이 작품은 조지아 암 연합 부여 - R9028에 의해 지원되었다.

이론적 해석 80 mers에 써모 과학 Dharmacon oligos, 50의 사용을 악용, 여기 우리는 oligos는 대상 염색체 DNA와 어닐링 다음, 효모 세포의 게놈 DNA에 유전 정보를 전송할 수있는 유전자 보정 분석에 따라, 절차를 제시한다. oligos 타겟팅 성공이 예상 표현형을 표시 효모 식민지의 모양에 의해 채점됩니다. 원하는 유전자 조작이 oligo 순서에 통합 하나 이상의 ribonucleotides 이내에 실시하면, 유전 정보는 따라서 염색체 대상 DNA, 타겟팅 과정에서 염색체 수준에서 RNA / DNA 하이브리드 형태의 RNA 트랙트에서 직접 흐르고 있습니다. 써모 사이 언티픽 Dharmacon RNA 함유 oligo의 ribonucleotide / S는 DNA 복구 유전자 합성을 통해 대상에 대한 템플릿으로 제공하거나 DNA에 내장된 수 있으며, DNA 복제 중에 템플릿으로 제공하고 있습니다. 이 실험에서 우리는 효모 / Saccharomyces cerevisiae의 / 진핵세포 모델 시스템을 이용하지만, 이와 유사한 접근 방법은 다른 생물 또는 셀 유형에도 적용할 수 있습니다. 이 비디오에서는, 우리는 대상 효모 게놈의 로커스에 상동 설계 써모 과학 Dharmacon oligo를 사용하여 대상 유전자의 돌연변를 해결하기 위해 중간에 한 ribonucleotide를 포함. RNA 함유 oligo로 변환 후, 우리는 oligo의 RNA의 넓이는 염색체 DNA에 통합하여 DNA를 복제하는 동안 DNA 합성을위한 템플릿으로 사용할 수있다는 것을 나타냅니다 특정 주파수에서 대상 사이트의 수정을 관찰합니다. RNA 넓이 내에서 실행 유전 정보가 안정적으로 다음과 같은 셀 세대로 전송됩니다. 여기 우리는 염색체 DNA에 전송 RNA 정보를 감지하는 열 과학 Dharmacon RNA 함유 oligo와 방식으로 효모 세포 변화의 단계를 설명합니다. RNA 함유 Oligo의 A. 디자인이 실험에 사용된 우리는 효모에서 유전자 결함을 해결하기 위해 RNA 함유 oligo를 설계 S. trp5 로커스에서 cerevisiae 염색체 DNA. 프로토콜에 사용되는 효모 긴장은 두 기지 삭제 한 난센스 돌연변이 (그림 1A)와 돌연변이 trp5 유전자를 포함하고 있습니다. 이러한 효모 긴장은 트립토판 auxotrophic의 돌연변이이며 트립토판없이 미디어에 식민지를 형성하지 않습니다. TRP5 유전자의 DNA 시퀀스는 Saccharomyces 게놈 데이터베이스 (http://www.yeastgenome.org/)에서 사용할 수 있습니다. 이 프로토콜에서 사용되는 써모 과학 Dharmacon RNA 함유 oligo는 삭제 변이와 trp5 allele (그림 1A)의 넌센스 돌연변를 수정할 수 있도록 설계 한 ribonucleotide를 수정할 수 있도록 설계 2 기본 DNA의 삽입과 65 메르입니다. oligo의 순서는 다음과 같이 설계되었습니다 : 5&#39; - AAAAGGGTTTTGATGAAGCTGTCG - CG - GATCCCACATTCTG - RG - GAAGACTTCAAATCCTTGTATTCT. 이 oligo는 200 나노미터 규모 써모 과학 Dharmacon (라파예트, CO)에 의해 합성되며, desalted입니다 deprotected 및 페이지 정화없이 사용. 효모 변환을위한 RNA 함유 Oligo (Storici 외에서 수정되었습니다., 2007 1) B. 준비 <ol><li> oligo 튜브를 포함하여 실험, pipettes, 소용돌이, 랙, 실험 공간, 모든 것이 시작되기 전에 잠재적인 RNase 오염을 제거하는 RNase의 오염 제거 솔루션을 조사하여 착용 장갑에 사용됩니다 물질을 닦아주십시오. RNase없는 물, 화학 시약, 튜브 및 모든 단계에서 피펫 팁을 사용합니다. 본 실험의 모든 단계는 RNase 무료되어야합니다. </li><li> 써모 과학 Dharmacon RNA 함유 oligo는 회사에서 250 pmoles / RNase없는 물과 펠렛을 해산하기 위해 적극적으로 소용돌이와 함께 μl 재고 솔루션에받은 Resuspend. -80에서 보관 ° C. </li><li> 즉시 변환하기 전에, 얼음 RNA 함유 oligo를 해동 및 RNase없는 튜브에 RNase 무료 물로 50 pmoles / μl에 희석. 각각의 변환은 RNA 함유 oligos 1 nmole이 필요합니다. </li><li> oligos의 차 구조를 제거 2 분 100 ° C 열 블록에있는 RNA 함유 oligos의 선택 금액을 변성. </li><li> 즉시 변성 후 얼음에 튜브를 놓으십시오. 변환까지 얼음 계속. </li><li> 실험에 컨트롤로 해당 DNA는 전용 oligo가 사용됩니다. 이 oligo는 위에서 설명한 바와 같이, -20 ° C에서 해동하고 RNA 함유 oligo로 변환을위한 준비가되어 있습니다. </li></ol> RNA 함유 Oligo를 사용하여 효모 세포의 C. 변환 <ol><li> trp5 돌연변이 효모 세포와 풍부한 YPD 액체 배지의 5 ML의 예방 30 ° C 야간 (참조 자료)에서 성장. </li><li> YPD 액체 배지의 50 ML에 밤새 문화의 1.5 ML을 전송합니다. </li><li> 4h에 대해 30 ° C 쉐이크 (225 RPM)에 세포를 품어. </li><li> 해결 방법 1과 방법 2 IMM 준비ediately 전에 RNase없는 튜브의 변환 (자료 참조). </li><li> 50 ML RNase 무료 튜브 2 분 1천5백62그램에 해당하는 3,000 RPM,에서 스핀으로 세포 배양을 전송합니다. 세포 강수량의 펠렛은 약입니다. 0.3 cm 3. </li><li> 2 분 위해 3000 RPM의 RNase가없는 물, 스핀 50 ML로 뜨는 및 세척 세포를 제거합니다. </li><li> 최대한 매체에있는 수 배지와 RNases 없애 5 번 6 단계를 반복합니다. </li><li> 해결 방법 1과 2 분 3,000 rpm으로 회전 5 ML에 뜨는 및 resuspend 세포를 제거합니다. </li><li> 해결 방법 1 250 μl에 뜨는 및 resuspend 세포를 제거합니다. 세포의이 금액은 7-8 변환을 위해 충분합니다. </li><li> RNase 무료 microcentrifuge 튜브에 세포 현탁액의 나누어지는 50 μl는 20 μl를 추가 RNA 함유 oligo 작업 솔루션 (1 nmole) 또는 DNA 전용 oligo 작업 솔루션 (1 nmole) 또는 멸균 물의 20 μl 20 μl를 대조군에 대한 oligo와 함께. 다음 각 변환 반응에 대한 솔루션이 300 μl를 추가합니다. 변화의 과정에서 연어 정자 DNA를 추가할 필요가 항공사 자체로 oligos의 행위로, 없습니다. </li><li> 와동을 다해 구성 요소 homogenously 혼합합니다. </li><li> 30 ° C 통에 30 분 변환 반응을 품어. </li><li> 42 열충격 ° 15 분 C. </li><li> 4 분 2,236그램에 해당하는 5,000 RPM,에서 세포를 스핀 다운. </li><li> 멸균 물 100 μl에 뜨는 및 resuspend 세포를 제거합니다. </li><li> 이 세포 현탁액의 나누어지는를 타고 100000 접어 약을 사용하여 한 YPD 접시에 판 세포에 의해 멸균 물로 희석. 30 15 멸균 유리 구슬과 부화 ° 2 일 C. </li><li> 플레이트를 사용하여 약 트립토판 (SC - TRP)없이 합성 전체 고체 매체 중 하나를 페트리 접시에 각각의 변환 반응의 모든 resuspended 세포. 30 15 멸균 유리 구슬과 부화 ° 4~5일 (그림 2) C. </li></ol> RNA 함유 Oligo의 진 보정의 D. 분석 <ol><li> RNA 함유 oligo에 대한 유전자 보정 주파수를 계산하는 선택적 매체 (그림 2)뿐만 아니라 YPD 매체에 성장 식민지, DNA 전용 oligo 및 노 oligo 컨트롤에 대한 숫자를 세어보세요. 얻은 숫자를 비교합니다. 두베이스 삭제와 난센스 돌연변이와 trp5 대립 유전자의 자연 복귀 속도가 사용된 효모 변형에 10-9 이하이며, 따라서 우리는 oligos이 전지에 추가되지 않습니다 선택적 매체에는 식민지 형성을 기대하지 않습니다. </li><li> 몇 밖으로 줄무늬가 임의로 하나의 콜로니 격리를 얻을 YPD 중간에 transformant의 식민지를 골랐어요. 식민지의 성장 이틀 동안 잠깐, 다음 몇 가지 (적어도 5) 하나의 식민지를 가지고 YPD과 선택적 매체에 패치를 확인하십시오. </li><li> 식민지 PCR (그림 1B)에 의해 RNA 함유 oligo 대상 지역 (250-1,000 BP)를 증폭하기 위해 primers 한 쌍의을 디자인합니다. (Storici 및 레즈닉에서 수정, 2006 2) 다음과 같이 식민지 PCR을위한 절차입니다. <ol><li> Resuspend 전지는 (약 1 mm3) 물 50 μl의 개별 패치의 품을 lyticase 1 단위를 추가합니다. 100 열 블록에서 부화 다음 10 분, 각하 용액에 세포가 게놈 DNA를 릴리스 휴식 5 분 C.위한 상온에서 알을 품다 </li><li> PCR 조건 : PCR 반응은 세포 resuspension 솔루션 10 μl를 포함, 50 pmoles 순방향 및 역방향 primers 각각 10 MM dNTPs, DNA 형성 촉매 효소 1 단위, 10X 버퍼와 5 μl 1 μl가로 멸균 물을 조정됩니다 50 μl의 최종 볼륨. 95 30 S 30 사이클 ° C, 55 30의 ° C, 72시 1 분 ° C,, 72 7 분 최종 연장 시간 ° C; 다음 샘플 PCR 프로그램은 95 ° C에서 3 분, 4 보관 ° C. 1 분 / 킬로바이트의 연장 시간이 반응에 대한 추정되고있다. </li><li> PCR 후, 샘플은 PCR 제품의 관찰을 위해 1 % 또는 2 % (PCR 제품의 예상 크기에 따라) 아가로 오스 겔 (그림 3)에서 실행됩니다. </li></ol></li><li> RNA 함유 oligo로 전송 유전 정보가 효모 게놈 대상 지역에 새로운 제한 사이트 (그림 1B)를 생성하는 경우, 그것은 적절한 제한 효소로 PCR 제품을 소화하여 정보의 정확한 전달을 확인 할 수 있습니다. 아무런 제한 사이트가 RNA 함유 oligo에 의해 생성되지 않으면 6 단계로 이동합니다. 특정 제한 효소를 사용하여 다이제스트 PCR 제품. 소화 반응 6 제한 효소의 μl PCR 제품, 버퍼, BSA (일부 효소 위해 사용되는 효소에 대한 지침을 참조하십시오 필요하지 않을 수 있습니다), 0.5 μl, 15 μl로 멸균 물이 포함되어 있습니다. 샘플 사용 효소의 특정 온도에서 1 H에 대한 incubated 수 있습니다. </li><li> 유전자 조작 식물을 관찰하기 위해 2 % 아가로 오스 겔의 같은 행에 소화 샘플과 함께 소화되지 않은 샘플을 실행 B가 양도RNA 함유 oligo의 Y RNA 트랙트 (그림 3). </li><li> PCR 정화 키트를 사용하여 PCR 제품 정화 및 DNA의 시퀀싱을 위해 그들을 준비합니다. 제품을 증폭하는 데 사용되는 동일한 primers와 시퀀싱을 위해 샘플을 제출한다. </li><li> 선택한 참조 시퀀스 (그림 4) 여러 시퀀스의 정렬을 허용 소프트웨어를 사용하여 DNA의 시퀀싱 결과를 분석. </li></ol> RNA 함유 oligo의 E. 알칼리 치료 (그림 5) <ol><li> 각 반응 들어, 1.5 ML 튜브에 RNA 함유 oligo, 또는 DNA - oligo 1 nmole을 (250 pmoles / μl 재고 솔루션 4 μl)을 추가합니다. </li><li> 가수 분해 1 M NaOH 4 μl를 추가하거나, 또는 한 H.위한 대조군으로 4 μl H 2 O를 추가하고, 물 목욕 65 ° C에서 알을 품다 그런 다음 물을 욕조에서 얼음로 이동합니다. </li><li> 1.2 M HCL, H 2 O 1 M 트리스 - HCL, 4 μl 4 μl, 또는 또는 H 2 O 6 μl와 부정적인 제어를위한 1 M 트리스 - HCL 4 μl 2 μl와 중화. 변환까지 얼음 계속. </li></ol><img src="/files/ftp_upload/2152/2152fig1.jpg" alt="그림 1" /> 그림 1. 결함 trp5 유전자 및 RNA 함유 oligo에 의해 수정 TRP5 allele의 개략도 그림.) ​​trp5 돌연변이 유전자는 2베이스 삭제 (검은색 삼각형)과 1 기본 난센스 돌연변이 (별표)가 포함되어 있습니다. 단일 가닥 RNA 함유 2 - 기본 삽입 (블루 루프)와 Van91 I 제한 효소 사이트를 (괄호로 표시) 생성 1 RNA베이스 대체 (빨간색 사각형)와 oligo은 유전자 결함을 수정하는 효모 세포로 변화됩니다 trp5 유전자니다. TRP5 유전자가 RNA 함유 oligo (수정 기지가 파란색 사각형으로 표시됩니다)에 의해 수리 후 B), Van91 I 사이트는 TRP5 유전자로 생성됩니다. TRP5 유전자에 하나의 Van91 I 제한 사이트를 포함한 278 BP의 조각을 PCR primers는 한 쌍의 (P1 및 P2)에 의해 증폭됩니다. Van91하여 P1과 P2 PCR 제품의 소화 후 생성된 177 BP 101 BP 조각은 I도 표시됩니다. <img src="/files/ftp_upload/2152/2152fig2.jpg" alt="그림 2" /> 그림 2. RNA 함유 oligo와 변환 결과가.) 아니오 oligo와 변형 효모 세포 SC - TRP 매체에 대한 식민지를 형성하지 않습니다, 접시 AB를 참조하십시오. B) 세포 후에 SC - TRP에 성장 플레이트 CG보기 효모 식민지는 RNA 함유 oligo 1 nmole로 변환됩니다. C) 전지 이후 SC - TRP에 성장 플레이트 HL보기 효모 식민지는 해당 DNA 전용 제어 oligo 1 nmole로 변환됩니다. <img src="/files/ftp_upload/2152/2152fig3.jpg" alt="그림 3" /> 그림 3. 에서 유전 정보 전달의 검색 RNA 함유 대상 게놈 지역. P1과 P2로 증폭하고 Van91 I 제한 효소로 소화 PCR 시료의 2 % 아가로 오스 겔 전기 영동을 증폭 PCR 제품의 제한 소화에 의해 효모 염색체 DNA에 oligo합니다. 레인스 1, 8, 15, 100 사이즈, 200, 300, 400, 500 BP와 함께 DNA의 사다리는 왼쪽에 표시, 차선 2 trp5 돌연변이 변종의 게놈 DNA의 증폭 trp5 로커스의 PCR 제품, 레인 3, PCR 제품이 DNA 전용 oligo의 대상이 TRP + 식민지에서 파생된 게놈 DNA의 증폭, 차선 9-14, Van91 I 제한 소화, 차선 4-7, PCR 제품은 RNA 함유 oligo의 대상이 TRP + 식민지에서 파생된 게놈 DNA의 증폭 레인스 2-7에서 PCR 제품. 레인스 10-14에서 포경 PCR 제품 밴드의 존재는 TRP5 로커스 (CCACATTCTGG)에서 Van91 I에 의해 부분적인 소화에 의해 설명하실 수 있습니다. Van91 I (CCANNNN NTGG)에 대한 절단 사이트에서 여러 시퀀스를 수있다는 것을 고려하면, TRP5에서 생성된 사이트는 효소에 가장 최적의 표적이 될 수 없습니다. 사실, 위의 모든 PCR 제품의 시퀀싱 다음 DNA 우리는 (그림 4 참조) oligos에서 벌이는 이외 추가 변경 사항을 감지하지 않습니다. Van91에서 P1과 P2의 primers와 소화 제품 밴드에 의해 증폭된 278 BP PCR 밴드는 177 BP 101 BP의 전 오른쪽에있는 화살표에 의해 표시됩니다. <img src="/files/ftp_upload/2152/2152fig4tmb.jpg" border="0" alt="그림 4Thumb" /> 그림 4. RNA 함유 oligo의 유전자 교정을 보여주는 DNA 시퀀싱 결과. 게놈 영역의) DNA의 electropherogram는 RNA 함유 oligo 대상. DNA 순서 (박스 파란색)에서 G는 RNA 함유 oligo에 RG에서 유래. 또한 박스 CG 기지의 삽입입니다. 다른 모든 PCR 제품의 시퀀싱 결과가 아니라 배경 위에 형광 신호, 이것도 같이해도 좋다. TRP + transfo의 TRP5 지역의 B) 시퀀스DNA 전용 oligo (T1)와 RNA 함유 oligo (T2 - T5) 상단에있는 합의의 순서와 일치하고 대상 rmants는 (게놈 DNA, 빨간색 oligos 타겟팅 전에 trp5 돌연변이 세포의와 비교됩니다 음영). 수리 RNA 함유 바닥에 oligo하는 두 기본 DNA 삽입 한베이스 (G) 빨간색으로 표시된 RNA의 치환을하고 있습니다. 노란 그늘 쇼와 함께 파란색으로 박스 영역 것을 RNA 함유 oligo뿐만 아니라이 DNA 전용 oligo이 정확하게 삭제 변이와 모든 테스트 샘플의 난센스 돌연변을 수정. 점선 라인은 RNA 함유 oligo 순서의 위치를​​ 표시합니다. 하시기 바랍니다 <a href="http://www.jove.com/files/ftp_upload/2152/2152fig4.jpg">여기를 클릭</a> 그림 4의 더 큰 버전을 볼 수 있습니다. <img src="/files/ftp_upload/2152/2152fig5.jpg" alt="그림 5" /> 그림 5. 알칼리 치료 RNA 함유 oligo의 유전자 수정을 방지합니다. RNA 함유 oligo (R)에 의해 변환 주파수는 빨간색 막대와 DNA 전용 oligo (D)의 파란색 막대에 표시되는 것을 볼 수 있습니다. 오차 막대는 각 oligo 3 독립적인 변환을위한 의미의 표준 오류를 나타냅니다. DNA 전용 oligo가없이 NaOH 처리와 유사한 변환 주파수를 표시합니다. 다르게, RNA 함유 oligo로 변환 주파수 NaOH는 0 아래의 치료 방울. 따라서 RNA 함유 oligo있는 준비가 DNA 전용 oligo와 오염되지이며, 따라서 관찰 변환 주파수는 RNA 함유 oligo에만 적용됩니다.

<ol>
	<li>Storici, F., Bebenek, K., Kunkel, T. A., Gordenin, D. A., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-templated+DNA+repair.">RNA-templated DNA repair.</a> Nature. 447, 338-3341 (2007).</li><li>Storici, F., Resnick, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+delitto+perfetto+approach+to+in+vivo+site-directed+mutagenesis+and+chromosome+rearrangements+with+synthetic+oligonucleotides+in+yeast.">The delitto perfetto approach to in vivo site-directed mutagenesis and chromosome rearrangements with synthetic oligonucleotides in yeast.</a> Methods Enzymol. 409, 329-345 (2006).</li><li>Storici, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-mediated+DNA+modifications+and+RNA-templated+DNA+repair.">RNA-mediated DNA modifications and RNA-templated DNA repair.</a> Curr Opin Mol Ther. 10, 224-230 (2008).</li><li>Cerritelli, S. M., Crouch, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribonuclease+H:+the+enzymes+in+eukaryotes.">Ribonuclease H: the enzymes in eukaryotes.</a> FEBS J. 276, 1494-1505 (2009).</li></ol>

이 기사에 대한 비디오 제작이 간행물에 사용되는 시약 및 악기를 생산 써모 피셔 사이 언티픽에 의해 후원되었다.

RNA는 세포의 게놈 DNA에 직접 유전 정보를 전송할 수있다는 사실은 합성 RNA 함유 oligos의 사용 (Dharmacon 합성 oligos 1) 악용 발견되었습니다. 그것은 세포가 DNA 합성을위한 템플릿으로 RNA 함유 분자 또는 RNA 전용 시퀀스를 사용할 수있는 원리의 증거했습니다. 의 사용 RNA 함유만이 유전 정보가 반대 베꼈는데 DNA 사본 중간의 필요없이 게놈 DNA와 RNA에서 직접 전송할 수있다는 시위에 주도하지 oligos을뿐만 아니라 RNA가에 동종 템플릿으로 사용할 수있는 증거가 DNA 손상 1,3의 복구합니다. 우리가 여기에 표시 예제에서와 같이 oligos는 RNA 전용으로 만들어진 또는 DNA 순서에 포함된 단 하나 ribonucleotide를 포함할 수 있습니다. RNA 함유 oligo는 게놈 결함 trp5 allele의 넌센스 돌연변를 수정할 수 있도록 설계 한 임베디드 ribonucleotide 있습니다. ribonucleotide에서 게놈 DNA에 유전 정보의 전달은 목표 세포의 표현형 변화 (세포는 트립토판 부족한 매체에 재배)에 의해 드러났습니다. RNA 함유 oligo로 얻은 유전자 교정의 주파수는 측정 및 제어 DNA 전용 oligo의와 비교됩니다. 우리는 다양한 효모 유전자를 변형되기 다른 셀 배경,이 유전자 보정 분석을 수행함으로써, 우리는 요인 / S는 특히 RNA 함유 oligos 타겟팅에 영향을 미칠 어떤 감지할 수 있습니다. 따라서, 우리는 세포가 RNA / DNA 하이브리드의 안정성을 조절하는 방법 메커니즘을 밝힐 수 있습니다. 단순히 RNA 함유 oligos의 다른 변종을 설계함으로써 우리는 DNA 수정의 템플릿 역할을하는 특정 RNA의 넓이에 대한 가능성을 확인할 수 있습니다 우리는 DNA에 삽입하는 특정 RNA 시퀀스의 안정성을 확인할 수 있습니다. 또한, 우리는 희망이 RNA / DNA의 하이브리드와 상호 작용 요소에 대한 생체내 기판에 무엇입니까 확인할 수 있습니다. 주로 짧은 활용, 체외 연구에서 여러 RNA를 포함 oligos는 물론 RNases H의 생체내 기능에 같은 RNase H 효소 4와 같은, DNA와 하이브리드의 RNA를 인식할 수 요소의 기능을 특성화하기 위해 실시되었습니다 동안 RNA / DNA 하이브리드 안정성이 대부분 알 수없는 상태에 영향을 미칠 수있는 다른 단백질의 ID로. 활용 가능성 RNA 함유 큰 길이 (50 80 mers)와 최적의 품질 oligos하면 (예 : 써모 과학 Dharmacon RNA 함유 oligos 등) 직접의 생체내의 분자 프로세스의 다양한 검사하는 방법을 연 관심 세포. 으로 사용하여이 비디오, 변화에 표시된 RNA를 포함하는 것은 본질적으로 oligos RNases의 저하를 방지하기 위해, DNA 분자를 사용하여 변환에 비해 몇 가지 추가 단계가 필요합니다. 따라서, RNA 함유 oligos 것은 효모 시스템에 제한하지만,하지를 사용하여 변환은 DNA oligos에 의해 변화가 능숙하게되는 유기체 또는 세포 유형에 적용할 수 있습니다. 결론에 의해 세포를 대상으로 RNA하면 함유 oligos하는 것은 세포의 생체내의 DNA에 포함된 RNA / DNA 하이브리드 및 ribonucleotides를 생성할 수있는 기회를 제공합니다. 생체내의 안정성, 기능 및 이들의 결과는 RNA를 생성 / DNA의 하이브리드는 잠재적으로 DNA 수리의 알려지지 않은 메커니즘을 잠복하고 타겟 유전자에 대한 새로운 전략을 공개, 분석 및 특징 수 있습니다.

A. 변환 시약 및 미디어 (Storici 및 레즈닉에서 수정, 2006 <ol><li> YPD (효모 펩톤 덱스 트로 오스) 1 L의 경우, 10g의 효모 추출물, 펩톤 20g 간장, 20g 덱스 트로 오스. YPD 고체 미디어를 만들기 위해 15g의 한천을 추가합니다. 사용하기 전에 압력솥. 상온에서 보관하십시오. </li><li> 해결 방법 1 : 리튬 아세테이트의 0.1 M. 변환하기 전에 바로 준비하세요. 솔루션 1 작업 솔루션입니다, 따라서 그것은 분말에서 직접 준비가되어 있습니다. 아무 주식 솔루션은 만들어 없습니다. 실온에서 보관. LiAc는 DNA에 효모 세포 벽의 투과성을 증가시킵니다. </li><li> 해결 방법 2 : 리튬 아세테이트의 0.1 M 및 폴리에틸렌 글리콜 4000의 50 %. 또한 솔루션 2 작업 솔루션이며 직접 분말로 만든 것입니다. 아무 주식 솔루션은 준비되지 않습니다. 실온에서 보관. PEG 예금은 효모 세포에 oligos. </li><li> RNA 함유 oligos (써모 과학 Dharmacon), 50 80 mers, desalted, deprotected이 아닌 정화. 250 pmoles / μl로 Resuspend. -80에서 보관 ° C. </li><li> desalted이 아닌 정화 DNA 전용 oligos, 50 80 mers. 50 pmoles / μl로 Resuspend. -20 ° C.에 저장 </li><li> SC - TRP (합성 전체 미디어 트립토판 부족) 고체 미디어. </li><li> autoclaving 소독 0.5 cm 직경의 유리 비즈. </li><li> RNase - 해제 : RNase의 오염 제거 솔루션입니다. </li><li> DNase / RNase 무료, 멸균 원심 분리기 튜브. </li><li> DNase / RNase 무료, 멸균 원뿔 튜브. </li><li> 기력과 DNase / RNase 무료, 살균 에어로졸의 피펫 팁 : 100-200 ML, 100-1000 ML. </li></ol> B. 콜로니 PCR 자료. <ol><li> desalted 및 비 정화의 DNA primers. 50 pmoles / μl로 살균 물에 용해. -20 ° C.에 저장 </li><li> DNA 형성 촉매의 DNA 중합 효소, 버퍼, dNTPs. </li><li> PCR 튜브. </li></ol> C. PCR 정화. <ol><li> PCR 정화 키트. </li></ol> D. 젤 전기 영동. <ol><li> 아가로 오스. </li><li> 1 X TBE 실행 버퍼 (45 MM 트리스 - borate 및 1 ㎜의 에틸렌의 tetraacetate)는 10X TBE에서 희석. </li><li> Prestained 분자량 마커. </li><li> DNA 로딩 색소. </li></ol> E. 제한 소화. <ol><li> 제한 효소, 10X 버퍼, BSA. </li></ol> RNA 함유 oligo에 대한 알칼리 치료 F.. <ol><li> NaOH 용액의 1 M. </li><li> HCL 솔루션 1.2 M. </li><li> 트리스 - HCL 1 M, pH를 7.4 솔루션입니다. </li></ol>

generation of rna/dna hybrids in genomic dna by transformation using rna-containing oligonucleotides

합성 짧은 핵산 중합체 oligonucleotides (oligos)은 분자 생물학의 가장 기능과 광범위한 도구입니다. Oligos 어떤 원하는 DNA 또는 RNA의 시퀀스를 포함하는 생산 수 있으며, 기본, 설탕 수정의 다양한 포함 준비하실 수 있습니다. 또한, oligos는 특정 핵산 변경을 모방하고 있으므로, DNA 손상과 수리 메커니즘의 영향을 조사하는 것이 중요 도구로 검색할 수 있습니다 설계할 수 있습니다. 우리는 발견 써모 사이 언티픽 Dharmacon RNA 함유 50 80 세포핵 사이의 길이 oligos하는 생체내, 기능 및 염색체 RNA / DNA의 하이브리드의 결과와 DNA에 포함 ribonucleotides의 연구에 특히 적합합니다. RNA / DNA 하이브리드는 쉽게 아주 작은 세포와 이들 하이브리드는 세포의 유전자 무결성에 영향을 미칠 수있는 범위 내에서 RNA / DNA 하이브리드의 안정성에 대한 알려져있다 그러나, DNA 복제, 수리 및 녹음 중에 형성될 수 있기 때문이다. RNA 함유 oligos 따라서 염색체 DNA에 ribonucleotides을 소개하고 선택한 길이와 기본 구성의 RNA / DNA 하이브리드를 생성하는 완벽한 벡터를 나타냅니다. 여기서 우리는 진핵세포 모델 시스템 효모 / Saccharomyces cerevisiae의 /의 게놈에 ribonucleotides의 설립을위한 프로토콜을 제시한다. 그러나, 우리 실험실 활용이 써모 사이 언티픽 Dharmacon RNA 함유 oligos는 박테리아에서 인간의 세포로, 다른 전지 시스템의 염색체 수준에서 RNA / DNA 하이브리드를 생성합니다.

Watch this Scientific Journal Video about Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides at JoVE.com

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

이 작품은 염색체 수준에서 RNA / DNA 복합체를 형성하고 효모 세포의 게놈 DNA와 RNA의 유전 정보의 전송을 공개하는 방법을 보여줍니다.

RNA 함유 Oligonucleotides를 사용하여 변환하여 게놈 DNA에서 RNA / DNA 하이브리드의 생성

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

generation-rnadna-hybrids-genomic-dna-transformation-using-rna

Research

JoVE Journal

Biology

26.7K 조회수.  Georgia Institute of Technology. 이 작품은 염색체 수준에서 RNA / DNA 복합체를 형성하고 효모 세포의 게놈 DNA와 RNA의 유전 정보의 전송을 공개하는 방법을 보여줍니다.

비디오: Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Isolation of Genomic DNA from Mouse Tails

마우스 뒷면에서 게놈 DNA의 분리

연구

생물학

Transformation of Plasmid DNA into E. coli Using the Heat Shock Method

Transformation of plasmid DNA into E. coli using the heat shock method is a basic technique of molecular biology. It consists of inserting a foreign plasmid or ligation product into bacteria. This video protocol describes the traditional method of transformation using commercially available chemically competent bacteria from Genlantis. After a short incubation in ice, a mixture of chemically competent bacteria and DNA is placed at 42&deg;C for 45 seconds (heat shock) and then placed back in ice. SOC media is added and the transformed cells are incubated at 37&deg;C for 30 min with agitation. To be assured of isolating colonies irrespective of transformation efficiency, two quantities of transformed bacteria are plated. This traditional protocol can be used successfully to transform most commercially available competent bacteria. The turbocells from Genlantis can also be used in a novel 3-minute transformation protocol, described in the instruction manual.

열 충격 방법을 사용 E. 대장균에 플라스미드 DNA의 변화

Transformation of plasmid DNA into E. coli using the heat shock method is a basic technique of molecular biology. It consists of inserting a foreign ...

Extraction of High Molecular Weight Genomic DNA from Soils and Sediments

The soil microbiome is a vast and relatively unexplored reservoir of genomic diversity and metabolic innovation that is intimately associated with nutrient and energy flow within terrestrial ecosystems. Cultivation-independent environmental genomic, also known as metagenomic, approaches promise unprecedented access to this genetic information with respect to pathway reconstruction and functional screening for high value therapeutic and biomass conversion processes. However, the soil microbiome still remains a challenge largely due to the difficulty in obtaining high molecular weight DNA of sufficient quality for large insert library production. Here we introduce a protocol for extracting high molecular weight, microbial community genomic DNA from soils and sediments. The quality of isolated genomic DNA is ideal for constructing large insert environmental genomic libraries for downstream sequencing and screening applications. 
The procedure starts with cell lysis. Cell walls and membranes of microbes are lysed by both mechanical (grinding) and chemical forces (&beta;-mercaptoethanol). Genomic DNA is then isolated using extraction buffer, chloroform-isoamyl alcohol and isopropyl alcohol. The buffers employed for the lysis and extraction steps include guanidine isothiocyanate and hexadecyltrimethylammonium bromide (CTAB) to preserve the integrity of the high molecular weight genomic DNA. Depending on your downstream application, the isolated genomic DNA can be further purified using cesium chloride (CsCl) gradient ultracentrifugation, which reduces impurities including humic acids. The first procedure, extraction, takes approximately 8 hours, excluding DNA quantification step. The CsCl gradient ultracentrifugation, is a two days process. During the entire procedure, genomic DNA should be treated gently to prevent shearing, avoid severe vortexing, and repetitive harsh pipetting.

A methodology to isolate high molecular weight and high quality genomic DNA from soil microbial community is described.

소일스 및 세디먼츠에서 높은 분자량의 게놈의 DNA의 추출

The soil microbiome is a vast and relatively unexplored reservoir of genomic diversity and metabolic innovation that is intimately associated with ...

Generation of Transgenic C. elegans by Biolistic Transformation

The number of laboratories using the free living nematode C. elegans is rapidly growing. The popularity of this biological model is attributed to a rapid generation time and short life span, easy and inexpensive maintenance, fully sequenced genome, and array of RNAi resources and mutant animals. Additionally, analysis of the C. elegans genome revealed a great similarity between worms and higher vertebrates, which suggests that research in worms could be an important adjunct to studies performed in whole mice or cultured cells. A powerful and important part of worm research is the ability to use transgenic animals to study gene localization and function. Transgenic animals can be created either via microinjection of the worm germline or through the use of biolistic bombardment. Bombardment is a newer technique and is less familiar to a number of labs. Here we describe a simple protocol to generate transgenic worms by biolistic bombardment with gold particles using the Bio-Rad PDS-1000 system. Compared with DNA microinjection into hermaphrodite germline, this protocol has the advantage of not requiring special skills from the operator with regards to identifying worm anatomy or performing microinjection. Further multiple transgenic lines are usually obtained from a single bombardment. Also in contrast to microinjection, biolistic bombardment produces transgenic animals with both extrachromosomal arrays and integrated transgenes. The ability to obtain integrated transgenic lines can avoid the use of mutagenic protocols to integrate foreign DNA. In conclusion, biolistic bombardment can be an attractive method for the generation of transgenic animals, especially for investigators not interested in investing the time and effort needed to become skilled at microinjection.

Generation of Transgenic C. elegans by Biolistic Transformation

Transgenic worms are commonly used in C. elegans research. Described is a simple, yet effective, protocol to introduce transgenes into worms using biolistic bombardment with DNA-coated gold particles. The effort involved and results of bombardment compare favorably with microinjection for the generation of transgenic animals.

트렌스 제닉의 생성 C. 엘레간스 Biolistic 변환에 의해

The number of laboratories using the free living nematode C. elegans is rapidly growing. The popularity of this biological model is attributed to a rapid ...

Genomic MRI - a Public Resource for Studying Sequence Patterns within Genomic DNA

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in their nucleotide composition and consist of a complex mosaic of sequence patterns. These patterns include so-called Mid-Range Inhomogeneity (MRI) regions -- sequences 30-10000 nucleotides in length that are enriched by a particular base or combination of bases (e.g. (G+T)-rich, purine-rich, etc.). MRI regions are associated with unusual (non-B-form) DNA structures that are often involved in regulation of gene expression, recombination, and other genetic processes (Fedorova &amp; Fedorov 2010). The existence of a strong fixation bias within MRI regions against mutations that tend to reduce their sequence inhomogeneity additionally supports the functionality and importance of these genomic sequences (Prakash et al. 2009).
Here we demonstrate a freely available Internet resource -- the Genomic MRI program package -- designed for computational analysis of genomic sequences in order to find and characterize various MRI patterns within them (Bechtel et al. 2008). This package also allows generation of randomized sequences with various properties and level of correspondence to the natural input DNA sequences. The main goal of this resource is to facilitate examination of vast regions of non-coding DNA that are still scarcely investigated and await thorough exploration and recognition.

We present a public computational web site for the analysis of genomic sequences. It detects DNA sequence patterns with various non-random nucleotide compositions. This resource also generates randomized sequences with diverse levels of complexity.

게놈 MRI - 게놈 DNA 시퀀스 내의 패턴을 학습에 대한 공개 자료

Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in ...

Isolation and Characterization of RNA-Containing Exosomes

The field of exosome research is rapidly expanding, with a dramatic increase in publications in recent years. These small vesicles (30-100 nm) of endocytic origin were first proposed to function as a way for reticulocytes to eradicate the transferrin receptor while maturing into erythrocytes1, and were later named exosomes. Exosomes are formed by inward budding of late endosomes, producing multivesicular bodies (MVBs), and are released into the environment by fusion of the MVBs with the plasma membrane2. Since the first discovery of exosomes, a wide range of cells have been shown to release these vesicles. Exosomes have also been detected in several biological fluids, including plasma, nasal lavage fluid, saliva and breast milk3-6. Furthermore, it has been demonstrated that the content and function of exosomes depends on the originating cell and the conditions under which they are produced. A variety of functions have been demonstrated for exosomes, such as induction of tolerance against allergen7,8, eradication of established tumors in mice9, inhibition and activation of natural killer cells10-12, promotion of differentiation into T regulatory cells13, stimulation of T cell proliferation14 and induction of T cell apoptosis15. Year 2007 we demonstrated that exosomes released from mast cells contain messenger RNA (mRNA) and microRNA (miRNA), and that the RNA can be shuttled from one cell to another via exosomes. In the recipient cells, the mRNA shuttled by exosomes was shown to be translated into protein, suggesting a regulatory function of the transferred RNA16. Further, we have also shown that exosomes derived from cells grown under oxidative stress can induce tolerance against further stress in recipient cells and thus suggest a biological function of the exosomal shuttle RNA17. Cell culture media and biological fluids contain a mixture of vesicles and shed fragments. A high quality isolation method for exosomes, followed by characterization and identification of the exosomes and their content, is therefore crucial to distinguish exosomes from other vesicles and particles. Here, we present a method for the isolation of exosomes from both cell culture medium and body fluids. This isolation method is based on repeated centrifugation and filtration steps, followed by a final ultracentrifugation step in which the exosomes are pelleted. Important methods to identify the exosomes and characterize the exosomal morphology and protein content are highlighted, including electron microscopy, flow cytometry and Western blot. The purification of the total exosomal RNA is based on spin column chromatography and the exosomal RNA yield and size distribution is analyzed using a Bioanalyzer.

This paper demonstrates methods for the isolation, purification and detection of exosomes, as well as techniques for analysis of their molecular content. These methods are adaptable for exosome isolation from both cell culture media and biological fluids, and can beyond analysis of molecular content also be useful in functional studies.

RNA 함유 Exosomes의 분리 및 특성

The field of exosome research is rapidly expanding, with a dramatic increase in publications in recent years. These small vesicles (30-100 nm) of ...

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic redundancy affecting simple genetics in higher plants. The novel model organism Ostreococcus tauri is the smallest free-living eukaryote known to date, and possesses a greatly reduced genome size and cellular complexity1,2, manifested by the presence of just one of most organelles (mitochondrion, chloroplast, golgi stack) per cell, and a genome containing only ~8000 genes. Furthermore, the combination of unicellularity and easy culture provides a platform amenable to chemical biology approaches. Recently, Ostreococcus has been successfully employed to study basic mechanisms underlying circadian timekeeping3-6. Results from this model organism have impacted not only plant science, but also mammalian biology7. This example highlights how rapid experimentation in a simple eukaryote from the green lineage can accelerate research in more complex organisms by generating testable hypotheses using methods technically feasible only in this background of reduced complexity. Knowledge of a genome and the possibility to modify genes are essential tools in any model species. Genomic1, Transcriptomic8, and Proteomic9 information for this species is freely available, whereas the previously reported methods6,10 to genetically transform Ostreococcus are known to few laboratories worldwide.
In this article, the experimental methods to genetically transform this novel model organism with an overexpression construct by means of electroporation are outlined in detail, as well as the method of inclusion of transformed cells in low percentage agarose to allow selection of transformed lines originating from a single transformed cell. Following the successful application of Ostreococcus to circadian research, growing interest in Ostreococcus can be expected from diverse research areas within and outside plant sciences, including biotechnological areas. Researchers from a broad range of biological and medical sciences that work on conserved biochemical pathways may consider pursuing research in Ostreococcus, free from the genomic and organismal complexity of larger model species.

Genomic Transformation of the Picoeukaryote Ostreococcus tauri

This article describes genetic transformation of the unicellular marine alga Ostreococcus tauri by electroporation. This eukaryotic organism is an effective model platform for higher plants, possesing greatly reduced genomic and cellular complexity and being readily amenable to both cell culture and chemical biology.

Picoeukaryote의 게놈 변환<em&gt; Ostreococcus 타우 리</em

Common problems hindering rapid progress in Plant Sciences include cellular, tissue and whole organism complexity, and notably the high level of genomic ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

게놈 DNA에서 도보로 5 hydroxymethylcytosine의 선택적 캡처

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Real-time Imaging of Single Engineered RNA Transcripts in Living Cells Using Ratiometric Bimolecular Beacons

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the development of diverse techniques to visualize individual RNA transcripts in single living cells. One promising technique that has recently been described utilizes an oligonucleotide-based optical probe, ratiometric bimolecular beacon (RBMB), to detect RNA transcripts that were engineered to contain at least four tandem repeats of the RBMB target sequence in the 3&#8217;-untranslated region. RBMBs are specifically designed to emit a bright fluorescent signal upon hybridization to complementary RNA, but otherwise remain quenched. The use of a synthetic probe in this approach allows photostable, red-shifted, and highly emissive organic dyes to be used for imaging. Binding of multiple RBMBs to the engineered RNA transcripts results in discrete fluorescence spots when viewed under a wide-field fluorescent microscope. Consequently, the movement of individual RNA transcripts can be readily visualized in real-time by taking a time series of fluorescent images. Here we describe the preparation and purification of RBMBs, delivery into cells by microporation and live-cell imaging of single RNA transcripts.

Ratiometric bimolecular beacons (RBMBs) can be used to image single engineered RNA transcripts in living cells. Here, we describe the preparation and purification of RBMBs, delivery of RBMBs into cells by microporation and fluorescent imaging of single RNA transcripts in real-time.

비례 생체 분자 비콘을 사용하여 살아있는 세포의 단일 엔지니어링 RNA 성적 증명서의 실시간 영상

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

CRISPR / Cas9를 통해 포유 동물 세포주의 게놈에 삭제 세대

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...