 RNA 함유 oligo를 설계 S. trp5 로커스에서 cerevisiae 염색체 DNA. 프로토콜에 사용되는 효모 긴장은 두 기지 삭제 한 난센스 돌연변이 (그림 1A)와 돌연변이 trp5 유전자를 포함하고 있습니다. 이러한 효모 긴장은 트립토판 auxotrophic의 돌연변이이며 트립토판없이 미디어에 식민지를 형성하지 않습니다. TRP5 유전자의 DNA 시퀀스는 Saccharomyces 게놈 데이터베이스 (http://www.yeastgenome.org/)에서 사용할 수 있습니다. 이 프로토콜에서 사용되는 써모 과학 Dharmacon RNA 함유 oligo는 삭제 변이와 trp5 allele (그림 1A)의 넌센스 돌연변를 수정할 수 있도록 설계 한 ribonucleotide를 수정할 수 있도록 설계 2 기본 DNA의 삽입과 65 메르입니다. oligo의 순서는 다음과 같이 설계되었습니다 : 5&#39; - AAAAGGGTTTTGATGAAGCTGTCG - CG - GATCCCACATTCTG - RG - GAAGACTTCAAATCCTTGTATTCT. 이 oligo는 200 나노미터 규모 써모 과학 Dharmacon (라파예트, CO)에 의해 합성되며, desalted입니다 deprotected 및 페이지 정화없이 사용. 효모 변환을위한 RNA 함유 Oligo (Storici 외에서 수정되었습니다., 2007 1) B. 준비 <ol><li> oligo 튜브를 포함하여 실험, pipettes, 소용돌이, 랙, 실험 공간, 모든 것이 시작되기 전에 잠재적인 RNase 오염을 제거하는 RNase의 오염 제거 솔루션을 조사하여 착용 장갑에 사용됩니다 물질을 닦아주십시오. RNase없는 물, 화학 시약, 튜브 및 모든 단계에서 피펫 팁을 사용합니다. 본 실험의 모든 단계는 RNase 무료되어야합니다. </li><li> 써모 과학 Dharmacon RNA 함유 oligo는 회사에서 250 pmoles / RNase없는 물과 펠렛을 해산하기 위해 적극적으로 소용돌이와 함께 μl 재고 솔루션에받은 Resuspend. -80에서 보관 ° C. </li><li> 즉시 변환하기 전에, 얼음 RNA 함유 oligo를 해동 및 RNase없는 튜브에 RNase 무료 물로 50 pmoles / μl에 희석. 각각의 변환은 RNA 함유 oligos 1 nmole이 필요합니다. </li><li> oligos의 차 구조를 제거 2 분 100 ° C 열 블록에있는 RNA 함유 oligos의 선택 금액을 변성. </li><li> 즉시 변성 후 얼음에 튜브를 놓으십시오. 변환까지 얼음 계속. </li><li> 실험에 컨트롤로 해당 DNA는 전용 oligo가 사용됩니다. 이 oligo는 위에서 설명한 바와 같이, -20 ° C에서 해동하고 RNA 함유 oligo로 변환을위한 준비가되어 있습니다. </li></ol> RNA 함유 Oligo를 사용하여 효모 세포의 C. 변환 <ol><li> trp5 돌연변이 효모 세포와 풍부한 YPD 액체 배지의 5 ML의 예방 30 ° C 야간 (참조 자료)에서 성장. </li><li> YPD 액체 배지의 50 ML에 밤새 문화의 1.5 ML을 전송합니다. </li><li> 4h에 대해 30 ° C 쉐이크 (225 RPM)에 세포를 품어. </li><li> 해결 방법 1과 방법 2 IMM 준비ediately 전에 RNase없는 튜브의 변환 (자료 참조). </li><li> 50 ML RNase 무료 튜브 2 분 1천5백62그램에 해당하는 3,000 RPM,에서 스핀으로 세포 배양을 전송합니다. 세포 강수량의 펠렛은 약입니다. 0.3 cm 3. </li><li> 2 분 위해 3000 RPM의 RNase가없는 물, 스핀 50 ML로 뜨는 및 세척 세포를 제거합니다. </li><li> 최대한 매체에있는 수 배지와 RNases 없애 5 번 6 단계를 반복합니다. </li><li> 해결 방법 1과 2 분 3,000 rpm으로 회전 5 ML에 뜨는 및 resuspend 세포를 제거합니다. </li><li> 해결 방법 1 250 μl에 뜨는 및 resuspend 세포를 제거합니다. 세포의이 금액은 7-8 변환을 위해 충분합니다. </li><li> RNase 무료 microcentrifuge 튜브에 세포 현탁액의 나누어지는 50 μl는 20 μl를 추가 RNA 함유 oligo 작업 솔루션 (1 nmole) 또는 DNA 전용 oligo 작업 솔루션 (1 nmole) 또는 멸균 물의 20 μl 20 μl를 대조군에 대한 oligo와 함께. 다음 각 변환 반응에 대한 솔루션이 300 μl를 추가합니다. 변화의 과정에서 연어 정자 DNA를 추가할 필요가 항공사 자체로 oligos의 행위로, 없습니다. </li><li> 와동을 다해 구성 요소 homogenously 혼합합니다. </li><li> 30 ° C 통에 30 분 변환 반응을 품어. </li><li> 42 열충격 ° 15 분 C. </li><li> 4 분 2,236그램에 해당하는 5,000 RPM,에서 세포를 스핀 다운. </li><li> 멸균 물 100 μl에 뜨는 및 resuspend 세포를 제거합니다. </li><li> 이 세포 현탁액의 나누어지는를 타고 100000 접어 약을 사용하여 한 YPD 접시에 판 세포에 의해 멸균 물로 희석. 30 15 멸균 유리 구슬과 부화 ° 2 일 C. </li><li> 플레이트를 사용하여 약 트립토판 (SC - TRP)없이 합성 전체 고체 매체 중 하나를 페트리 접시에 각각의 변환 반응의 모든 resuspended 세포. 30 15 멸균 유리 구슬과 부화 ° 4~5일 (그림 2) C. </li></ol> RNA 함유 Oligo의 진 보정의 D. 분석 <ol><li> RNA 함유 oligo에 대한 유전자 보정 주파수를 계산하는 선택적 매체 (그림 2)뿐만 아니라 YPD 매체에 성장 식민지, DNA 전용 oligo 및 노 oligo 컨트롤에 대한 숫자를 세어보세요. 얻은 숫자를 비교합니다. 두베이스 삭제와 난센스 돌연변이와 trp5 대립 유전자의 자연 복귀 속도가 사용된 효모 변형에 10-9 이하이며, 따라서 우리는 oligos이 전지에 추가되지 않습니다 선택적 매체에는 식민지 형성을 기대하지 않습니다. </li><li> 몇 밖으로 줄무늬가 임의로 하나의 콜로니 격리를 얻을 YPD 중간에 transformant의 식민지를 골랐어요. 식민지의 성장 이틀 동안 잠깐, 다음 몇 가지 (적어도 5) 하나의 식민지를 가지고 YPD과 선택적 매체에 패치를 확인하십시오. </li><li> 식민지 PCR (그림 1B)에 의해 RNA 함유 oligo 대상 지역 (250-1,000 BP)를 증폭하기 위해 primers 한 쌍의을 디자인합니다. (Storici 및 레즈닉에서 수정, 2006 2) 다음과 같이 식민지 PCR을위한 절차입니다. <ol><li> Resuspend 전지는 (약 1 mm3) 물 50 μl의 개별 패치의 품을 lyticase 1 단위를 추가합니다. 100 열 블록에서 부화 다음 10 분, 각하 용액에 세포가 게놈 DNA를 릴리스 휴식 5 분 C.위한 상온에서 알을 품다 </li><li> PCR 조건 : PCR 반응은 세포 resuspension 솔루션 10 μl를 포함, 50 pmoles 순방향 및 역방향 primers 각각 10 MM dNTPs, DNA 형성 촉매 효소 1 단위, 10X 버퍼와 5 μl 1 μl가로 멸균 물을 조정됩니다 50 μl의 최종 볼륨. 95 30 S 30 사이클 ° C, 55 30의 ° C, 72시 1 분 ° C,, 72 7 분 최종 연장 시간 ° C; 다음 샘플 PCR 프로그램은 95 ° C에서 3 분, 4 보관 ° C. 1 분 / 킬로바이트의 연장 시간이 반응에 대한 추정되고있다. </li><li> PCR 후, 샘플은 PCR 제품의 관찰을 위해 1 % 또는 2 % (PCR 제품의 예상 크기에 따라) 아가로 오스 겔 (그림 3)에서 실행됩니다. </li></ol></li><li> RNA 함유 oligo로 전송 유전 정보가 효모 게놈 대상 지역에 새로운 제한 사이트 (그림 1B)를 생성하는 경우, 그것은 적절한 제한 효소로 PCR 제품을 소화하여 정보의 정확한 전달을 확인 할 수 있습니다. 아무런 제한 사이트가 RNA 함유 oligo에 의해 생성되지 않으면 6 단계로 이동합니다. 특정 제한 효소를 사용하여 다이제스트 PCR 제품. 소화 반응 6 제한 효소의 μl PCR 제품, 버퍼, BSA (일부 효소 위해 사용되는 효소에 대한 지침을 참조하십시오 필요하지 않을 수 있습니다), 0.5 μl, 15 μl로 멸균 물이 포함되어 있습니다. 샘플 사용 효소의 특정 온도에서 1 H에 대한 incubated 수 있습니다. </li><li> 유전자 조작 식물을 관찰하기 위해 2 % 아가로 오스 겔의 같은 행에 소화 샘플과 함께 소화되지 않은 샘플을 실행 B가 양도RNA 함유 oligo의 Y RNA 트랙트 (그림 3). </li><li> PCR 정화 키트를 사용하여 PCR 제품 정화 및 DNA의 시퀀싱을 위해 그들을 준비합니다. 제품을 증폭하는 데 사용되는 동일한 primers와 시퀀싱을 위해 샘플을 제출한다. </li><li> 선택한 참조 시퀀스 (그림 4) 여러 시퀀스의 정렬을 허용 소프트웨어를 사용하여 DNA의 시퀀싱 결과를 분석. </li></ol> RNA 함유 oligo의 E. 알칼리 치료 (그림 5) <ol><li> 각 반응 들어, 1.5 ML 튜브에 RNA 함유 oligo, 또는 DNA - oligo 1 nmole을 (250 pmoles / μl 재고 솔루션 4 μl)을 추가합니다. </li><li> 가수 분해 1 M NaOH 4 μl를 추가하거나, 또는 한 H.위한 대조군으로 4 μl H 2 O를 추가하고, 물 목욕 65 ° C에서 알을 품다 그런 다음 물을 욕조에서 얼음로 이동합니다. </li><li> 1.2 M HCL, H 2 O 1 M 트리스 - HCL, 4 μl 4 μl, 또는 또는 H 2 O 6 μl와 부정적인 제어를위한 1 M 트리스 - HCL 4 μl 2 μl와 중화. 변환까지 얼음 계속. </li></ol><img src="/files/ftp_upload/2152/2152fig1.jpg" alt="그림 1" /> 그림 1. 결함 trp5 유전자 및 RNA 함유 oligo에 의해 수정 TRP5 allele의 개략도 그림.) ​​trp5 돌연변이 유전자는 2베이스 삭제 (검은색 삼각형)과 1 기본 난센스 돌연변이 (별표)가 포함되어 있습니다. 단일 가닥 RNA 함유 2 - 기본 삽입 (블루 루프)와 Van91 I 제한 효소 사이트를 (괄호로 표시) 생성 1 RNA베이스 대체 (빨간색 사각형)와 oligo은 유전자 결함을 수정하는 효모 세포로 변화됩니다 trp5 유전자니다. TRP5 유전자가 RNA 함유 oligo (수정 기지가 파란색 사각형으로 표시됩니다)에 의해 수리 후 B), Van91 I 사이트는 TRP5 유전자로 생성됩니다. TRP5 유전자에 하나의 Van91 I 제한 사이트를 포함한 278 BP의 조각을 PCR primers는 한 쌍의 (P1 및 P2)에 의해 증폭됩니다. Van91하여 P1과 P2 PCR 제품의 소화 후 생성된 177 BP 101 BP 조각은 I도 표시됩니다. <img src="/files/ftp_upload/2152/2152fig2.jpg" alt="그림 2" /> 그림 2. RNA 함유 oligo와 변환 결과가.) 아니오 oligo와 변형 효모 세포 SC - TRP 매체에 대한 식민지를 형성하지 않습니다, 접시 AB를 참조하십시오. B) 세포 후에 SC - TRP에 성장 플레이트 CG보기 효모 식민지는 RNA 함유 oligo 1 nmole로 변환됩니다. C) 전지 이후 SC - TRP에 성장 플레이트 HL보기 효모 식민지는 해당 DNA 전용 제어 oligo 1 nmole로 변환됩니다. <img src="/files/ftp_upload/2152/2152fig3.jpg" alt="그림 3" /> 그림 3. 에서 유전 정보 전달의 검색 RNA 함유 대상 게놈 지역. P1과 P2로 증폭하고 Van91 I 제한 효소로 소화 PCR 시료의 2 % 아가로 오스 겔 전기 영동을 증폭 PCR 제품의 제한 소화에 의해 효모 염색체 DNA에 oligo합니다. 레인스 1, 8, 15, 100 사이즈, 200, 300, 400, 500 BP와 함께 DNA의 사다리는 왼쪽에 표시, 차선 2 trp5 돌연변이 변종의 게놈 DNA의 증폭 trp5 로커스의 PCR 제품, 레인 3, PCR 제품이 DNA 전용 oligo의 대상이 TRP + 식민지에서 파생된 게놈 DNA의 증폭, 차선 9-14, Van91 I 제한 소화, 차선 4-7, PCR 제품은 RNA 함유 oligo의 대상이 TRP + 식민지에서 파생된 게놈 DNA의 증폭 레인스 2-7에서 PCR 제품. 레인스 10-14에서 포경 PCR 제품 밴드의 존재는 TRP5 로커스 (CCACATTCTGG)에서 Van91 I에 의해 부분적인 소화에 의해 설명하실 수 있습니다. Van91 I (CCANNNN NTGG)에 대한 절단 사이트에서 여러 시퀀스를 수있다는 것을 고려하면, TRP5에서 생성된 사이트는 효소에 가장 최적의 표적이 될 수 없습니다. 사실, 위의 모든 PCR 제품의 시퀀싱 다음 DNA 우리는 (그림 4 참조) oligos에서 벌이는 이외 추가 변경 사항을 감지하지 않습니다. Van91에서 P1과 P2의 primers와 소화 제품 밴드에 의해 증폭된 278 BP PCR 밴드는 177 BP 101 BP의 전 오른쪽에있는 화살표에 의해 표시됩니다. <img src="/files/ftp_upload/2152/2152fig4tmb.jpg" border="0" alt="그림 4Thumb" /> 그림 4. RNA 함유 oligo의 유전자 교정을 보여주는 DNA 시퀀싱 결과. 게놈 영역의) DNA의 electropherogram는 RNA 함유 oligo 대상. DNA 순서 (박스 파란색)에서 G는 RNA 함유 oligo에 RG에서 유래. 또한 박스 CG 기지의 삽입입니다. 다른 모든 PCR 제품의 시퀀싱 결과가 아니라 배경 위에 형광 신호, 이것도 같이해도 좋다. TRP + transfo의 TRP5 지역의 B) 시퀀스DNA 전용 oligo (T1)와 RNA 함유 oligo (T2 - T5) 상단에있는 합의의 순서와 일치하고 대상 rmants는 (게놈 DNA, 빨간색 oligos 타겟팅 전에 trp5 돌연변이 세포의와 비교됩니다 음영). 수리 RNA 함유 바닥에 oligo하는 두 기본 DNA 삽입 한베이스 (G) 빨간색으로 표시된 RNA의 치환을하고 있습니다. 노란 그늘 쇼와 함께 파란색으로 박스 영역 것을 RNA 함유 oligo뿐만 아니라이 DNA 전용 oligo이 정확하게 삭제 변이와 모든 테스트 샘플의 난센스 돌연변을 수정. 점선 라인은 RNA 함유 oligo 순서의 위치를​​ 표시합니다. 하시기 바랍니다 <a href="https://www.jove.com/files/ftp_upload/2152/2152fig4.jpg">여기를 클릭</a> 그림 4의 더 큰 버전을 볼 수 있습니다. <img src="/files/ftp_upload/2152/2152fig5.jpg" alt="그림 5" /> 그림 5. 알칼리 치료 RNA 함유 oligo의 유전자 수정을 방지합니다. RNA 함유 oligo (R)에 의해 변환 주파수는 빨간색 막대와 DNA 전용 oligo (D)의 파란색 막대에 표시되는 것을 볼 수 있습니다. 오차 막대는 각 oligo 3 독립적인 변환을위한 의미의 표준 오류를 나타냅니다. DNA 전용 oligo가없이 NaOH 처리와 유사한 변환 주파수를 표시합니다. 다르게, RNA 함유 oligo로 변환 주파수 NaOH는 0 아래의 치료 방울. 따라서 RNA 함유 oligo있는 준비가 DNA 전용 oligo와 오염되지이며, 따라서 관찰 변환 주파수는 RNA 함유 oligo에만 적용됩니다.

<ol>
	<li>Storici, F., Bebenek, K., Kunkel, T. A., Gordenin, D. A., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-templated+DNA+repair.">RNA-templated DNA repair.</a> Nature. 447, 338-3341 (2007).</li><li>Storici, F., Resnick, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+delitto+perfetto+approach+to+in+vivo+site-directed+mutagenesis+and+chromosome+rearrangements+with+synthetic+oligonucleotides+in+yeast.">The delitto perfetto approach to in vivo site-directed mutagenesis and chromosome rearrangements with synthetic oligonucleotides in yeast.</a> Methods Enzymol. 409, 329-345 (2006).</li><li>Storici, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-mediated+DNA+modifications+and+RNA-templated+DNA+repair.">RNA-mediated DNA modifications and RNA-templated DNA repair.</a> Curr Opin Mol Ther. 10, 224-230 (2008).</li><li>Cerritelli, S. M., Crouch, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribonuclease+H:+the+enzymes+in+eukaryotes.">Ribonuclease H: the enzymes in eukaryotes.</a> FEBS J. 276, 1494-1505 (2009).</li></ol>

이 기사에 대한 비디오 제작이 간행물에 사용되는 시약 및 악기를 생산 써모 피셔 사이 언티픽에 의해 후원되었다.

RNA는 세포의 게놈 DNA에 직접 유전 정보를 전송할 수있다는 사실은 합성 RNA 함유 oligos의 사용 (Dharmacon 합성 oligos 1) 악용 발견되었습니다. 그것은 세포가 DNA 합성을위한 템플릿으로 RNA 함유 분자 또는 RNA 전용 시퀀스를 사용할 수있는 원리의 증거했습니다. 의 사용 RNA 함유만이 유전 정보가 반대 베꼈는데 DNA 사본 중간의 필요없이 게놈 DNA와 RNA에서 직접 전송할 수있다는 시위에 주도하지 oligos을뿐만 아니라 RNA가에 동종 템플릿으로 사용할 수있는 증거가 DNA 손상 1,3의 복구합니다. 우리가 여기에 표시 예제에서와 같이 oligos는 RNA 전용으로 만들어진 또는 DNA 순서에 포함된 단 하나 ribonucleotide를 포함할 수 있습니다. RNA 함유 oligo는 게놈 결함 trp5 allele의 넌센스 돌연변를 수정할 수 있도록 설계 한 임베디드 ribonucleotide 있습니다. ribonucleotide에서 게놈 DNA에 유전 정보의 전달은 목표 세포의 표현형 변화 (세포는 트립토판 부족한 매체에 재배)에 의해 드러났습니다. RNA 함유 oligo로 얻은 유전자 교정의 주파수는 측정 및 제어 DNA 전용 oligo의와 비교됩니다. 우리는 다양한 효모 유전자를 변형되기 다른 셀 배경,이 유전자 보정 분석을 수행함으로써, 우리는 요인 / S는 특히 RNA 함유 oligos 타겟팅에 영향을 미칠 어떤 감지할 수 있습니다. 따라서, 우리는 세포가 RNA / DNA 하이브리드의 안정성을 조절하는 방법 메커니즘을 밝힐 수 있습니다. 단순히 RNA 함유 oligos의 다른 변종을 설계함으로써 우리는 DNA 수정의 템플릿 역할을하는 특정 RNA의 넓이에 대한 가능성을 확인할 수 있습니다 우리는 DNA에 삽입하는 특정 RNA 시퀀스의 안정성을 확인할 수 있습니다. 또한, 우리는 희망이 RNA / DNA의 하이브리드와 상호 작용 요소에 대한 생체내 기판에 무엇입니까 확인할 수 있습니다. 주로 짧은 활용, 체외 연구에서 여러 RNA를 포함 oligos는 물론 RNases H의 생체내 기능에 같은 RNase H 효소 4와 같은, DNA와 하이브리드의 RNA를 인식할 수 요소의 기능을 특성화하기 위해 실시되었습니다 동안 RNA / DNA 하이브리드 안정성이 대부분 알 수없는 상태에 영향을 미칠 수있는 다른 단백질의 ID로. 활용 가능성 RNA 함유 큰 길이 (50 80 mers)와 최적의 품질 oligos하면 (예 : 써모 과학 Dharmacon RNA 함유 oligos 등) 직접의 생체내의 분자 프로세스의 다양한 검사하는 방법을 연 관심 세포. 으로 사용하여이 비디오, 변화에 표시된 RNA를 포함하는 것은 본질적으로 oligos RNases의 저하를 방지하기 위해, DNA 분자를 사용하여 변환에 비해 몇 가지 추가 단계가 필요합니다. 따라서, RNA 함유 oligos 것은 효모 시스템에 제한하지만,하지를 사용하여 변환은 DNA oligos에 의해 변화가 능숙하게되는 유기체 또는 세포 유형에 적용할 수 있습니다. 결론에 의해 세포를 대상으로 RNA하면 함유 oligos하는 것은 세포의 생체내의 DNA에 포함된 RNA / DNA 하이브리드 및 ribonucleotides를 생성할 수있는 기회를 제공합니다. 생체내의 안정성, 기능 및 이들의 결과는 RNA를 생성 / DNA의 하이브리드는 잠재적으로 DNA 수리의 알려지지 않은 메커니즘을 잠복하고 타겟 유전자에 대한 새로운 전략을 공개, 분석 및 특징 수 있습니다.

A. 변환 시약 및 미디어 (Storici 및 레즈닉에서 수정, 2006 <ol><li> YPD (효모 펩톤 덱스 트로 오스) 1 L의 경우, 10g의 효모 추출물, 펩톤 20g 간장, 20g 덱스 트로 오스. YPD 고체 미디어를 만들기 위해 15g의 한천을 추가합니다. 사용하기 전에 압력솥. 상온에서 보관하십시오. </li><li> 해결 방법 1 : 리튬 아세테이트의 0.1 M. 변환하기 전에 바로 준비하세요. 솔루션 1 작업 솔루션입니다, 따라서 그것은 분말에서 직접 준비가되어 있습니다. 아무 주식 솔루션은 만들어 없습니다. 실온에서 보관. LiAc는 DNA에 효모 세포 벽의 투과성을 증가시킵니다. </li><li> 해결 방법 2 : 리튬 아세테이트의 0.1 M 및 폴리에틸렌 글리콜 4000의 50 %. 또한 솔루션 2 작업 솔루션이며 직접 분말로 만든 것입니다. 아무 주식 솔루션은 준비되지 않습니다. 실온에서 보관. PEG 예금은 효모 세포에 oligos. </li><li> RNA 함유 oligos (써모 과학 Dharmacon), 50 80 mers, desalted, deprotected이 아닌 정화. 250 pmoles / μl로 Resuspend. -80에서 보관 ° C. </li><li> desalted이 아닌 정화 DNA 전용 oligos, 50 80 mers. 50 pmoles / μl로 Resuspend. -20 ° C.에 저장 </li><li> SC - TRP (합성 전체 미디어 트립토판 부족) 고체 미디어. </li><li> autoclaving 소독 0.5 cm 직경의 유리 비즈. </li><li> RNase - 해제 : RNase의 오염 제거 솔루션입니다. </li><li> DNase / RNase 무료, 멸균 원심 분리기 튜브. </li><li> DNase / RNase 무료, 멸균 원뿔 튜브. </li><li> 기력과 DNase / RNase 무료, 살균 에어로졸의 피펫 팁 : 100-200 ML, 100-1000 ML. </li></ol> B. 콜로니 PCR 자료. <ol><li> desalted 및 비 정화의 DNA primers. 50 pmoles / μl로 살균 물에 용해. -20 ° C.에 저장 </li><li> DNA 형성 촉매의 DNA 중합 효소, 버퍼, dNTPs. </li><li> PCR 튜브. </li></ol> C. PCR 정화. <ol><li> PCR 정화 키트. </li></ol> D. 젤 전기 영동. <ol><li> 아가로 오스. </li><li> 1 X TBE 실행 버퍼 (45 MM 트리스 - borate 및 1 ㎜의 에틸렌의 tetraacetate)는 10X TBE에서 희석. </li><li> Prestained 분자량 마커. </li><li> DNA 로딩 색소. </li></ol> E. 제한 소화. <ol><li> 제한 효소, 10X 버퍼, BSA. </li></ol> RNA 함유 oligo에 대한 알칼리 치료 F.. <ol><li> NaOH 용액의 1 M. </li><li> HCL 솔루션 1.2 M. </li><li> 트리스 - HCL 1 M, pH를 7.4 솔루션입니다. </li></ol>

generation of rna/dna hybrids in genomic dna by transformation using rna-containing oligonucleotides

합성 짧은 핵산 중합체 oligonucleotides (oligos)은 분자 생물학의 가장 기능과 광범위한 도구입니다. Oligos 어떤 원하는 DNA 또는 RNA의 시퀀스를 포함하는 생산 수 있으며, 기본, 설탕 수정의 다양한 포함 준비하실 수 있습니다. 또한, oligos는 특정 핵산 변경을 모방하고 있으므로, DNA 손상과 수리 메커니즘의 영향을 조사하는 것이 중요 도구로 검색할 수 있습니다 설계할 수 있습니다. 우리는 발견 써모 사이 언티픽 Dharmacon RNA 함유 50 80 세포핵 사이의 길이 oligos하는 생체내, 기능 및 염색체 RNA / DNA의 하이브리드의 결과와 DNA에 포함 ribonucleotides의 연구에 특히 적합합니다. RNA / DNA 하이브리드는 쉽게 아주 작은 세포와 이들 하이브리드는 세포의 유전자 무결성에 영향을 미칠 수있는 범위 내에서 RNA / DNA 하이브리드의 안정성에 대한 알려져있다 그러나, DNA 복제, 수리 및 녹음 중에 형성될 수 있기 때문이다. RNA 함유 oligos 따라서 염색체 DNA에 ribonucleotides을 소개하고 선택한 길이와 기본 구성의 RNA / DNA 하이브리드를 생성하는 완벽한 벡터를 나타냅니다. 여기서 우리는 진핵세포 모델 시스템 효모 / Saccharomyces cerevisiae의 /의 게놈에 ribonucleotides의 설립을위한 프로토콜을 제시한다. 그러나, 우리 실험실 활용이 써모 사이 언티픽 Dharmacon RNA 함유 oligos는 박테리아에서 인간의 세포로, 다른 전지 시스템의 염색체 수준에서 RNA / DNA 하이브리드를 생성합니다.

Watch this Scientific Journal Video about Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides at JoVE.com

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

이 작품은 염색체 수준에서 RNA / DNA 복합체를 형성하고 효모 세포의 게놈 DNA와 RNA의 유전 정보의 전송을 공개하는 방법을 보여줍니다.

RNA 함유 Oligonucleotides를 사용하여 변환하여 게놈 DNA에서 RNA / DNA 하이브리드의 생성

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

generation-rnadna-hybrids-genomic-dna-transformation-using-rna

Research

JoVE Journal

Biology

26.8K 조회수.  Georgia Institute of Technology. 이 작품은 염색체 수준에서 RNA / DNA 복합체를 형성하고 효모 세포의 게놈 DNA와 RNA의 유전 정보의 전송을 공개하는 방법을 보여줍니다.

비디오: Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

점 돌연변이 수리 CRISPR/Cas9 및 SsODN 인간 세포에 의해 촉매의 기능으로 현지 변이 검사 하는 표준 방법론

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

연구

유전학

DNA Vector-based RNA Interference to Study Gene Function in Cancer

RNA interference (RNAi) inhibits gene expression by specifically degrading target mRNAs. Since the discovery of double-stranded small interference RNA (siRNA) in gene silencing1, RNAi has become a powerful research tool in gene function studies. Compared to genetic deletion, RNAi-mediated gene silencing possesses many advantages, such as the ease with which it is carried out and its suitability to most cell lines. Multiple studies have demonstrated the applications of RNAi technology in cancer research. In particular, the development of the DNA vector-based technology to produce small hairpin RNA (shRNA) driven by the U6 or H1 promoter has made long term and inducible gene silencing possible2,3. Its use in combination with genetically engineered viral vectors, such as lentivirus, facilitates high efficiencies of shRNA delivery and/or integration into genomic DNA for stable shRNA expression. 
We describe a detailed procedure using the DNA vector-based RNAi technology to determine gene function, including construction of lentiviral vectors expressing shRNA, lentivirus production and cell infection, and functional studies using a mouse xenograft model. 
Various strategies have been reported in generating shRNA constructs. The protocol described here employing PCR amplification and a 3-fragment ligation can be used to directly and efficiently generate shRNA-containing lentiviral constructs without leaving any extra nucleotide adjacent to a shRNA coding sequence. Since the shRNA-expression cassettes created by this strategy can be cut out by restriction enzymes, they can be easily moved to other vectors with different fluorescent or antibiotic markers. Most commercial transfection reagents can be used in lentivirus production. However, in this report, we provide an economic method using calcium phosphate precipitation that can achieve over 90% transfection efficiency in 293T cells. Compared to constitutive shRNA expression vectors, an inducible shRNA system is particularly suitable to knocking down a gene essential to cell proliferation. We demonstrate the gene silencing of Yin Yang 1 (YY1), a potential oncogene in breast cancer4,5, by a Tet-On inducible shRNA system and its effects on tumor formation. Research using lentivirus requires review and approval of a biosafety protocol by the Biosafety Committee of a researcher's institution. Research using animal models requires review and approval of an animal protocol by the Animal Care and Use Committee (ACUC) of a researcher's institution.

RNA interference (RNAi) possesses many advantages over gene knockout and has been broadly used as a tool in gene functional studies. The invention of DNA vector-based RNAi technology has made long term and inducible gene knockdown possible, and also increased the feasibility of gene silencing in vivo.

암 관련 유전자 기능을 연구하기 DNA를 벡터 기반의 RNA 간섭

RNA interference (RNAi) inhibits gene expression by specifically degrading target mRNAs. Since the discovery of double-stranded small interference RNA ...

의학

Single-step Purification of Macromolecular Complexes Using RNA Attached to Biotin and a Photo-cleavable Linker

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial purification of biologically important RNA/protein complexes. However, this strategy suffers from one major disadvantage that limits its broader utilization: the biotin/streptavidin interaction can be broken only under denaturing conditions that also disrupt the integrity of the eluted complexes, hence precluding their subsequent functional analysis and/or further purification by other methods. In addition, the eluted samples are frequently contaminated with the background proteins that nonspecifically associate with streptavidin beads, complicating the analysis of the purified complexes by silver staining and mass spectrometry. To overcome these limitations, we developed a variant of the biotin/streptavidin strategy in which biotin is attached to an RNA substrate via a photo-cleavable linker and the complexes immobilized on streptavidin beads are selectively eluted to solution in a native form by long wave UV, leaving the background proteins on the beads. Shorter RNA binding substrates can be synthesized chemically with biotin and the photo-cleavable linker covalently attached to the 5&#39; end of the RNA, whereas longer RNA substrates can be provided with the two groups by a complementary oligonucleotide. These two variants of the UV-elution method were tested for purification of the U7 snRNP-dependent processing complexes that cleave histone pre-mRNAs at the 3&#39; end and they both proved to compare favorably to other previously developed purification methods. The UV-eluted samples contained readily detectable amounts of the U7 snRNP that was free of major protein contaminants and suitable for direct analysis by mass spectrometry and functional assays. The described method can be readily adapted for purification of other RNA binding complexes and used in conjunction with single- and double-stranded DNA binding sites to purify DNA-specific proteins and macromolecular complexes.

RNA/protein complexes purified using botin-streptavidin strategy are eluted to solution under denaturing conditions in a form unsuitable for further purification and functional analysis. Here, we describe a modification of this strategy that utilizes a photo-cleavable linker in RNA and a gentle UV-elution step, yielding native and fully functional RNA/protein complexes.

단일 단계 정화 RNA Biotin 및 사진 쪼갤 링커를 사용 하 여 고분자 복합물의

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial ...

생화학

High-Density DNA and RNA microarrays - Photolithographic Synthesis, Hybridization and Preparation of Large Nucleic Acid Libraries

Photolithography is a powerful technique for the synthesis of DNA oligonucleotides on glass slides, as it combines the efficiency of phosphoramidite coupling reactions with the precision and density of UV light reflected from micrometer-sized mirrors. Photolithography yields microarrays that can accommodate from hundreds of thousands up to several million different DNA sequences, 100-nt or longer, in only a few hours. With this very large sequence space, microarrays are ideal platforms for exploring the mechanisms of nucleic acid&#183;ligand interactions, which are particularly relevant in the case of RNA. We recently reported on the preparation of a new set of RNA phosphoramidites compatible with in situ photolithography and which were subsequently used to grow RNA oligonucleotides, homopolymers as well as mixed-base sequences. Here, we illustrate in detail the process of RNA microarray fabrication, from the experimental design, to instrumental setup, array synthesis, deprotection and final hybridization assay using a template 25mer sequence containing all four bases as an example. In parallel, we go beyond hybridization-based experiments and exploit microarray photolithography as an inexpensive gateway to complex nucleic acid libraries. To do so, high-density DNA microarrays are fabricated on a base-sensitive monomer that allows the DNA to be conveniently cleaved and retrieved after synthesis and deprotection. The fabrication protocol is optimized so as to limit the number of synthetic errors and to that effect, a layer of &#946;-carotene solution is introduced to absorb UV photons that may otherwise reflect back onto the synthesis substrates. We describe in a step-by-step manner the complete process of library preparation, from design to cleavage and quantification.

In this article, we present and discuss new developments in the synthesis and applications of nucleic acid microarrays fabricated in situ. Specifically, we show how the protocols for DNA synthesis can be extended to RNA and how microarrays can be used to create retrievable nucleic acid libraries.

고밀도 DNA 및 RNA 마이크로어레이 - 광소학 합성, 하이브리드화 및 대형 핵산 라이브러리의 제조

Photolithography is a powerful technique for the synthesis of DNA oligonucleotides on glass slides, as it combines the efficiency of phosphoramidite ...

Generation of Genetically Modified Mice through the Microinjection of Oocytes

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear injection of DNA expression constructs into fertilized oocytes remains the most commonly used technique to generate transgenic mice for overexpression. With the introduction of CRISPR technology for gene targeting, pronuclear injection into fertilized oocytes has been extended to the generation of both knockout and knockin mice. This work describes the preparation of DNA for injection and the generation of CRISPR guides for gene targeting, with a particular emphasis on quality control. The genotyping procedures required for the identification of potential founders are critical. Innovative genotyping strategies that take advantage of the "multiplexing" capabilities of CRISPR are presented herein. Surgical procedures are also outlined. Together, the steps of the protocol will allow for the generation of genetically modified mice and for the subsequent establishment of mouse colonies for a plethora of research fields, including immunology, neuroscience, cancer, physiology, development, and others.

The microinjection of mouse oocytes is commonly used for both classic transgenesis (i.e., the random integration of transgenes) and CRISPR-mediated gene targeting. This protocol reviews the latest developments in microinjection, with a particular emphasis on quality control and genotyping strategies.

난 모세포의 미세 주입을 통한 유전자 조작 마우스의 생성

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear ...

발생학

Protocol for the Solid-phase Synthesis of Oligomers of RNA Containing a 2'-O-thiophenylmethyl Modification and Characterization via Circular Dichroism

Solid-phase synthesis has been used to obtain canonical and modified polymers of nucleic acids, specifically of DNA or RNA, which has made it a popular methodology for applications in various fields and for different research purposes. The procedure described herein focuses on the synthesis, purification, and characterization of dodecamers of RNA 5&#39;-[CUA CGG AAU CAU]-3&#39; containing zero, one, or two modifications located at the C2&#39;-O-position. The probes are based on 2-thiophenylmethyl groups, incorporated into RNA nucleotides via standard organic synthesis and introduced into the corresponding oligonucleotides via their respective phosphoramidites. This report makes use of phosphoramidite chemistry via the four canonical nucleobases (Uridine (U), Cytosine (C), Guanosine (G), Adenosine (A)), as well as 2-thiophenylmethyl functionalized nucleotides modified at the 2&#39;-O-position; however, the methodology is amenable for a large variety of modifications that have been developed over the years. The oligonucleotides were synthesized on a controlled-pore glass (CPG) support followed by cleavage from the resin and deprotection under standard conditions, i.e., a mixture of ammonia and methylamine (AMA) followed by hydrogen fluoride/triethylamine/N-methylpyrrolidinone. The corresponding oligonucleotides were purified via polyacrylamide electrophoresis (20% denaturing) followed by elution, desalting, and isolation via reversed-phase chromatography (Sep-pak, C18-column). Quantification and structural parameters were assessed via ultraviolet-visible (UV-vis) and circular dichroism (CD) photometric analysis, respectively. This report aims to serve as a resource and guide for beginner and expert researchers interested in embarking in this field. It is expected to serve as a work-in-progress as new technologies and methodologies are developed. The description of the methodologies and techniques within this document correspond to a DNA/RNA synthesizer (refurbished and purchased in 2013) that uses phosphoramidite chemistry.

Protocol for the Solid-phase Synthesis of Oligomers of RNA Containing a 2'-O-thiophenylmethyl Modification and Characterization via Circular Dichroism

This article provides a detailed procedure on the solid-phase synthesis, purification, and characterization of dodecamers of RNA modified at the C2&#39;-O-position. UV-vis and circular dichroism photometric analyses are used to quantify and characterize structural aspects, i.e., single-strands or double-strands.

2&#39;- 포스 핀 올리고 뉴클레오타이드를 함유하는 올리고머의 고상 합성을위한 프로토콜<em&gt; O</em&gt; 원형 이색 성을 통한 - 티오 페닐 메틸 변형 및 특성 분석

Solid-phase synthesis has been used to obtain canonical and modified polymers of nucleic acids, specifically of DNA or RNA, which has made it a popular ...

화학

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an upstream 3&#39; splice site within a pre-mRNA, a process called back-splicing. This circularization is likely aided by secondary structures in the pre-mRNA that bring the splice sites into close proximity. In human genes, Alu elements are thought to promote these secondary RNA structures, as Alu elements are abundant and exhibit base complementarities with each other when present in opposite directions in the pre-mRNA. Here, we describe the generation and analysis of large, Alu element containing reporter genes that form circular RNAs. Through optimization of cloning protocols, reporter genes with up to 20 kb insert length can be generated. Their analysis in co-transfection experiments allows the identification of regulatory factors. Thus, this method can identify RNA sequences and cellular components involved in circular RNA formation.

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

We clone and analyze reporter genes generating circular RNAs. These reporter genes are larger than constructs to analyze linear splicing and contain Alu elements. To investigate the circular RNAs, the constructs are transfected into cells and resulting RNA is analyzed using RT-PCR after removal of linear RNA.

원형 RNA를 분석하기 위해 미니유전자를 포함하는 Alu 요소 사용

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an ...

RNA Interference in Aquatic Beetles as a Powerful Tool for Manipulating Gene Expression at Specific Developmental Time Points

RNA interference (RNAi) remains a powerful technique that allows for the targeted reduction of gene expression through mRNA degradation. This technique is applicable to a wide variety of organisms and is highly efficient in the species-rich order Coleoptera (beetles). Here, we summarize the necessary steps for developing this technique in a novel organism and illustrate its application to the different developmental stages of the aquatic diving beetle Thermonectus marmoratus. Target gene sequences can be obtained cost-effectively through the assembly of transcriptomes against a close relative with known genomics or de novo. Candidate gene cloning utilizes a specific cloning vector (the pCR4-TOPO plasmid), which allows the synthesis of double-stranded RNA (dsRNA) for any gene with the use of a single common primer. The synthesized dsRNA can be injected into either embryos for early developmental processes or larvae for later developmental processes. We then illustrate how RNAi can be injected into aquatic larvae using immobilization in agarose. To demonstrate the technique, we provide several examples of RNAi experiments, generating specific knockdowns with predicted phenotypes. Specifically, RNAi for the tanning gene laccase2 leads to cuticle lightening in both larvae and adults, and RNAi for the eye pigmentation gene white produces a lightening/lack of pigmentation in eye tubes. In addition, the knockdown of a key lens protein leads to larvae with optical deficiencies and a reduced ability to hunt prey. Combined, these results exemplify the power of RNAi as a tool for investigating both morphological patterning and behavioral traits in organisms with only transcriptomic databases.

RNA interference is a widely applicable, powerful technique for manipulating gene expression at specific developmental stages. Here, we describe the necessary steps for implementing this technique in the aquatic diving beetle Thermonectus marmoratus, from the acquisition of gene sequences to the knockdown of genes that affect structure or behavior.

특정 발달 시점에서 유전자 발현을 조작하기 위한 강력한 도구로 수생 딱정벌레의 RNA 간섭

RNA interference (RNAi) remains a powerful technique that allows for the targeted reduction of gene expression through mRNA degradation. This technique is ...

환경과학

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

세균 인공 염색체 : RNA 바이러스 양성 가닥의 연구에 대한 기능 유전체학 도구

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

면역학 및 감염병학

DNA-Tethered RNA Polymerase for Programmable In vitro Transcription and Molecular Computation

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work demonstrates that concepts from DNA nanotechnology can be used to program the enzymatic activity of the phage-derived T7 RNA polymerase (RNAP) and build scalable synthetic gene regulatory networks. First, an oligonucleotide-tethered T7 RNAP is engineered via expression of an N-terminally SNAP-tagged RNAP and subsequent chemical coupling of the SNAP-tag with a benzylguanine (BG)-modified oligonucleotide. Next, nucleic-acid strand displacement is used to program polymerase transcription on-demand. In addition, auxiliary nucleic acid assemblies can be used as &#34;artificial transcription factors&#34; to regulate the interactions between the DNA-programmed T7 RNAP with its DNA templates. This in vitro transcription regulatory mechanism can implement a variety of circuit behaviors such as digital logic, feedback, cascading, and multiplexing. The composability of this gene regulatory architecture facilitates design abstraction, standardization, and scaling. These features will enable the rapid prototyping of in vitro&#160;genetic devices for applications such as bio-sensing, disease detection, and data storage.

We describe the engineering of a novel DNA-tethered T7 RNA polymerase to regulate in vitro transcription reactions. We discuss the steps for protein synthesis and characterization, validate proof-of-concept transcriptional regulation, and discuss its applications in molecular computing, diagnostics, and molecular information processing.

시험관 내 전사 및 분자 계산을 위한 DNA 테더드 RNA 폴리머라제

DNA nanotechnology enables programmable self-assembly of nucleic acids into user-prescribed shapes and dynamics for diverse applications. This work ...