이 작품은 KFB에 난청 연구 재단에서 YC S 및 NSF (IOS 0,930,096)를 부여 지원했다. KFB : NIH / NINDCD이 RO1 DC04184, <a href="https://commons.era.nih.gov/commons/genericStatus.do?actionRole=nonPI&amp;applID=7854446&amp;uhf-token=Ugf7JvudZTCbTUW9jSAR1snMUgg%3D">3R01DC004184 - 08W1</a> , NSF DBI 0,832,862, NSF IOS 0,930,096

1. Electroporation에 대한 전극 만들기 <ol><li> 적당한 길이의 75 μm의 직경의 텅스텐 와이어를 (AM 시스템즈 Carlsborg, WA) (약 3-5센티미터) 컷 </li><li> molex 케이블 커넥터 (핀 스탬프 황동)를 통해 텅스텐 와이어를 넣어 </li><li> 랩 텅스텐 와이어 및 축소 튜브 (SPC 기술, 시카고, 일리노이)와 와이어로 축소 튜브를 밀봉하기 위해 알콜 램프 또는 열 총을 들고 열을 적용과 molex 케이블 커넥터 </li><li> 텅스텐 와이어의 팁을 선명하게하려면, 1.0 N의 수산화 나트륨에 와이어를 찍어 (콘라드 외. 1993)하고, 다른 전극으로 종이 클립을 사용하여, 스퀘어 웨이브 Electroporator와 와이어를 전해하다. 우리가 사용하는 조건은 펄스 사이에 50 MS 각 지속적인 100 MS 5 50 볼트 펄스입니다. 전극은 15-20 μm의의 직경을 날카롭게한다 </li><li> electroporation에 사용하기 전에 모델링 흙으로 눌러 홈 이내 트레이에서 전선을 유지 </li></ol> 2. Electroporation 스테이션 설정 <ol><li> 테이프 micromanipulators (세계 정밀 장비)에 75μm 텅스텐 전극을 날카롭게. </li><li> 해부 현미경 스테이지 (Leica)의 양쪽에 플레이스 micromanipulators. </li><li> 보호 뀨이 - 21 수정 스퀘어 웨이브 Electroporator (그림 1)에 전극을 연결합니다. </li><li> electroporator 켜고 전압, 펄스 기간, 그리고 펄스의 수를 포함하여 electroporation에 대한 매개 변수를 설정합니다. 이 실험에 대한 가장 효과적인 매개 변수는 각 각 펄스 사이에 100ms와 5.0ms 동안 지속 세 13 볼트 펄스로 발견되었다. electroporation은 배아에서 공기 방울을 만드는 경우, 펄스 길이를 줄일 수 있습니다. </li></ol> 3. Zebrafish 귀의 소포으로 Morpholinos의 Microinjection <ol><li> 번식 탱크에서 수확 zebrafish의 배아. 에서 배아를 품어 배아 육아 ° C 하룻밤 28.5에서 0.3 PPM 메틸렌 블루 (웨스 터, 2005)와 매체를. </li><li> 서터 P - 97 전극 풀러와 유리 바늘을 당겨 </li><li> 37 아가로 오스 겔 기지 (10mm 페트리 접시에 생선 물 1퍼센트 아가로 오스) 워밍업 ° C 물 목욕으로 </li><li> 생선 물 열 1% 낮은 용융 점 아가로 오스 (LMPA)까지 녹아 및 37 ° C의 물을 욕조에 따뜻하게 유지. </li><li> morpholino 솔루션 (GeneTools, 코르 발리스, OR)와 유리 바늘을 작성하고 적절한 직경에 대한 제보를 잘라. micromanipulator (쿤)에 주사 바늘을 탑재합니다. </li><li> 약 10 μm의에 바늘 끝부분을 잘라 끝 morpholino 솔루션의 충분한 공급을 허용하도록 미네랄 오일에 주입. </li><li> 24 시간 postfertilization (HPF)에서 배아를 Dechorinate 및 0.3 PPM의 메틸렌 블루 피시 물에 MS222 (tricaine, 시그마)으로 그들을 마취. </li><li> 편리 유니폼을 분석 오른쪽 위로와 아가로 오스 겔베이스에 3-5 anesthetized 배아 정렬 </li><li> 각각의 배아 이상 1 % LMPA 1 ~ 2 방울을 넣어 보자 자리에서 배아를 해결하기 위해 응고 </li><li> 귀의 소포가 오른쪽에 있도록 페트리 접시를 회전 </li><li> 귀의 소포의 루멘에 바늘을 놓고 부착된 질소 탱크 (그림 2)와 PV820 공압 PicoPump (세계 정밀 악기)와 morpholino 솔루션을 주입 </li></ol> 4. Electroporation 절차 <ol><li> 즉시 주사 후 electroporation 역에 탑재된 배아를 이동 </li><li> 귀의 소포 단 후부 조직에 긍정적인 전극을 플레이스하지만, 침투하지 마십시오 귀의 소포로 단지 앞쪽에 두뇌에 부정적인 전극을 삽입 </li><li> 발 페달이나 스위치를 눌러서을 사용하여 현재 적용합니다. </li><li> 아가로 오스의 물고기 물을 붓고하고 소용돌이와 유리 피펫와 아가로 오스의 배아를 제거합니다. 배아를 손상하지 않도록주의하시기 바랍니다. 제거하기 어려운 배아 들어, 부드럽게 배아를 둘러싼 모든 LMPA 멀리 휴식하기 위해 바늘을 사용합니다. </li><li> 메틸렌 블루 피시 물 및 분석을위한 원하는 단계 (현장 하이브리드화 등 및 미세한 anlaysis에 immunohistochemical, 형태학의)에 배아를 높이와 함께 접시에 장소 배아. </li></ol> 5. 대표 결과 : <img src="/files/ftp_upload/2466/2466fig1.jpg" alt="그림 1" /> 그림 1. Electroporation 역. 전극 날카롭게 75μm 텅스텐 와이어를 사용하여 만든 보호 뀨이 - 21 수정 스퀘어 웨이브 Electroporator로 연결로 연결되어 있었다. 이 전극은 micromanipulators이 테이프로 붙여져 있었다. <img src="/files/ftp_upload/2466/2466fig2.jpg" alt="그림 2" /> 그림 2. 사출 역. 모든 배아는 표준화 목적으로 오른쪽 귀에 주입했다. <img src="/files/ftp_upload/2466/2466fig3.jpg" alt="그림 3" /> 3 DPF의 배아와 굴지의 필라멘트의 그림 3. Phalloidin의 얼룩. (A) 3 DPF의 배아 injecte제어 MO와 D는 사후 망막의 황반 (PM)에 phalloidin 강한 얼룩이 있습니다. (B) 제어 MO로 주입 후 electroporated되었다 난자는 주사에만 배아에서 오후 phalloidin의 얼룩 비슷한 수준을했다. electroporation와 함께 MIF 수법의 살인인의 주입은시 (D)에서 phalloidin의 얼룩의 극적인 감소가 발생하면서 (C) 혼자 귀의 소포로 MIF 수법의 살인인과 사출이 phalloidin의 얼룩의 감소가 발생하지 않았다. 오전, 앞쪽에 망막의 황반. <img src="/files/ftp_upload/2466/2466fig4.jpg" alt="그림 4" /> 그림 4 5. DPF의 애벌레와 굴지의 필라멘트의 Phalloidin의 얼룩. 이 주사 사이에 차이는 없었다 (A) 및 표준 제어 morpholino가 (B) 사용되었다 electroporation와 함께 주입. 그러나, MIF morpholinos와 electroporated로 주입되었다 5 DPF의 애벌레는 MIF morpholinos (C를 주사 맞은 배 (胚)에 비해 3 DPF 이상하지만 덜 극적인 뒷부분 망막의 황반 (PM) (D)에서 phalloidin의 얼룩을 감소했다 ). 오전, 앞쪽에 망막의 황반. <img src="/files/ftp_upload/2466/2466fig5.jpg" alt="그림 5" /> 그림 5. 3 DPF에서 배아의 Acetylated tubulin의 얼룩. (A)의 배 (胚)는 주사 또는 electroporation을받지 못했습니다. (B)의 배 (胚)는 electroporated하지만 주사를받지 않았다. MIF morpholinos와 함께 주입하여 electroporation (C, D)를 모두받을 수 배아 컨트롤에 비해 가시 감소 tubulin의 얼룩을했다. (PM, 사후 망막의 황반). <img src="/files/ftp_upload/2466/2466fig6.jpg" alt="그림 6" /> 그림 6. 컨트롤 morpholino 3 DPF에서 배아의 Acetylated tubulin의 얼룩. (A) 어떠한 치료를하지 않고 난자는 사후 망막의 황반 (PM)와 광범위한 innervation에 강한 acetylated tubulin의 얼룩을 보여주었다. (B) 난자는 제어 morpholino 주사. (C) 난자는 오직 electroporation과 치료. (D) 주입 및 제어 electroporated morpholino와 컨트롤 난자는 치료없이 컨트롤에 비해 뒷부분 망막의 황반과 innervation의 acetylated tubulin 비슷한 수준을했다.

<ol>
	<li>Conrad, G. W., Bee, J. A., Roche, S. M., Teillet, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fabrication+of+microscalpels+by+electrolysis+of+tungsten+wire+in+a+meniscus.">Fabrication of microscalpels by electrolysis of tungsten wire in a meniscus.</a> J Neurosci Methods. 50, 123-127 (1993).</li><li>Suzuki, M., Takamura, Y., Maeno, M., Tochinai, S., Iyaguchi, D., Tanaka, I., Nishihira, J., Ishibashi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xenopus+laevis+macrophage+migration+inhibitory+factor+is+essential+for+axis+formation+and+neural+development.">Xenopus laevis macrophage migration inhibitory factor is essential for axis formation and neural development.</a> J Biol Chem. 279, 21406-21414 (2004).</li><li>Barald, K. F., Kelley, M. W., W, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+placode+to+polarization:+new+tunes+in+inner+ear+development.">From placode to polarization: new tunes in inner ear development.</a> Development. 131, 4119-4135 (2004).</li></ol>

문서의 생산은 비디오와 텍스트에 언급된 시약을 생산 유전자 도구, LLC에 의해 후원되었다.

우리는 성공적으로 24 HPF의 zebrafish 배아의 귀에에 안티 센스 oligonucleotide의 수법의 살인인를 도입했습니다. 분사와 electroporation 이후 자랐던 공룡의 태아가 가능한되었습니다. 배아의 electroporation에서 살아남는다면, 그들은 치료뿐만 아니라 전용 주입에만 electroporated 있었다 배아 있었다 배아를받은 적이 없음 배아에 비해 정상적인 속도로 증가했다. 우리는 phalloidin과 acetylated tubulin과 라벨을 통해 귀 분사와 electroporation 후 MIF 및 MIF 같은 수법의 살인인의 효과를 관찰했다. 뒷부분 망막의 황반의 감각 세포에있는 굴지의 필라멘트의 Phalloidin의 얼룩은 수법의 살인인로 주입되었다 배아에 비해 머리카락 세포 및 / 또는 stereocilia 번호의 변화를 일으킨 MIF와 24 HPF 단계에서 MIF와 같은 MO의 electroporation을 나타냅니다 (그림 3). 헤어 셀 번호에있는이 감소는 쉔 외의 결과와 일치합니다. (제출) MIF 및 MIF처럼하는 수법의 살인인 걸 saccular 망막의 황반에있는 세포의 수를 감소의 원인이되는. 그 electroporation을 설명 수법의 살인인 및 electroporated로 주입되었다 태아의 머리 세포 숫자의 감소함으로써 귀의 소포에만 주입어진 배아에 비해 형태학의 효과의 범위를 증가, 세포막에 걸쳐 수법의 살인인 이동에 도움이됩니다. statoacoustic 신경절의 형태의 변경은 acetylated tubulin의 얼룩을 통해 관찰했다. statoacoustic 신경절에 의해 innervation의 범위는 주입과 공연이 neurites (그림 5)의 분기 감소 electroporated되었습니다 배아으로 영향을했습니다. acetylated tubulin의 얼룩이 크게 주입하고 electroporated 있었다 모두 배아 감소하기 때문에 또한, ganglionic 세포 및 / 또는 신경절 세포의 감소 번호 결로가 발생 감소있을 수 있습니다. MIF는 신경 시스템 개발 (스즈키 외., 2004)에 중요한 것으로 표시 되었기 때문에, electroporation 후 본 변경 사항은 MIF 및 MIF 같은 neuroblast 세포에 MO 솔루션입니다. 증가 transfection 결과 수 있습니다 직접 개발 조직으로 안티 센스 oligo morpholinos의 Electroporation은 배아에서 조직 개발하는 동안 유전자 모두 공간과 temporally의 표현을 제어하기위한 유용한 도구입니다. MIF와 내이 (内耳)의 조직에 수법의 살인인 MIF처럼의 Electroporation은 사후 망막의 황반과 statoacoustic 신경절 모두 비정상적인 형태의 결과. 어느에만 주사 또는 유일한 electroporated했다 배아 또는 전혀 치료를받은 적이 없음 배아에 비해 주입하고 electroporated 있던 태아의 사후 망막의 황반에있는 감각 세포의 수가 감소가 발생했습니다. statoacoustic 신경절 및 SAG의 크기에 의해 사후 감각 패치 innervation의 정도에 감소도 발생했습니다. Electroporation 원하는 조직에서 특정 DNA, RNA, 또는 MO의 주요 효과를 관찰하고 다른 조직에있는 보조 효과에서 이들을 차별, 뇌, 신경 문장을 포함하여의 이익과 특정 조직에 macromolecules를 transfecting위한 가치있는 방법입니다 내이 (内耳)의 개발에 periotic mesenchyme (Barald와 켈리, 2004).

<ol><li> 수법의 살인인 : 0.3 MIF, MIF 같은 MO1에 대한 조합의 MM, 그리고 MIF 같은 MO2 사용되었다. 5&#39; - acatcggcatgactgcgacagagat - 3 &#39;MIF MO은 zebrafish MIF의 mRNA의 시작 코돈으로 무료입니다. 두 수법의 살인인는 MIF와 같은 사용되었습니다 MIF ​​MO1 같은 translational 시작 사이트 무료입니다. MO2 MIF와 같은 intron1/exon이 경계에서 순서 AS에서 파생된 반면, 5&#39; - GTTTCTATATTTATGAACGGCATGA - 3 &#39;5&#39; - GATTCATCCTCTGAAGACGTAAGCC &#39;-3. 5&#39; - CCTCTTACCTCAGTTACAATTTATA - 3 &#39;제어 수법은 진 도구에서 발진 뉴클레오 티드 시퀀스되었습니다. </li><li> 생선 물속에 메틸렌 블루 (0.3 PPM) </li><li> MS222 (tricaine, 시그마, 생선 물 속에 0.64 ㎜) </li><li> 낮은 용융 점 아가로 오스 (LMPA, 로체) </li><li> 페놀 레드 (시그마) </li><li> 안티 acetylated tubulin (시그마) </li><li> 알렉사 플루어 ® 488 염소 방지 마우스 두번째 항체 (분자 프로브) </li><li> 텍사스 붉은 phalloidin (분자 프로브) </li></ol>

direct delivery of mif morpholinos into the zebrafish otocyst by injection and electroporation affects inner ear development

최근에는 electroporation은 눈, 뇌 및 zebrafish의 somites 등 다양한 조직로 DNA, RNA, 그리고 morpholinos의 생체내 transfection에 대한 인기가 기술되고있다. 유전자 조작의 다른 방법 이상의 electroporation의 장점은 특정 조직은 전류의 응용 프로그램에 의해 macromolecules의 도입을 위해, 두 공간과 temporally, 타겟이 될 수있다는 것입니다. 여기서 우리는 zebrafish의 개발 내이 (内耳)의 조직에 MIF 및 MIF 같은 morpholinos를 transfecting위한 electroporation의 사용을 설명합니다. 과거 연구에서는 MIF morpholino은 1 배아에 주입 - 8 세포 단계에 확산 형태학의 신경계 및 안구의 변화뿐만 아니라 귀에 결과. 개발 나중 단계에서 내이 (内耳)의 조직을 대상으로하여, 우리는 다른 조직의 영향에서 발생할 수 있습니다 보조 효과를 반대로 개발 내이 (内耳)에서 MIF의 주요 효과를 확인할 수 있습니다. 뉴런,의 연결을 처리하고, 사후 망막의 황반과 관련된 세포의 형태를 연구 얼룩 phalloidin 및 acetylated tubulin을 사용함으로써, 우리는 zebrafish 내이 (内耳)에서 타겟으로 transfection을위한 방법으로 electroporation의 효능을 평가할 수 있었다. 24hpf 배아의 귀의 vesicles는 morpholinos와 electroporated로 주입되었고 그 어떤 치료를받은 적이 없음 또는 유일한 주입 또는 electroporated 있었다 배아에 비해했다. 주입 및 electroporated했다 공룡의 태아가 머리 셀 번호의 감소를 보여주 statoacoustic 신경절 (SAG)과 통제 그룹에 비해 적은 세그 뉴런에 의해 innervation을 감소. 결과는 나중 단계에서 otocysts에 morpholinos의 직접 배달은 불특정 신경계와 1-8 세포 단계에서 제공 morpholinos의 신경 크레스트 효과를 피할 것으로 나타났다. 또한 허용하는 내이 (内耳)와 뇌, 신경 문장 또는 periotic mesenchyme에 기본 효과의 귀가 아닌 보조 효과로 이동 효과 시험.

Watch this Scientific Journal Video about Direct Delivery of MIF Morpholinos Into the Zebrafish Otocyst by Injection and Electroporation Affects Inner Ear Development at JoVE.com

Direct Delivery of MIF Morpholinos Into the Zebrafish Otocyst by Injection and Electroporation Affects Inner Ear Development

24hpf에서 zebrafish otocyst에 직접 morpholinos를 전달하는 방법이 개발되었습니다. 귀의 소포 및 침투력을 효과 electroporation의 루멘에 morpholinos의 microinjection을 사용하여, 우리는 두뇌에 morpholinos의 효과를 무시하고 내이 (内耳)에 특정 효과를 얻을 수 있었다.

사출 및 Electroporation에 의해 Zebrafish Otocyst으로 MIF Morpholinos 직접 배달 내이 (内耳)의 개발 미치는 영향

In recent years, electroporation has become a popular technique for in vivo transfection of DNA, RNA, and morpholinos into various tissues, including the ...

direct-delivery-mif-morpholinos-into-zebrafish-otocyst-injection

Research

JoVE Journal

Biology

14.2K 조회수.  University of Wisconsin, Madison. 24hpf에서 zebrafish otocyst에 직접 morpholinos를 전달하는 방법이 개발되었습니다. 귀의 소포 및 침투력을 효과 electroporation의 루멘에 morpholinos의 microinjection을 사용하여, 우리는 두뇌에 morpholinos의 효과를 무시하고 내이 (内耳)에 특정 효과를 얻을 수 있었다.

비디오: Direct Delivery of MIF Morpholinos Into the Zebrafish Otocyst by Injection and Electroporation Affects Inner Ear Development

In Utero Intraventricular Injection and Electroporation of E16 Rat Embryos

In-utero in-vivo injection and electroporation of the embryonic rat neocortex provides a powerful tool for the manipulation of individual progenitors lining the walls of the lateral ventricle. This technique is now widely used to study the processes involved in corticogenesis by over-expressing or knocking down genes and observing the effects on cellular proliferation, migration, and differentiation. In comparison to traditional knockout strategies, in-utero electroporation provides a rapid means to manipulate a population of cells during a specific temporal window. In this video protocol, we outline the experimental methodology for preparing rats for surgery, exposing the uterine horns through laporatomy, injecting DNA into the lateral ventricles of the developing embryo, electroporating DNA into the progenitors lining the lateral wall, and caring for animals post-surgery. Our laboratory uses this protocol for surgeries on E15-E21 rats, however it is most commonly performed at E16 as shown in this video.

E16 랫 태아의 Utero의 심실 주입 및 Electroporation에

In-utero in-vivo injection and electroporation of the embryonic rat neocortex provides a powerful tool for the manipulation of individual progenitors ...

연구

생물학

In Utero Intraventricular Injection and Electroporation of E15 Mouse Embryos

In-utero in-vivo injection and electroporation of the embryonic mouse neocortex provides a powerful tool for the manipulation of individual progenitors lining the walls of the lateral ventricle. This technique is now widely used to study the processes involved in corticogenesis by over-expressing or knocking down genes and observing the effects on cellular proliferation, migration, and differentiation. In comparison to traditional knockout strategies, in-utero electroporation provides a rapid means to manipulate a population of cells during a specific temporal window. In this video protocol we outline the experimental methodology for preparing mice for surgery, exposing the uterine horns through laporatomy, injecting DNA into the lateral ventricles of the developing embryo, electroporating DNA into the progenitors lining the lateral wall, and caring for animals post-surgery. Our laboratory uses this protocol for surgeries on E13-E16 mice, however, it is most commonly performed at E15, as shown in this video. 

E15 마우스 태아의 Utero의 심실 주입 및 Electroporation에

In-utero in-vivo injection and electroporation of the embryonic mouse neocortex provides a powerful tool for the manipulation of individual progenitors ...

Electroporation of Mycobacteria

High efficiency transformation is a major limitation in the study of mycobacteria. The genus Mycobacterium can be difficult to transform; this is mainly caused by the thick and waxy cell wall, but is compounded by the fact that most molecular techniques have been developed for distantly-related species such as Escherichia coli and Bacillus subtilis. In spite of these obstacles, mycobacterial plasmids have been identified and DNA transformation of many mycobacterial species have now been described. The most successful method for introducing DNA into mycobacteria is electroporation. Many parameters contribute to successful transformation; these include the species/strain, the nature of the transforming DNA, the selectable marker used, the growth medium, and the  conditions for the electroporation pulse. Optimized methods for the transformation of both slow- and fast-grower are detailed here. Transformation efficiencies for different mycobacterial species and with various selectable markers are reported.

Mycobacterial pathogenic strategies remain poorly understood. The slow growth rate of most species, the impenetrable nature of the cell-wall, and the hazards of working with pathogens make mycobacteria difficult to study and are largely responsible for our poor understanding of these organisms. In this video we will demonstrate the technique of electroporation, which involves subjecting cells to a brief high electrical impulse to allow the entry of DNA. It is the most widely used method for introducing DNA into mycobacterial cells.

Mycobacteria의 Electroporation

High efficiency transformation is a major limitation in the study of mycobacteria. The genus Mycobacterium can be difficult to transform; this is mainly ...

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

성인 Zebrafish에서 내이 (内耳) 감각 상피 조직의 총과 파인 해부 ( Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Zebrafish Brain Ventricle Injection

Proper brain ventricle formation during embryonic brain development is required for normal brain function.  Brain ventricles are the highly conserved cavities within the brain that are filled with cerebrospinal fluid.  In zebrafish, after neural tube formation, the neuroepithelium undergoes a series of constrictions and folds while it fills with fluid resulting in brain ventricle formation.  In order to understand the process of ventricle formation, and the neuroepithelial shape changes that occur at the same time, we needed a way to visualize the ventricle space in comparison to the brain tissue.  However, the nature of transparent zebrafish embryos makes it difficult to differentiate the tissue from the ventricle space.  Therefore, we developed a brain ventricle injection technique where the ventricle space is filled with a fluorescent dye and imaged by brightfield and fluorescent microscopy.  The brightfield and the fluorescent images are then processed and superimposed in Photoshop.  This technique allows for visualization of the ventricle space with the fluorescent dye, in comparison to the shape of the neuroepithelium in the brightfield image.  Brain ventricle injection in zebrafish can be employed from 18 hours post fertilization through early larval stages.  We have used this technique extensively in our studies of brain ventricle formation and morphogenesis as well as in characterizing brain morphogenesis mutants (1-3).

After neural tube formation, the neuroepithelium constricts and folds while the tube fills with embryonic cerebrospinal fluid (eCSF) to form the embryonic brain ventricles. We developed this ventricle injection technique to better visualize the fluid filled space in contrast to the neuroepithelial shape in a live embryo.

Zebrafish의 두뇌 뇌실 주입

Proper brain ventricle formation during embryonic brain development is required for normal brain function.  Brain ventricles are the highly conserved ...

Primary Culture and Plasmid Electroporation of the Murine Organ of Corti. 

In all mammals, the sensory epithelium for audition is located along the spiraling organ of Corti that resides within the conch shaped cochlea of the inner ear (fig 1). Hair cells in the developing cochlea, which are the mechanosensory cells of the auditory system, are aligned in one row of inner hair cells and three (in the base and mid-turns) to four (in the apical turn) rows of outer hair cells that span the length of the organ of Corti. Hair cells transduce sound-induced mechanical vibrations of the basilar membrane into neural impulses that the brain can interpret. Most cases of sensorineural hearing loss are caused by death or dysfunction of cochlear hair cells.
An increasingly essential tool in auditory research is the isolation and in vitro culture of the organ explant 1,2,9. Once isolated, the explants may be utilized in several ways to provide information regarding normative, anomalous, or therapeutic physiology. Gene expression, stereocilia motility, cell and molecular biology, as well as biological approaches for hair cell regeneration are examples of experimental applications of organ of Corti explants.
This protocol describes a method for the isolation and culture of the organ of Corti from neonatal mice. The accompanying video includes stepwise directions for the isolation of the temporal bone from mouse pups, and subsequent isolation of the cochlea, spiral ligament, and organ of Corti. Once isolated, the sensory epithelium can be plated and cultured in vitro in its entirety, or as a further dissected micro-isolate that lacks the spiral limbus and spiral ganglion neurons. Using this method, primary explants can be maintained for 7-10 days. As an example of the utility of this procedure, organ of Corti explants will be electroporated with an exogenous DsRed reporter gene. This method provides an improvement over other published methods because it provides reproducible, unambiguous, and stepwise directions for the isolation, microdissection, and primary culture of the organ of Corti.

Primary Culture and Plasmid Electroporation of the Murine Organ of Corti.

This procedure describes a method for the isolation and culture of the murine organ of Corti with or without the spiral limbus and spiral ganglion neurons. We also demonstrate a method for the expression of an exogenous reporter gene in the organ of Corti explant by electroporation.

차 문화와 Corti의 Murine 오르간의 플라스미드 Electroporation.

In all mammals, the sensory epithelium for audition is located along the spiraling organ of Corti that resides within the conch shaped cochlea of the ...

Intraperitoneal Injection into Adult Zebrafish

A convenient method for chemically treating zebrafish is to introduce the reagent into the tank water, where it will be taken up by the fish. However, this method makes it difficult to know how much reagent is absorbed or taken up per fish. Some experimental questions, particularly those related to metabolic studies, may be better addressed by delivering a defined quantity to each fish, based on weight. Here we present a method for intraperitoneal (IP) injection into adult zebrafish. Injection is into the abdominal cavity, posterior to the pelvic girdle. This procedure is adapted from veterinary methods used for larger fish. It is safe, as we have observed zero mortality. Additionally, we have seen bleeding at the injection site in only 5 out of 127 injections, and in each of those cases the bleeding was brief, lasting several seconds, and the quantity of blood lost was small. Success with this procedure requires gentle handling of the fish through several steps including fasting, weighing, anesthetizing, injection, and recovery. Precautions are required to minimize stress throughout the procedure. Our precautions include using a small injection volume and a 35G needle. We use Cortland salt solution as the vehicle, which is osmotically balanced for freshwater fish. Aeration of the gills is maintained during the injection procedure by first bringing the fish into a surgical plane of anesthesia, which allows slow operculum movements, and second, by holding the fish in a trough within a water-saturated sponge during the injection itself. We demonstrate the utility of IP injection by injecting glucose and monitoring the rise in blood glucose level and its subsequent return to normal. As stress is known to increase blood glucose in teleost fish, we compare blood glucose levels in vehicle-injected and non-injected adults and show that the procedure does not cause a significant rise in blood glucose.

We demonstrate intraperitoneal injection into adult zebrafish. We use a 10 &mu;l NanoFil microsyringe controlled by a Micro4 controller and UltraMicroPump III. This demonstration includes the use of cold water as an anesthetic.

성인 Zebrafish에 Intraperitoneal 사출

A convenient method for chemically treating zebrafish is to introduce the reagent into the tank water, where it will be taken up by the fish. However, ...

RNAi Interference by dsRNA Injection into Drosophila Embryos

Genetic screening is one of the most powerful methods available for gaining insights into complex biological process 1. Over the years many improvements and tools for genetic manipulation have become available in Drosophila 2. Soon after the initial discovery by Frie and Mello 3 that double stranded RNA can be used to knockdown the activity of individual genes in Caenorhabditis elegans, RNA interference (RNAi) was shown to provide a powerful reverse genetic approach to analyze gene functions in Drosophila organ development 4, 5.
Many organs, including lung, kidney, liver, and vascular system, are composed of branched tubular networks that transport vital fluids or gases 6, 7. The analysis of Drosophila tracheal formation provides an excellent model system to study the morphogenesis of other tubular organs 8. The Berkeley Drosophila genome project has revealed hundreds of genes that are expressed in the tracheal system. To study the molecular and cellular mechanism of tube formation, the challenge is to understand the roles of these genes in tracheal development. Here, we described a detailed method of dsRNA injection into Drosophila embryo to knockdown individual gene expression. We successfully knocked down endogenous dysfusion(dys) gene expression by dsRNA injection. Dys is a bHLH-PAS protein expressed in tracheal fusion cells, and it is required for tracheal branch fusion 9, 10. dys-RNAi completely eliminated dys expression and resulted in tracheal fusion defect. This relatively simple method provides a tool to identify genes requried for tissure and organ development in Drosophila.

RNAi Interference by dsRNA Injection into Drosophila Embryos

RNA interference has been proven very effective to analyze gene function in Drosophila tracheal development. A detailed protocol used by Jiang lab to inject dsRNA into fly embryos to knockdown gene expression is illustrated. This technique has the potential for screening genes required for tissue and organ development in Drosophila.

dsRNA 주입하여 RNAi 간섭에 Drosophila 태아

Genetic screening is one of the most powerful methods available for gaining insights into complex biological process 1. Over the years many improvements ...

Electroporation of Craniofacial Mesenchyme

Electroporation is an efficient method of delivering DNA and other charged macromolecules into tissues at precise time points and in precise locations. For example, electroporation has been used with great success to study neural and retinal development in Xenopus, chicken and mouse 1-10. However, it is important to note that in all of these studies, investigators were not targeting soft tissues. Because we are interested in craniofacial development, we adapted a method to target facial mesenchyme.
When we searched the literature, we found, to our surprise, very few reports of successful gene transfer into cartilaginous tissue. The majority of these studies were gene therapy studies, such as siRNA or protein delivery into chondrogenic cell lines, or, animal models of arthritis 11-13. In other systems, such as chicken or mouse, electroporation of facial mesenchyme has been challenging (personal communications, Dept of Craniofacial Development, KCL). We hypothesized that electroporation into procartilaginous and cartilaginous tissues in Xenopus might work better. In our studies, we show that gene transfer into the facial cartilages occurs efficiently at early stages (28), when the facial primordium is still comprised of soft tissue prior to cartilage differentiation.
Xenopus is a very accessible vertebrate system for analysis of craniofacial development. Craniofacial structures are more readily visible in Xenopus than in any other vertebrate model, primarily because Xenopus embryos are fertilized externally, allowing analyses of the earliest stages, and facilitating live imaging at single cell resolution, as well as reuse of the mothers 14. Among vertebrate models developing externally, Xenopus is more useful for craniofacial analysis than zebrafish, as Xenopus larvae are larger and easier to dissect, and the developing facial region is more accessible to imaging than the equivalent region in fish. In addition, Xenopus is evolutionarily closer to humans than zebrafish (&tilde;100 million years closer) 15. Finally, at these stages, Xenopus tadpoles are transparent, and concurrent expression of fluorescent proteins or molecules will allow easy visualization of the developing cartilages. We anticipate that this approach will allow us to rapidly and efficiently test candidate molecules in an in vivo model system.

Craniofacial cartilages develop in close contact with other tissues and are difficult to manipulate in live animals. We are using electroporation to deliver molecular tools during growth of the craniofacial skeleton while bypassing early embryonic effects. This approach will allow us to efficiently test candidate molecules in vivo.

Craniofacial Mesenchyme의 Electroporation

Electroporation is an efficient method of delivering DNA and other charged macromolecules into tissues at precise time points and in precise locations. ...

In vivo Electroporation of Morpholinos into the Adult Zebrafish Retina

Many devastating inherited eye diseases result in progressive and irreversible blindness because humans cannot regenerate dying or diseased retinal neurons. In contrast, the adult zebrafish retina possesses the robust ability to spontaneously regenerate any neuronal class that is lost in a variety of different retinal damage models, including retinal puncture, chemical ablation, concentrated high temperature, and intense light treatment 1-8. Our lab extensively characterized regeneration of photoreceptors following constant intense light treatment and inner retinal neurons after intravitreal ouabain injection 2, 5, 9. In all cases, resident M&uuml;ller glia re-enter the cell cycle to produce neuronal progenitors, which continue to proliferate and migrate to the proper retinal layer, where they differentiate into the deficient neurons. 
	We characterized five different stages during regeneration of the light-damaged retina that were highlighted by specific cellular responses. We identified several differentially expressed genes at each stage of retinal regeneration by mRNA microarray analysis 10. Many of these genes are also critical for ocular development. To test the role of each candidate gene/protein during retinal regeneration, we needed to develop a method to conditionally limit the expression of a candidate protein only at times during regeneration of the adult retina. 
	Morpholino oligos are widely used to study loss of function of specific proteins during the development of zebrafish, Xenopus, chick, mouse, and tumors in human xenografts 11-14. These modified oligos basepair with complementary RNA sequence to either block the splicing or translation of the target RNA. Morpholinos are stable in the cell and can eliminate or "knockdown" protein expression for three to five days 12. 
	Here, we describe a method to efficiently knockdown target protein expression in the adult zebrafish retina. This method employs lissamine-tagged antisense morpholinos that are injected into the vitreous of the adult zebrafish eye. Using electrode forceps, the morpholino is then electroporated into all the cell types of the dorsal and central retina. Lissamine provides the charge on the morpholino for electroporation and can be visualized to assess the presence of the morpholino in the retinal cells. 
	Conditional knockdown in the retina can be used to examine the role of specific proteins at different times during regeneration. Additionally, this approach can be used to study the role of specific proteins in the undamaged retina, in such processes as visual transduction and visual processing in second order neurons.