우리는 비디오 제작과 우수한 지원 밀라노 Scimone에 감사하고 있습니다.

HIV에 감염된 혈액 샘플 처리가 중요한 권고 사항이 필요합니다. 혈액의 모든 표본은 강력한 누출 방지 용기에 이송해야합니다. 컨테이너의 외관 및 표본 함께 모든 서류의 오염을 방지하기 위해 표본을 수집시주의해야합니다. 감염된 혈액을 처리하는 모든 사람은 장갑을 착용해야합니다. 장갑이 변경 및 손을 표본 처리 완료 후 세탁해야합니다. HIV에 감염된 혈액 샘플의 처리는 클래스 II 생물 학적 캐비닛 후드에서 수행되어야합니다. 기계 pipetting 보조를 사용해야합니다. 바늘이나 다른 샵스 (유리 예 : pipettes 또는 모세관 튜브 포함)의 사용은 아무런 대안이 없다는있는 경우로 제한되어야합니다. 실험실 표면은 혈액의 유출 후 적절한 화학 살균제로 소독해야하며 작업 활동을 완료하는 경우. 사용 오염된 물질은 재사용 전에 소독해야하거나 임상 폐기물 경로를 통해 정확하게 폐기해야합니다. 중재가 효과가 즉시 시작되어야합니다와 같은 잠재적으로 전염성이 혈액이나 체액 (즉, 이러한 요구하는 보편적인 예방 조치)에 직업 노출의 모든 사건은 응급으로 치료해야합니다. 프로토콜은 완성 오일이 필요합니다. 기간은 그림 1에 자세히 있습니다. 박테리아 종은 그림 2에서 설명한 방법을 사용 구분됩니다. 1. 샘플 컬렉션 <ol><li> 전체 혈액 9 ML은 EDTA (에틸렌 다이아 민 테트라 초산) 포함 튜브로 그린 것입니다. </li><li> 튜브는 플라즈마를 얻을 RT 10 분 2000 RPM에서 centrifuged 있습니다. </li><li> 플라즈마 멸균이 ML - Eppendorf 튜브에 수집됩니다. </li></ol> 2. 플라즈마 샘플에서 DNA 추출 <ol><li> 적절히 후드, pipettes 및 불임을 보장하기 위해 실험에 필요한 자료를 소독. </li><li> 최소한 30 분 동안 자외선 불빛 아래에서 모든 자료를 놓습니다. </li><li> 살균제로 소독 장갑을 닦으십시오. </li><li> 에탄올 몇 종이 타올을 만끽하고 후드 아래에 그들을 놓으십시오. 때마다 팁을는 젖은 종이 타월에 피펫을 닦아 삭제됩니다. </li></ol> DNA는 제조 업체의 지침 (예 : Easy - DNA 키트, Invitrogen, 칼스 배드 CA, 미국) 다음과 같은 상용 키트를 사용하여 추출됩니다. <ol start="5"><li> 플라즈마 350 μL은 살균 2ml eppendorf 튜브에 배치됩니다. </li><li> 필터링 ultrapure 물 350 μL는 대조군으로 사용됩니다. </li><li> 샘플로 라이 소 자임 (1mg/ml) 10 μL를 추가합니다. </li><li> 37 30 분 품어 ° C. </li><li> 용해 용액 500 μL를 추가하고 샘플을 부드럽게 섞는다. </li><li> 65 7 분 동안 품어 ° C. </li><li> 샘플에 클로로포름 900 μL를 추가합니다. </li><li> 샘플이 균일하게 점성 때까지 적극적으로 소용돌이. </li><li> 강수량 솔루션과 적극적으로 와동 200 μL를 추가합니다. </li><li> 단계를 분리하고 인터페이스를 형성 RT에서 10 분 동안 10,500 rpm으로 샘플을 원심 분리기. </li><li> 에탄올 100 % 1 ML를 포함하는 새로운 microcentrifuge 관에 상단 수성 단계를 전송합니다. </li><li> 4 10 분 10,500 RPM에서 샘플을 원심 분리기 ° C. </li><li> 에탄올을 제거합니다. </li><li> 에탄올 70 % 1ml를 추가합니다. </li><li> 4 10 분 최대 속도로 샘플을 원심 분리기 ° C. </li><li> 에탄올을 제거합니다. 잔여 에탄올은 pipettator로 제거하여야한다. </li><li> ultrapure 물 50 μL의 펠렛을 Resuspend. </li><li> 분광 광도계로 DNA 농도를 읽으십시오. </li></ol> 3. 16 rRNA 유전자 PCR PCR 증폭은 앞에서 설명한 9로 수행됩니다. <ol><li> 10X PCR 버퍼, 25 MM MgCl2 5 μL, 2 MM 총 dNTPs 5 μL, 50 μm의 프라이머 RW01 (AACTGGAGGAAGGTGGGGAT) 1 μL, 50 μm의 프라이머 DG74 1 μL의 10 μL로 구성된 100 μL 반응 혼합물에서 DNA를 증폭 (AGGAGGTGATCCAACCGCA), H20 34 μL와 DNA 형성 촉매 효소 (AmpliTaq 골드, 응용 Biosystem, 포스터 시티, CA, 미국) 0.5 μL. </li><li> 박테리아 DNA 형성 촉매 효소에 의해 오염 가능성을 방지하기 위해 필터의 PCR 믹스를 전송합니다. </li><li> 4 500 RCF에서 30 분 원심 분리기 필터 (Microcon, Millipore, 빌레 리카, MA, 미국) ° C. </li><li> (긍정적이고 부정적인 PCR 컨트롤, 샘플 및 추출 물) 증폭해야 샘플의 개수에 따라 나누어지는 PCR 믹스. </li><li> 다음과 같은 온도 조건에 자전거 타는 사람 사용 : 94 ° 10 분 C, 94시 일분 때마다 40 번 ° C, 55 ° C 72 ° C, 72 ° C. 10 분 </li><li> 2 % 아가로 오스 겔에 PCR 제품을 시각화. 100 BP의 DNA의 사다리를 사용하십시오. PCR 제품 크기는 360 BP (그림 3)입니다. </li></ol> 4. PCR 제품 정화 단지 PCR 양성 샘플은 정화되어야합니다. 정화는 사용이 수행됩니다상용 키트 다음과 같은 제조 업체의 지침 (PureLink PCR microkit, Invitrogen, 칼스 배드 CA, 미국). <ol><li> PCR 제품의 1 볼륨 당 이소프로판올를 포함하는 바인딩 버퍼 4 볼륨을 추가합니다. </li><li> 열 바인딩 버퍼와 PCR 제품을 전송합니다. </li><li> RT에서 10,000 RCF에서 1 분 원심 분리기. </li><li> 에탄올을 포함 씻어 버퍼와 컬럼을 씻으십시오. </li><li> RT에서 10,000 RCF에서 1 분 원심 분리기. </li><li> 실리카 막 건조하고 에탄올과 잔여 씻으 버퍼를 제거하는 RT에서 1 분 최대 속도로 원심 분리기. </li><li> ultrapure 물 10 μL를 추가합니다. </li><li> RT에서 1 분 알을 품다. </li><li> 정화 DNA를 수집하기 위해 RT에서 2 분 동안 최대 속도로 원심 분리기. </li></ol> 5. 복제 Lysogeny 맛을 (LB) 플레이트 준비 <ol><li> 물을 약 800 ML에 LB 믹스 25 GR을 디졸브. </li><li> 1 L.로 최종 볼륨을 가지고 </li><li> Bactoagar 15 GR을 추가합니다. </li><li> 20 분 압력솥. </li><li> autoclaving 후에 적극적으로 소용돌이 술병의 솔루션은 녹은 한천을 섞어. </li><li> 50 ° C.에 대한 해결책을 쿨 </li><li> 암피실린 (50 μg / ML)와 소용돌이가 해체까지를 추가합니다. </li><li> 약 3mm의 깊이로 번호판을 하거라. </li><li> 상온에서 접시를 둡니다. </li><li> 37 각 LB 판과 부화에 확산 X - 걸 (40mg/ml)와 IPTG (100 ㎜) ° C 사용할 준비까지. </li></ol> 관할 셀 변환 변환은 상용 키트 다음과 같은 제조 업체의 지시 사항을 (토포 TA 클로닝 키트, Invitrogen, 칼스 배드 CA, 미국)를 사용하여 수행됩니다. <ol><li> 복제 반응 믹스 (신선한 PCR 제품 1-4 μL, 소금 용액 1 μL, 벡터 및 물 필요한 경우 1 μL) 준비합니다. </li><li> 부드럽게 반응을 혼합하고 RT에서 5-10분 위해 알을 품다. </li><li> 얼음에서 반응을 놓으십시오. </li><li> 관할 세포의 유리병으로 복제 반응 2 μL를 추가하고 부드럽게 섞는다. </li><li> 30 분 얼음에 품어. </li><li> 42 30 초 동안 열 충격 세포 ° C. </li><li> 즉시 얼음에 튜브를 전송합니다. </li><li> 중간 250 μL를 추가합니다. </li><li> tighly 튜브 캡 37에서 수평 튜브를 흔들 ° C를 1 시간. </li><li> prewarmed 선택 접시에 각각의 변환부터 50 μL를 벌리고. </li><li> 37 밤새 품어 ° C. </li></ol> 다음 부화, 흰색과 파란색 식민지가 접시에 개발할 수 있습니다. 화이트 식민지는 PCR 제품 삽입에 대한 긍정이며, 파란색 식민지 PCR 제품 삽입에 대해 아무것도 없습니다. 6. 시퀀싱 분석 시퀀싱 반응 <ol><li> 2,5 μl DNA 1 μl 프라이머 (μl / 5pmol) 1,1 μl BigDye (응용 Biosystem, 포스터 시티, CA, 미국) : 믹스는이 시약을 사용하여 이루어집니다. </li><li> 자전거 타는 사람 열 조건 : 96 ° 일분에 대한 C, 4 분 15 초 및 60 ° C 10 초, 55 ° C에 대해 96 ° C 25 번. </li></ol> 열 정제 <ol><li> 각 반응 들어, 하나의 MicroSpin 칼럼 (Qiagen, 밀란, 이탈리아)를 준비합니다. </li><li> 수지를 섞어 열과 와동 반전. </li><li> 칼럼의 맨 아래를 뜯어보면, ¼ 뚜껑을 느슨하게 설정하고, microcentrifuge 관에서 개최 칼럼. </li><li> 1 분 3,200 RPM을 원심 분리기. </li><li> 깨끗한 microcentrifuge 튜브에 열을 전송. </li><li> 조심스럽게 pipet 칼럼의 중심에 전체 배열 PCR 반응. </li><li> 1 분 3,200 RPM을 원심 분리기. </li><li> 정화의 DNA는 튜브 (ultrapure 물 20 μl)에 eluite합니다. </li></ol> 시퀀싱 분석 <ol><li> 96 multiwell 판에 정화 샘플 (20 μl)을로드합니다. </li><li> 시퀀서에 접시를로드합니다. 자동 DNA의 Sequencers은 시퀀스 실행의 결과를 보여주는 4 색 크로마토 그램을 생성합니다. </li><li> 공개 시퀀스 데이터베이스에 대한 쿼리로 뉴클레오 티드 시퀀스 입력. 검색은 기본 지역 정렬 검색 도구 (BLAST)와 함께 NCBI 데이터베이스 및 서버에서 수행됩니다. </li><li> 98~100%의 homologies에서만 박테리아를 고려하십시오. </li></ol> 7. 대표 결과 <img src="/files/ftp_upload/2830/2830fig1.jpg" alt="그림 1" /> 그림 1. 절차의 타임 라인. <img src="/files/ftp_upload/2830/2830fig2.jpg" alt="그림 2" /> 그림 2. 전체 세균성 식별 절차의 흐름 차트. <img src="/files/ftp_upload/2830/2830fig3.jpg" alt="그림 3" /> 그림 3. 광범위한 범위 16 rRNA 유전자 PCR 제품을 보여주는 2% 아가로 오스 겔. 레인 1은 100bp의 DNA 사다리를 포함, 레인 2 PCR 긍정적인 컨트롤을 포함, 레인 3 부정적인 PCR 컨트롤을 보여줍니다. 레인 4 HIV 양성 환자에서 샘플을 보여줍니다, 그리고 레인 5 물이 포함되어 있습니다. 레인 6 쉬건강한 개인 및 부정적인 PCR 반응에서 ows 샘플, 레인 7 물이 포함되어 있습니다. 만이 HIV 양성 환자는 긍정적인 PCR 증폭을 표시합니다. 추출 단계에서 대조군으로 사용 Ultrapure의 물, 오염이 발생 없다는 것을 나타냅니다. <img src="/files/ftp_upload/2830/2830fig4.jpg" alt="그림 4" /> 플라스미드 보여주는 그림 4. 0.7 % 아가로 오스 겔은 miniprep 절차를 추출. 레인 1 1 Kilobase의 DNA를 사다리를 포함, 레인 2 블루 제어 식민지, 12 3 백색 식민지를 포함하는 차선을 포함하고 있습니다. 파란 식민지에서 플라스미드는 PCR 제품의 삽입을 포함하지 않습니다. 총 10 개의 백색 식민지는 올바른 삽입과 플라스미드가 포함되어 있습니다. <img src="/files/ftp_upload/2830/2830fig5.jpg" alt="그림 5" /> 그림 5. 하나 HIV 양성 개인의 플라즈마 세균 시퀀싱 분석의 예를 보여줍니다. 우리의 결과는 HIV 질환에서 미생물의 translocation이 세균 translocation을 제어에 창자가 면역의 실질적인 실패를 제안 HIV - 부정적인 과목에서 볼 수없는 polimicrobic 식물을, 포함 것으로 나타났습니다.

<ol>
	<li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+commensal+intestinal+bacteria+and+the+immune+system.">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li><li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease.">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li><li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection.">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li><li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+disease:+fallout+from+a+mucosal+catastrophe.">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li><li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection.">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+associated+with+sustained+failure+in+CD4++T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy.">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Microbial+Translocation+and+Immune+Hyperactivation+in+Disease+Progression+of+HIV++Patients+with+Preserved+CD4+Count+in+the+Absence+of+ART.">Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART.</a> , (2010).</li><li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria,+including+bacteria+found+in+cerebrospinal+fluid.">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li></ol>

관심 없음 충돌 선언하지 않습니다.

<p class="jove_content"&gt; 우리는 이에 HIV에 감염된 개인의 주변 혈액에 박테리아의 translocation을 특성화하기 위해 PCR / 시퀀싱 프로토콜을 보여줍니다.</p&gt;<p class="jove_content"EDTA (에틸렌 다이아 민 테트라 초산) 함유 튜브에 수집한 플라즈마를 사용하는 경우&gt; 대부분의 신뢰할 수있는 결과를 얻을 수 있습니다. 혈액 샘플링 후, 플라즈마는 haemolysis 및 DNA 조각 저하를 피하기 위해, 3분의 2 시간 이내에 원심 분리로 구분?...

<table border="1"><tbody><tr><th> 시약의 이름 </th><th> 회사 </th><th> 카탈로그 번호 </th><th> 댓글 (옵션) </th></tr><tr><td> Easty - DNA 키트 </td><td> Invitrogen </td><td> K 180,001 </td><td></td></tr><tr><td> 클로로포름 </td><td> 시그마 - 알드리치 </td><td> C2432 </td><td></td></tr><tr><td> 에탄올 </td><td> 시그마 - 알드리치 </td><td> E7203 </td><td></td><tr/><tr><td> UltraPure Waer </td><td> Invitrogen </td><td> 10977049 </td><td></td></tr><tr><td> 라이 소 자임 </td><td> Fluka </td><td> 62,970 </td><td> 10 Distillated 물에 μg / ML </td></tr><tr><td> AmpliTaq 골드 </td><td> 응용 Biosystem </td><td> 26478701 </td><td></td></tr><tr><td> Microcon 100 </td><td> Millipore </td><td> 42,413 </td><td></td></tr><tr><td> PCR primers </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> 아가로 오스 </td><td> Eppendorf </td><td> C1343 </td><td></td></tr><tr><td> DNA 사다리 </td><td> Invitrogen </td><td> 15628019 </td><td></td></tr><tr><td> Purelink PCR 마이크로 키트 </td><td> Invitrogen </td><td> K310050 </td><td></td></tr><tr><td> LB 아가르, 분말 </td><td> Invitrogen </td><td> 22700025 </td><td></td></tr><tr><td> Bactoagar </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> 암피실린 </td><td> Invitrogen </td><td> 11593027 </td><td> 10 Distillated 물에 MG / ML </td></tr><tr><td> X - 여자 </td><td> Invitrogen </td><td> 15520034 </td><td> DMF에 40mg/mL </td></tr><tr><td> IPTG </td><td> Invitrogen </td><td> 15529019 </td><td> Distillated 물속에 100mM </td></tr><tr><td> 토포 TA 클로닝 키트 </td><td> Invitrogen </td><td> K450002 </td><td></td></tr><tr><td> Purelink 빠른 플라스미드 Miniprep 키트 </td><td> Invitrogen </td><td> K210010 </td><td></td></tr><tr><td> 빅 염료 </td><td> 응용 Biosystem </td><td> 4,337,455 </td><td></td></tr><tr><td> DyeEx 2.0 스핀 키트 </td><td> Qiagen </td><td> 63,204 </td><td></td></tr></tbody></table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

건강한 위장관은 생리학적으로 체액성 및 세포 점막 면역 시스템 1,2의 발전에 영향을 공생 미생물의 큰 다양성에 의해 식민지입니다. Microbiota은 강한 점막 장벽을 통해 면역 시스템에서 격리됩니다. 감염 및 항생제는 정상적인 위장관의 장벽 가능한 면역 이상에 3 발생할 수 있습니다 상주 세균의 구성을 모두 변경하는 것으로 알려져 있습니다. HIV는 면역 체계 활성화 4-7에 기여하는 등 lipopolysaccharide와 박테리아 DNA 조각과 같은 세균 bioproducts,의 체계 순환에 점막 면역 및 누설의 진보적인 장애와 위장 장애에 위반됩니다. 미생물 translocation은 HIV / AIDS immunopathogenesis 및 치료 4,8에 대한 응답으로 연관되어 있습니다. 우리는 HIV에 감염된 환자의 말초 혈액에 translocating 박테리아의 구성을 특징으로 목표. 우리의 목표를 추구하기 위해 우리는 시퀀싱 분석을 다음 panbacteric 16 ribosomial 유전자에 대해 PCR 반응을 설정합니다. 간단히, 모두 HIV에 감염된 건강한 과목에서 전체 혈액이 사용됩니다. 건강한 개인이 정상적인 창자 항상성을 제시 것을 감안할 때 microflora에 대한 translocation 이러한 환자에서 예상되지 않습니다. venipuncture와 플라즈마 분리하여 전체 혈액 컬렉션을 따라 DNA는 플라즈마에서 추출 및 유전자 9 ribosomial panbacteric 16에 대한 광범위한 PCR 반응을 수행하는 데 사용됩니다. 다음 PCR 제품 정화, 복제 및 시퀀싱 분석이 수행됩니다.

Watch this Scientific Journal Video about Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients at JoVE.com

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

우리의 실험은 HIV 양성 환자의 말초 혈액에서 translocating 세균 종의 시퀀싱 분석을 수행하는 방법을 보여줍니다.

주변 혈액에 세균 Microflora의 시퀀싱 : HIV에 감염된 환자 경험

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Research

JoVE Journal

Medicine

12.2K 조회수.  San Paolo Hospital University of Milan, Italy. 우리의 실험은 HIV 양성 환자의 말초 혈액에서 translocating 세균 종의 시퀀싱 분석을 수행하는 방법을 보여줍니다.

비디오: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Modeling Intracerebral Hemorrhage in Mice: Injection of Autologous Blood or Bacterial Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related hospitalizations and for which no effective treatments are available to date1,2. Because of the heterogeneity of ICH in humans, various preclinical models are needed to thoroughly explore prospective therapeutic strategies3. Experimental ICH is commonly induced in rodents by intraparenchymal injection of either autologous blood or bacterial collagenase4. The appropriate model is selected based on the pathophysiology of hemorrhage induction and injury progression. The blood injection model mimics a rapidly progressing hemorrhage. Alternatively, bacterial collagenase enzymatically disrupts the basal lamina of brain capillaries, causing an active bleed that generally evolves over several hours5. Resultant perihematomal edema and neurofunctional deficits can be quantified from both models. In this study, we described and evaluated a modified double injection model of autologous whole blood6 as well as an ICH injection model of bacterial collagenase7, both of which target the basal ganglia (corpus striatum) of male CD-1 mice. We assessed neurofunctional deficits and brain edema at 24 and 72 hr after ICH induction. Intrastriatal injection of autologous blood (30 &mu;l) or bacterial collagenase (0.075U) caused reproducible neurofunctional deficits in mice and significantly increased brain edema at 24 and 72 hr after surgery (p&lt;0.05). In conclusion, both models yield consistent hemorrhagic infarcts and represent basic methods for preclinical ICH research.

Clinically relevant animal models of intracerebral hemorrhage (ICH) are needed to extend our knowledge of hemorrhagic stroke and to examine novel therapeutic strategies. In this study, we describe and evaluate two ICH models that implement unilateral injections of either autologous whole blood or bacterial collagenase into the basal ganglia (corpus striatum) of mice.

마우스의 모델링 Intracerebral 출혈 : Autologous 혈액이나 세균 Collagenase의 주입

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related ...

연구

의학

Measuring Frailty in HIV-infected Individuals. Identification of Frail Patients is the First Step to Amelioration and Reversal of Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased reserve and resistance to stressors increases in incidence with increasing age. In the elderly, frailty may pursue a step-wise loss of function from non-frail to pre-frail to frail. We studied frailty in HIV-infected patients and found that ~20% are frail using the Fried phenotype using stringent criteria developed for the elderly1,2. In HIV infection the syndrome occurs at a younger age.
HIV patients were checked for 1) unintentional weight loss; 2) slowness as determined by walking speed; 3) weakness as measured by a grip dynamometer; 4) exhaustion by responses to a depression scale; and 5) low physical activity was determined by assessing kilocalories expended in a week's time. Pre-frailty was present with any two of five criteria and frailty was present if any three of the five criteria were abnormal.
The tests take approximately 10-15 min to complete and they can be performed by medical assistants during routine clinic visits. Test results are scored by referring to standard tables. Understanding which of the five components contribute to frailty in an individual patient can allow the clinician to address relevant underlying problems, many of which are not evident in routine HIV clinic visits.

Frailty syndrome is commonly seen in the aged and reflects multi-system physiological change. However, with reduced functional reserve and resilience frailty is also known to be common in the HIV infected population. This study outlined an easily administered screening test to identify HIV patients with frailty. When significant components of frailty are identified, clinicians will be able to focus on amelioration of the problem and promote reversion to the pre-frail state.

HIV에 감염된 개인의 연약함을 측정합니다. 허약 환자의 식별 개량과 연약함 환입하는 첫 번째 단계입니다

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased ...

Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic conditions. As part of a diagnostic assessment, the early detection of postural deficits is important so that appropriate and targeted interventions can be prescribed. The Sensory Organization Test (SOT) on the EquiTest determines an individual&#39;s use of the sensory systems (somatosensory, visual, and vestibular) that are responsible for postural control. Somatosensory and visual input are altered by the calibrated sway-referenced support surface and visual surround, which move in the anterior-posterior direction in response to the individual&#39;s postural sway. This creates a conflicting sensory experience. The Motor Control Test (MCT) challenges postural control by creating unexpected postural disturbances in the form of backwards and forwards translations. The translations are graded in magnitude and the time to recover from the perturbation is computed.
Intermittent claudication, the most common symptom of peripheral arterial disease, is characterized by a cramping pain in the lower limbs and caused by muscle ischemia secondary to reduced blood flow to working muscles during physical exertion. Claudicants often display poor balance, making them susceptible to falls and activity avoidance. The Ankle Brachial Pressure Index (ABPI) is a noninvasive method for indicating the presence of peripheral arterial disease and intermittent claudication, a common symptom in the lower extremities. ABPI is measured as the highest systolic pressure from either the dorsalis pedis or posterior tibial artery divided by the highest brachial artery systolic pressure from either arm. This paper will focus on the use of computerized dynamic posturography in the assessment of balance in claudicants.

Individuals with intermittent claudication exhibit poor balance compared to healthy controls. Computerized dynamic posturography is an objective method for measuring an individual's postural responses to balance disturbances. This provides an objective reflection of the person&#x2019;s ability to respond to situations under which sensory stimuli are altered and unexpected perturbations occur.

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic ...

Assessment of Vascular Function in Patients With Chronic Kidney Disease

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this is only partially explained by traditional CVD risk factors. Vascular dysfunction is an important non-traditional risk factor, characterized by vascular endothelial dysfunction (most commonly assessed as impaired endothelium-dependent dilation [EDD]) and stiffening of the large elastic arteries. While various techniques exist to assess EDD and large elastic artery stiffness, the most commonly used are brachial artery flow-mediated dilation (FMDBA) and aortic pulse-wave velocity (aPWV), respectively. Both of these noninvasive measures of vascular dysfunction are independent predictors of future cardiovascular events in patients with and without kidney disease. Patients with CKD demonstrate both impaired FMDBA, and increased aPWV. While the exact mechanisms by which vascular dysfunction develops in CKD are incompletely understood, increased oxidative stress and a subsequent reduction in nitric oxide (NO) bioavailability are important contributors. Cellular changes in oxidative stress can be assessed by collecting vascular endothelial cells from the antecubital vein and measuring protein expression of markers of oxidative stress using immunofluorescence. We provide here a discussion of these methods to measure FMDBA, aPWV, and vascular endothelial cell protein expression.

The degree of vascular dysfunction and contributing physiological mechanisms can be assessed in patients with chronic kidney disease by measuring brachial artery flow-mediated dilation, aortic pulse-wave velocity, and vascular endothelial cell protein expression.

만성 신장 질환 환자에서 혈관 기능의 평가

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

II-45 동계 쥐의 Mesothelioma 모델에서 소성을 주입 및 주변 면역 세포 모니터링

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Endotoxin Activity Assay for the Detection of Whole Blood Endotoxemia in Critically Ill Patients

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis and septic shock. The early identification of an infectious process that is rapidly evolving to a critical illness might prompt a quicker and more intensive treatment, thereby potentially leading to better patient outcomes. The Endotoxin Activity (EA) assay can be used at the bedside as a reliable biomarker of systemic endotoxemia. The detection of elevated endotoxin activity levels has been repeatedly shown to be associated with an increased disease severity in patients with sepsis and septic shock. The assay is quick and easy to perform. Briefly, after sampling, an aliquot of whole blood is mixed with an anti-endotoxin antibody and with added LPS. Endotoxin activity is measured as the relative oxidative burst of primed neutrophils as detected by chemioluminescence. The assay&#39;s output is expressed on a scale from 0 (absent) to 1 (maximal) and categorized as &#8220;low&#8221; (&#60;0.4 units), &#8220;intermediate&#8221; (0.4&#8211;0.59 units), or &#8220;high&#8221; (&#8805;0.6 units). The detailed methodology and rationale for the implementation of the EA assay are reported in this manuscript.

We hereby present a protocol to measure at the bedside the endotoxin activity of human whole blood samples. The Endotoxin Activity assay is a simple test to perform and may be a useful biomarker in critically ill patients with sepsis.

중증 환자에서 전혈 내독소 혈증 검출을 위한 내독소 활성 분석

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis ...

Semi-quantitative Assessment Using [18F]FDG Tracer in Patients with Severe Brain Injury

Patients with severe traumatic brain injury (sTBI) have difficulty knowing whether they are accurately expressing their thoughts and emotions because of disorders of consciousness, disrupted higher brain function, and verbal disturbances. As a consequence of an insufficient ability to communicate, objective evaluations are needed from family members, medical staff, and caregivers. One such evaluation is the assessment of functioning brain areas. Recently, multimodal brain imaging has been used to explore the function of damaged brain areas. [18F]-fluorodeoxyglucose positron emission tomography-computed tomography ([18F]FDG-PET/CT) is a successful tool for examining brain function. However, the assessment of brain glucose metabolism based on [18F]FDG-PET/CT is not standardized and depends on several varying parameters, as well as the patient&#39;s condition. Here, we describe a series of semiquantitative assessment protocols for a region-of-interest (ROI) image analysis using self-produced [18F]FDG tracers in patients with sTBI. The protocol focuses on screening the participants, preparing the [18F]FDG tracer in the hot lab, scheduling the acquisition of [18F]FDG-PET/CT brain images, and measuring glucose metabolism using the ROI analysis from a targeted brain area.

Semi-quantitative Assessment Using [18F]FDG Tracer in Patients with Severe Brain Injury

[18F]-fluorodeoxyglucose (FDG) positron emission tomography-computed tomography is useful for studying glucose metabolism related to brain function. Here, we present a protocol for an [18F]FDG tracer set-up and semiquantitative assessment of the region-of-interest analysis for targeted brain areas associated with clinical manifestations in patients with severe traumatic brain injury.

심한 뇌 손상 환자에서 [18F] FDG 추적 프로그램을 사용 하 여 반 정량적 평가

Patients with severe traumatic brain injury (sTBI) have difficulty knowing whether they are accurately expressing their thoughts and emotions because of ...

Integration of Brain Tissue Saturation Monitoring in Cardiopulmonary Exercise Testing in Patients with Heart Failure

Cerebral hypo-oxygenation during rest or exercise negatively impacts the exercise capacity of patients with heart failure with reduced ejection fraction (HF). However, in clinical cardiopulmonary exercise testing (CPET), cerebral hemodynamics is not assessed. NIRS is used to measure cerebral tissue oxygen saturation (SctO2) in the frontal lobe. This method is reliable and valid and has been utilized in several studies. SctO2 is lower during both rest and peak exercise in patients with HF than in healthy controls (66.3 &#177; 13.3% and 63.4 &#177; 13.8% vs. 73.1 &#177; 2.8% and 72 &#177; 3.2%). SctO2 at rest is significantly linearly correlated with peak VO2 (r = 0.602), oxygen uptake efficiency slope (r = 0.501), and brain natriuretic peptide (r = -0.492), all of which are recognized prognostic and disease severity markers, indicating its potential prognostic value. SctO2 is determined mainly by end-tidal CO2 pressure, mean arterial pressure, and hemoglobin in the HF population. This article demonstrates a protocol that integrates SctO2 using NIRS into incremental CPET on a calibrated bicycle ergometer.

This protocol integrated near-infrared spectroscopy into conventional cardiopulmonary exercise testing to identify the involvement of the cerebral hemodynamic response in exercise intolerance in patients with heart failure.

심부전 환자에서 심폐 운동 테스트에서 뇌 조직 포화 모니터링의 통합

Cerebral hypo-oxygenation during rest or exercise negatively impacts the exercise capacity of patients with heart failure with reduced ejection fraction ...

Real-Time Monitoring of Neurocritical Patients with Diffuse Optical Spectroscopies

Neurophysiological monitoring is an important goal in the treatment of neurocritical patients, as it may prevent secondary damage and directly impact morbidity and mortality rates. However, there is currently a lack of suitable non-invasive, real-time technologies for continuous monitoring of cerebral physiology at the bedside. Diffuse optical techniques have been proposed as a potential tool for bedside measurements of cerebral blood flow and cerebral oxygenation in case of neurocritical patients. Diffuse optical spectroscopies have been previously explored to monitor patients in several clinical scenarios ranging from neonatal monitoring to cerebrovascular interventions in adults. However, the feasibility of the technique to aid clinicians by providing real-time information at the bedside remains largely unaddressed. Here, we report the translation of a diffuse optical system for continuous real-time monitoring of cerebral blood flow, cerebral oxygenation, and cerebral oxygen metabolism during intensive care. The real-time feature of the instrument could enable treatment strategies based on patient-specific cerebral physiology rather than relying on surrogate metrics, such as arterial blood pressure. By providing real-time information on the cerebral circulation at different time scales with relatively cheap and portable instrumentation, this approach may be especially useful in low-budget hospitals, in remote areas and for&#160;monitoring in open fields (e.g., defense and sports).

Presented here is a protocol for non-invasively monitoring cerebral hemodynamics of neurocritical patients in real-time and at the bedside using diffuse optics. Specifically, the proposed protocol uses a hybrid diffuse optical systems to detect and display real-time information on cerebral oxygenation, cerebral blood flow and cerebral metabolism.

확산 광학 분광법을 이용한 신경중증 환자의 실시간 모니터링

Neurophysiological monitoring is an important goal in the treatment of neurocritical patients, as it may prevent secondary damage and directly impact ...

Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) can manifest fine motor disorders of the upper extremities. Handwriting is a complex and unique human activity involving both motor and cognitive coordination. Researchers from western countries have discovered that patients with MCI have abnormal handwriting features. However, no relevant studies have been conducted in the Chinese population. Owing to the cross-culture phenomenon of handwriting, the aim of this study is to find new handwriting tasks to demonstrate the differences in handwriting features between elderly patients with MCI and age-matched healthy individuals.

This study proposed a digital handwriting analysis of characters in individuals with mild cognitive impairment to find more information than is revealed by traditional pencil&#8211;paper handwriting analysis.

경증 인지 장애가있는 중국 환자의 문자 디지털 필기 분석

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) ...