이 작업은 최대 플랑크 협회의 지원을받는되었다.

1. Matrigel 코팅 플레이트와 미디어의 작성 <ol><li> Matrigel - 코팅 접시에 Matrigel의 준비는 EBS를 차별화의 첨부 파일 선호하는 기판이 발견 있으며,이 10 일부터 뉴런의 효율적인 가지를 촉진하고 있습니다. <ol><li> 얼음에 박 Matrigel의 해동 10 ML. </li><li> 다음 날, 얼음처럼 차가운 DMEM/F-12의 두 권으로 젤리 같은 Matrigel을 희석하여 -20 ° C.에서 냉동 저장 될 수 있습니다 prechilled 15 ML 원뿔 튜브에 1 ML의 aliquots을 준비 </li><li> neuronal 차별화 판 형식에 따라 결정합니다. 예를 들어, 시작 지점으로, 우리는 12도 형식의 차별화의 초기 원형을 수행하는 것이 좋습니다. 4 ° C.에서 사전 시원한 사 12 잘 접시 모든 prediluted Matrigel는 해동하고 해산 될 때까지 위아래로 pipetting 다음 사전 차가운 DMEM/F-12 9 ML을 추가하여 냉동 Matrigel 중 하나 나누어지는을 분해. </li><li> 그때, 얼음 (최종 Matrigel 희석 : 1:75)에 DMEM/F-12 15 ML를 포함하는 새로운 50 ML 튜브에 내용을 전송합니다. 그런 다음 미리 냉각 12도 플레이트의 각도에 희석 Matrigel의 0.5 ML를 추가합니다. Parafilm으로 접시를 정리하고 하루 아침에 RT에 서 보자. </li><li> 다음 날, 4 ° C.에 접시를 전송 코팅 플레이트는 사용하기 전에 몇 주 동안 저장 될 수 있습니다. </li></ol></li><li> 미디어 </li></ol> EB 형성 매체 (한 96 - 웰 플레이트에 차별화를 수행하기 위해 필요한 ~ 15 ML - 그림 2의 표 1과 계획을 참조하십시오) : DMEM/F-12 0.4과 % (PVA) 1X N2 1X B27 0.05 % BSA 20 NG / ML FGF2 10 μM Y-27632 1X PenStrepGln 차별화 매체 (한 96 - 웰 플레이트에 차별화를 수행하기 위해 필요한 ~ 30 ML, 그 중 하나 Matrigel 코팅 12 잘 플레이트에 신경 형성 한 다음, 표 1 참조) : DMEM/F-12 1X N2 <br/&gt; 1X B27 0.05 % BSA 0.5 μM PD0325901 15 μM의 SB431542 0.5 μM의 Dorsomorphin 1X PenStrepGln 2. 강제 EB 형성 <ol><li> 선호하는 피더 - 무료 조건 하에서 hPSCs 성장. 우리는 Matrigel 코팅 6 잘 플레이트 15 일 MEF이 설치된 매체를 사용합니다. 그러나, 수제 또는 상업적 정의 미디어 등 다른 문화 시스템은 작동합니다. 차별화의 실험을 시작하는 때, hPSCs 하위 합류 적극적으로 성장해야합니다. </li><li> 기계적 스테레오 현미경으로 멸균 플라스틱 피펫 팁을 사용하여 자발적으로 차별화 된 식민지를 제거합니다. </li><li> 1X Y-27632을 포함 Accutase를 사용하여 하나의 셀에 PBS 및 알림을 사용하여 남아있는 undifferentiated 식민지을 씻는다. EB 형성 매체와 hematocytometer를 사용하여 셀 titre을 결정의 작은 볼륨에 resuspend 2 분, 200 XG에서 원심 분리하여 펠렛 단일 세포. </li><li> 에 세포의 나누어지는을 추가ML 당 40,000 달러 그리고 80,000 세포 사이의 titre 될 수있는 나머지 EB 형성 매체입니다. </li><li> 멀티 채널 피펫 사용하여 잘 당 4,000 8,000 셀의 결과, 96V 아래로 판에 잘 당 100 μl를 전송합니다. 1 분 400 XG에서 스윙 아웃 플레이트 원심 분리기의 회전 96 - 웰 플레이트는 우물의 맨 아래에있는 세포를 수집하고, 세포 문화 인큐베이터로 전송합니다. 그림 1에 표시된 것과 같이 EBS는 하루 아침에 형성됩니다. </li></ol> 3. Neuroectoderm 유도 <ol><li> 다음 날 (일 0), 차별화 매체 2 ML을 포함하는 3.5 cm 세균 요리로 작은 볼륨에서 스테레오 현미경 및 전송에서 96V 접시에서 EBS를 수집합니다. 부드럽게 EBS를 씻어하는 데 몇 초 정도의 요리를 선동. </li><li> 100 차별화 매체의 μl 당 잘 울트라 - 로우-첨부 U-하단 96 - 웰 플레이트를 추가합니다. stereomicroscope 아래 96U-우물로 세척 접시에서 작은 볼륨으로 전송 EBS (우리 당 하나의 EB붙인다). neuroectoderm 형성을 허용하는 4 일간 세포 배양 배양기에 장소 96U 판. </li></ol> 4. 신경 세포 형성 <ol><li> 일 4 일 단계 3.1에서와 같이 세척 접시를 준비하고 추가로 차별화 매체 (물론 당 1 ML)에 의한 사전 예열 Matrigel 코팅 12 잘 판에 DMEM/F-12를 교체하십시오. </li><li> EBS의 도금 <ol><li> 96U 판에서 EBS를 수집,이 위, 그리고 조심스럽게 씨앗에게 씻어 그 Matrigel 코팅 12 잘 접시의 우물에 하나 (물론 당 약 8 EBS)의 하나 EBS는 동등의 방해받지 가지를 허용하도록 우물에서 배포되어야한다 다음 일 동안 뉴런 (그림 2의 &quot;일 5&quot;이미지 참조). </li><li> 보육에 12 잘 판을 다시 양도하기 전에, EBS는 느슨하게 RT에서 약 10 분에 연결 할 수 있습니다. 그런 다음, 세포 배양 배양기에 12 잘 판을주의 깊게 전송합니다. 뉴런은 우로서 다음 4 일 이내에 방사형 방식으로 도금 EBS에서 알아 성장그림 2에서 wn ( &quot;일 8&quot;오른쪽 이미지). </li></ol></li></ol> 5. Monolayers 등의 신경 조직 <ol><li> 포인트 4 단계의 대안으로), 절차의 4 일에서 차별화 매체 2 ML을 포함하는 3.5 cm 세균 그릇에 EBS를 수집 한 다음에 다음 PBS 함유 음식에 작은 볼륨으로 EBS를 전송하고, Accutase를 포함하는 다른 음식. </li><li> 차별화 매체의 작은 볼륨에 resuspend 하나의 세포, 2 분 200 XG에서 원심 분리기로 소화하고 hematocytometer를 사용하여 셀 titre를 결정하자. 차별화 매체를 (Y-27632이없는)를 사용하여 ML 당 1 2X10 6 셀에 titre를 조정합니다. </li><li> 사전 예열 Matrigel 코팅 12 잘 플레이트 (물론 당 1 ML) 및 세포 문화 인큐베이터로 전송에 판 세포 아웃. monolayers으로 신경 세포 형성은 일 7-8 (그림 3C) 사이에 관찰되었다. 그것은 그러나, 주목해야합니다 그의 monolayer 변종절차는 완전히 세포 생존과 가장 적합한 기판에 적용되는 최적화되어 있지 않습니다. </li></ol>

<ol>
	<li>Thomson, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+derived+from+human+blastocysts.">Embryonic stem cell lines derived from human blastocysts.</a> Science. 282, 1145-1147 (1998).</li><li>Takahashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+adult+human+fibroblasts+by+defined+factors.">Induction of pluripotent stem cells from adult human fibroblasts by defined factors.</a> Cell. 131, 861-872 (2007).</li><li>Koch, P., Opitz, T., Steinbeck, J. A., Ladewig, J., Brustle, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rosette-type,+self-renewing+human+ES+cell-derived+neural+stem+cell+with+potential+for+in+vitro+instruction+and+synaptic+integration.">A rosette-type, self-renewing human ES cell-derived neural stem cell with potential for in vitro instruction and synaptic integration.</a> Proc. Natl. Acad. Sci. U.S.A. 106, 3225-3230 (2009).</li><li>Chambers, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+neural+conversion+of+human+ES+and+iPS+cells+by+dual+inhibition+of+SMAD+signaling.">Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling.</a> Nat. Biotechnol. 27, 275-280 (2009).</li><li>Lee, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+directed+differentiation+of+neural+crest+stem+cells+derived+from+human+embryonic+stem+cells.">Isolation and directed differentiation of neural crest stem cells derived from human embryonic stem cells.</a> Nat. Biotechnol. 25, 1468-1475 (2007).</li><li>Li, X. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specification+of+motoneurons+from+human+embryonic+stem+cells.">Specification of motoneurons from human embryonic stem cells.</a> Nat. Biotechnol. 23, 215-221 (2005).</li><li>Pera, M. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+human+embryonic+stem+cell+differentiation+by+BMP-2+and+its+antagonist+noggin.">Regulation of human embryonic stem cell differentiation by BMP-2 and its antagonist noggin.</a> J. Cell Sci. 117, 1269-1280 (2004).</li><li>Smith, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Activin/Nodal+signaling+promotes+specification+of+human+embryonic+stem+cells+into+neuroectoderm.">Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm.</a> Dev. Biol. 313, 107-117 (2008).</li><li>Greber, B., Lehrach, H., Adjaye, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+early+fate+decisions+in+human+ES+cells+by+distinct+states+of+TGFbeta+pathway+activity.">Control of early fate decisions in human ES cells by distinct states of TGFbeta pathway activity.</a> Stem Cells Dev. 17, 1065-1077 (2008).</li><li>Greber, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FGF+signalling+inhibits+neural+induction+in+human+embryonic+stem+cells.">FGF signalling inhibits neural induction in human embryonic stem cells.</a> EMBO J. 30, 4874-4884 (2011).</li><li>Anderson, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Familial+dysautonomia+is+caused+by+mutations+of+the+IKAP+gene.">Familial dysautonomia is caused by mutations of the IKAP gene.</a> Am. J. Hum. Genet. 68, 753-758 (2001).</li><li>Lee, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+pathogenesis+and+treatment+of+familial+dysautonomia+using+patient-specific+iPSCs.">Modelling pathogenesis and treatment of familial dysautonomia using patient-specific iPSCs.</a> Nature. 461, 402-406 (2009).</li><li>Burridge, P. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+human+embryonic+stem+cell+embryoid+body+homogeneity+and+cardiomyocyte+differentiation+from+a+novel+V-96+plate+aggregation+system+highlights+interline+variability.">Improved human embryonic stem cell embryoid body homogeneity and cardiomyocyte differentiation from a novel V-96 plate aggregation system highlights interline variability.</a> Stem Cells. 25, 929-938 (2007).</li><li>Watanabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ROCK+inhibitor+permits+survival+of+dissociated+human+embryonic+stem+cells.">A ROCK inhibitor permits survival of dissociated human embryonic stem cells.</a> Nat. Biotechnol. 25, 681-686 (2007).</li><li>Xu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Feeder-free+growth+of+undifferentiated+human+embryonic+stem+cells.">Feeder-free growth of undifferentiated human embryonic stem cells.</a> Nat. Biotechnol. 19, 971-974 (2001).</li><li>Burridge, P. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+universal+system+for+highly+efficient+cardiac+differentiation+of+human+induced+pluripotent+stem+cells+that+eliminates+interline+variability.">A universal system for highly efficient cardiac differentiation of human induced pluripotent stem cells that eliminates interline variability.</a> PLoS One. 6, e18293 (2011).</li></ol>

관심 없음 충돌이 선언 없습니다.

우리 이전에 다음 ID로 출판 절차 10을 포함 hPSCs,에서 EB 형성을 포함한 대부분의 차별화 프로토콜은 수동 또는 필연적 EB 크기로 이질성로 연결 집계 등 hESCs의 효소를 이용한 수확을 기반으로합니다. 이 사실은이를 중간 처리량 규모에서, 특히 체계적인 분석이 어려운 렌더링, 일부 세포 라인 차별화 효율의 변화로 연결됩니다. 또한, 수동 해부 자체가 확장 성을 떨어 뜨리고있는 노동 집약적이다. 대조적으로, 여기에 설명 된 방법은 샘플 사이의 세포 처리 및 최소화 다양성을 용이하게 단일 세포에서 EB 형성에 기반을두고 있습니다. 중요한 것은, 우리는 뉴런에 전체 차별화 용량은 스핀 EBS와 프로토콜을 시작에 영향을되지 않는 것으로 나타났습니다. 또한, 유지 96 - 웰 정지 플레이트를 사용하는 방법에 의해 서로 분리 개인 EBS는 t을 방지종래의 절차 (10)의 또 다른 단점을 제시 - 정지 서로 통합에서까지. 결과적으로, 주어진 실험을 시작하는 데 필요한 입력 hPSCs의 양이 subconfluent hPSC의 식민지 6 - 잘 접시의 잘 약 하나가 일반적으로 두 96 - 웰 플레이트에서 차별화를 시작하기에 충분한 점에서 부족합니다. 마지막으로, 스핀 EB 기술은 EB 크기 이상 꼭 제어 할 수 있습니다. 우리의 관찰에 따르면, neuronal 마커의 표현 수준은 도금 EBS (그림 3A)의 증가 크기가 어느 정도 증가하는 경향이 있습니다. 다른 한편으로는, 너무 큰 EBS는 도금 후 괴사 센터를 표시하는 경향이 있습니다. 따라서, 타협으로, 우리는 4000 8,000 세포 EBS는 적절한 범위로 발견했다. 높은 효율성으로 인해, 단순함, 속도, 비용 효율성, 우리는 설명 방법은 기능 연구를위한 유용한 플랫폼으로 예상, 질병 모델링 인간의에게 필요한ensory 뉴런, 또는 모든 유형의 뉴런을 필요로하는 중간 처리 셀 기반의 약리 assays. 후자의 응용 프로그램에 대해 이러한 높은 콘텐츠를 영상으로 자동 분석과의 호환성이 바람직 할 것입니다. 이것은, 그러나, 도금 EBS의 외주 만 outgrowing 뉴런이 분석 될 수 있다는 사실에 의해 손상 될 수 있습니다. 이 장애물을 회피하기 위해, 우리는 또한 프로토콜의 일 4시에 EBS를 dissociating 및 단일 세포를 도금하여 뉴런의 monolayers를 생성하려고 시도했습니다. 사실, 그림 3C의 데이터는 뉴런이 약 60 %의 합리적인 효율성을 형성하는 것이 좋습니다. 그러나, 우리는 프로토콜의 변화는 더 다른 첨부 파일 기판을 사용하여 예를 들어, 탐색 및 최적화 될 수 있다는 제안이 조건에서 세포 생존에 감소를 관찰. (단계 5.2 일-4 세포를 도금시 Y-27632의 추가는 도금 후 세포 생존을 촉진 한뿐만 아니라 w를 방해 등장i 번째 이후의 neuronal 차별화하고이 때문에 생략합니다.) 또한, 그것은 또한 프로토콜의 두 번째 단계의 중간 성분을 변화하여 뉴런의 다른 유형이 플랫폼으로 생성 될 수 있는지의 여부도 조사 할 재미있을 것입니다. 또한, 일 0시 96U 모양의 우물로 96V에서 EBS의 전송에 관련하여, 그것은 궁극적으로 설명 방법의 높은 처리량 호환성을 달성하기 위해, 다중 채널 pipetting에 따라 절차를 고안하는 것이 바람직 할 것입니다.

hPSCs는, 상기 배아를 파생 인간 배아 줄기 세포 (hESCs)와 유도 만능 줄기 세포 (hiPSCs)을, 그들은 체외 1-2에 다양한 세포 lineages을 야기 할 수있는 만능 의미합니다. 수많은 차별화 된 세포 유형은 이러한 세포 연구 및 세포 기반 스크리닝 방법에 대한 유용한 도구를 제시하고, 셀 기반의 치료학에 대한 약속을 보유하는 개념을 지원하는 최신 hESCs에서 파생되었습니다. 그들은 종종 관심을 3-6 주어진 신경 세포 종류에 신경 progenitors의 수동 고립, 그리고 이후의 터미널 차별화에 이어 첫번째 유도 전반적인 신경 운명에 기초로 hESCs에 대한 Neuronal 차별화 프로토콜은 일반적으로 복잡하고 시간이 많이 소요됩니다. 어떤 점에서,이 복잡성은 초기 인간 발달, whic을 모방 등 최첨단의 지시 차별화 프로토콜은 stepwise 경향이 있다는 것을 감안하면 놀라운과 피할 수 없습니다H는 그 자체로 매우 복잡합니다. 한편,이 부분도 지금까지 완전히 최적화되지 여전히 차별화 프로토콜의 결과로, 기본 분자 프로세스에 대한 이해의 부족이 반영 될 수 있습니다. neuroectoderm, 페라 외에 undifferentiated hPSCs의 전환에 관해서이 있습니다. BMP / SMAD1/5/8 신호의 억제는 hESCs 7 신경 유도를 향상 것으로 나타났습니다. 또한, SMAD2 / 3 신호의 불 활성화는 neuroectoderm 형성 팔을 홍보하기 위해 표시되었습니다. 따라서,이 두 경로의 결합 불 활성화는 hPSCs 4,9을보다 효율적으로 신경 유도로 연결하는 경향이있다. 최근, 우리는이 세 신호 경로는 FGF / ERK는 hESCs의 neuroectodermal의 노력의 초기 단계 강력한 억제 역할을하는 것으로 나타났습니다. 반대로, 모든이 세 경로의 동시 억압이와 neuroectoderm로 hESCs의 거의 균일 전환 될10 단 사일 인치 그 후, 기능 뉴런에 고효율 터미널 차별화은 8 일 이내에 관찰되었다. 획득 뉴런이 부분에서 자신의 빠른 파생 열을 설명 할 수 있습니다 주변 신경계의 감각 뉴런 될 가능성이 있었다. 감각 신경 세포의 유지 보수에 결함이 이러한 가족 dysautonomia 11와 같은 특정 인간의 장애의 원인을 받고 있습니다. 이러한 추가 기능 특성에 대한 hiPSC 기술을 12 일 기준으로 질환,뿐만 아니라 뉴런의 특정 유형을 필요로하지 적용 목적으로 모델링를 들어,이 차별화 절차 유용한 근거를 제시 할 수 있습니다. 그러나, 차별화를 우리가 원래 hESC의 식민지 10 clumps에서 배아 기관의 참여 형성 (EBS)를 고용 전략, 그리고이 EB 크기에 대한 이질성의 꽤 정도의 결과, 또한 일부 CE에 신경 형성의 효율성을 손상 등장붙인다 라인. 또한, EB 크기의 이질성으로 인해 체계적으로 신경 세포 형성 과정과 이후로 추가 성장 요인 또는 작은 분자의 효과를 테스트 할 수있는 능력이 다소 실마리를 못 찾고 할 것처럼 보였다. 이 보고서에서, 우리는 또한 다른 상황 13과 같이 매우 크기 제어 방식으로 EBS를 생성하는 중간 처리량 호환, 강제 집합 기반 기술에 우리의 이전 절차를 적응. 그 후, EBS는 정지 neuroectoderm 형성을 시작하려면, 96 - 웰 플레이트의 V 자형 우물 U 자형 초저 첨부 파일 플레이트 96도로 전송 된에서 생성. 나흘 후, EBS는 높은 효율성과 동질성의 말기 차별화 된 뉴런에 상승을주는 아웃 도금 될 수 있습니다. 또한, 하루 4 EBS는 단일 셀에 dissociated 있었고, 인간의 뉴런의 저밀도 monolayers 결과하는 등의 아웃 도금. 일관된 결과는 지금까지이 독립적으로 드와 함께 얻었다rived hESC 라인, HuES6 및 NCL3. 전제 조건으로 성공적으로 EB 형성 함께 hESC의 생존 13-14을 촉진하는 것으로 알려져 ROCK 억제제 Y-27632과 합성 폴리머, 폴리 비닐 알코올 (PVA)의 사용에 엄격히 의존했다. 그 결과, EBS의 동질성은 96 V-플레이트 년에 설립이 실질적으로 무작위로 분할 기법에 따라 대량 문화 등 EBS의 형성에 비해 향상되었습니다. 이 시스템은 따라서 점착성의 조건 하에서 철저히 통제되고 신경 세포 형성에 이어 서스펜션 문화에 neuroectoderm 형성을위한 대폭 개선 된 플랫폼을 제공합니다.

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td><td> 코멘트 </td></tr><tr><td> Matrigel HC </td><td> Becton 디킨슨 </td><td> 354263 </td><td> 처리에 대한 자세한 내용은 텍스트를 참조하십시오 </td></tr><tr><td> DMEM/F-12 </td><td> 생명 기술 </td><td> 21331-020 </td><td></td></tr><tr><td> 폴리 (비닐 알코올) </td><td> 시그마 </td><td> 363170 </td><td> 초음파 waterbath를 사용하여 DMEM/F-12에 0.4 %에서 분해 / 과열 방지 / 4에서 ° C 몇 주 동안 계속 될 수있다 </td></tr><tr><td> N2의 보충 </td><td> 생명 기술 </td><td> 17502-048 </td><td> 100X, 냉동 aliquots로 저장 </td></tr><tr><td> B27 보충 </td><td> 생명 기술 </td><td> 12587-010 </td><td> 냉동 aliquots로 50X, 저장 </td></tr><tr><td> 소 혈청 알부민 </td><td> 시그마 </td><td> A1595 </td><td> 10% = 500X, 냉동 aliquots로 저장 </td></tr><tr><td> 페니실린 / 스트렙토 마이신과 L-글루타민 </td><td> PAA </td><td> P11-013 </td><td> 또는 동급 </td></tr><tr><td> FGF2 </td><td> Peprotech </td><td> 100-18B </td><td> 냉동 aliquots로 0.1 %에서 10 μg / ML에서 분해 BSA / PBS = 1000X, 저장 </td></tr><tr><td> ROCK 저해제 Y-27632 </td><td> abcamBiochemicals </td><td> ASC-129 </td><td> 냉동 aliquots로 DMSO = 1000X, 저장의 10 MM에 디졸브 </td></tr><tr><td> PBS </td><td> PAA </td><td> H15-002 </td><td> 또는 동급 </td></tr><tr><td> Accutase </td><td> PAA </td><td> L11-007 </td><td></td></tr><tr><td> 96 - 웰 V-바닥 판 </td><td> Nunc </td><td> 277143 </td><td></td></tr><tr><td> PD0325901 </td><td> 축삭 Medchem </td><td> 축삭 1408 </td><td> 냉동 aliquots로 DMSO = 1000X, 저장에 0.5 밀리미터에 디졸브 </td></tr><tr><td> SB431542 </td><td> abcamBiochemicals </td><td> ASC-163 </td><td> 냉동 aliquots로 DMSO = 1000X, 상점에서 15 MM에 용해 </td></tr><tr><td> Dorsomorphin </td><td> 산타 크루즈 (Santa Cruz) </td><td> SC-200689 </td><td> 냉동 aliquots로 DMSO = 1000X, 저장에 0.5 밀리미터에 용해 </td></tr><tr><td> 96 - 웰 U-하단의 초저 첨부 파일 플레이트 </td><td> 코닝 </td><td> 7007 </td><td></td></tr><tr><td> 베타-III의 Tubulin 항체 (마우스) </td><td> 시그마 </td><td> T8660 </td><td> 1:1000에서 사용 </td></tr><tr><td> 베타-III의 Tubulin 항체 (토끼) </td><td> Covance </td><td> PRB-435P </td><td> 1:2000에서 사용 </td></tr><tr><td> BRN3A (POU4F1) 항체 </td><td> 산타 크루즈 (Santa Cruz) </td><td> SC-8429 </td><td> 1:500에서 사용 </td></tr><tr><td></td><td></td><td></td><td> 표 1. &lt;/ strong&gt;을 특정 시약 및 장비. </td></tr></tbody></table>

rapid and efficient generation of neurons from human pluripotent stem cells in a multititre plate format

인간 만능의 줄기 세포 (hPSCs)에서 뉴런의 생성을위한 기존 프로토콜은 종종 이전에 터미널 차별화에 신경 전구체 세포의 분리 및 확장을 포함하는 다단계 절차되기 때문에 지루한 수 있습니다. 이 시간이 많이 소요되는 방식에 비해, 우리는 최근 세 신호 경로, TGFβ/SMAD2, BMP/SMAD1, 그리고 FGF / ERK의 결합 억제가 작동 뉴런에 즉시 차별화 다음 hPSCs에서 neuroectoderm의 빠른 유도를 촉진하는 것으로 확인되었습니다. 여기, 우리는 더 이상 그 재현성을 향상하고 중간 처리 응용 프로그램과 호환하기 위해, 소설 multititre 판 형식으로 절차를 조정했습니다. 이 자기편 조건에서 뉴런으로 차별화의 다른 사일에 이어 부동 영역 (embryoid 기관)에 neuroectoderm 형성 4 일을 포함한다. 이 프로토콜을 획득 대부분의 세포는 양극성 감각 뉴런 것 같습니다. 또한,절차는 매우 효율적이다 특히 전문적인 기술을 필요로하지 않으며, 비용 효율적인 작은 분자로 간단한 화학적으로 정의 된 매체에 기반을두고 있습니다. 이러한 기능으로 인해, 절차는 더 기능적 조사를위한 유용한 플랫폼으로뿐만 아니라 세포 기반 스크리닝 인간의 감각 뉴런 또는 유형의 뉴런을 요구하는 접근에 사용될 수 있습니다.

이전 보고서에서, 많은 다른 사람들과 라인에, hPSCs에서 EBS가 낮은 첨부 요리 (10) 내로 hPSCs의 일상 분할시 응집체를 replating으로 간단하게 생성 할 수 있습니다. 결과 EB 크기 (그림 1C, 상단)의 다양한 배포판이 일반적으로 발생합니다. 이로 인해 또 다른 문제는 정지 유지 EBS는 EB 크기의 더 높은 이질성로 이어지는, 서로 통합 경향이 있다는 것입니다. 이러한 문제를 회피하기 위해, 우리는 따라서 multititre 플레이트의 낮은 첨부 파일 우물 (그림 1A)에 하나의 hPSCs을 도금하여 EBS를 생성하려고 시도했습니다. 이것은 EB 형성과 세포 사망 (그림 1B, 오른쪽 아래)에되었습니다. hPSCs에 대해 알려진 생존 분자를 적용, Y-27632는 비슷한 결과를 주었다. 마찬가지로, 이전 hESCs 16 EB 형성을 향상시키기 위해 표시되었습니다 적용 폴리 비닐 알코올 (PVA)는 96V의 맨 아래에있는 hPSCs &quot;을 수집&quot;하는 경향이- 우물이 있지만, EB 형성으로 이어질 없습니다. 그러나, PVA의 보완과 함께 Y-27632을 결합하면, 우리는 쉽게 화학적으로 정의 된 조건에서 hESCs의 단일 셀 중지 (그림 1b)에서 EBS를 생성 할 수있었습니다. 편리하게,이 multititre 판 형식의 EB 크기는 밀접하게 기존의 기술 (그림 1C, 하단)를 사용하여 대조적으로, 당 잘 세포의 서로 다른 번호를 퍼 뜨리고 의해 제어 될 수 있습니다. 96V 판에서 추가 배양 후, 그러나, EBS는 우물의 바닥에 붙어있었습니다. 따라서, EB 형성 다음날에, 그것은 매우 낮은 첨부 파일 96U 플레이트 (그림 1A)에 EBS를 전송하는 데 필요한되었습니다. Neuroectoderm 그 다음 PD0325901 (FGF / ERK 억제제), SB431542 (TGFβ/SMAD2 억제제)으로 구성된 작은 분자 칵테일을 사용하여이 형식으로 유도하고, dorsomorphin (BMP/SMAD1 억제제) 등 10 설명되어 있습니다. 다음은 neuroectoderm 형성(그림 2),이 작은 분자 칵테일을 사용하여 EBS는 표면이 Matrigel 코팅하는 경우에 한해, 어떤 형식에 뉴런을 야기 할 밝혀 도금 할 수 있습니다. 세포의 서로 다른 숫자 (그림 1C, 하단)와 EB 형성을 시작하면, 우리는 EBS가 가장 neuronal 차별화 용량을 얻을하는 경향이 8,000 셀 주위에서 생성 된 것으로 나타났습니다. 이것은 도금 후 괴사 EB 센터를 감소 도금 EBS, 및 BRN3A 및 β-III의 Tubulin (도 2 및도 3A, B)와 같은 감각과 범 neuronal 마커의 높은 표현의 발음 neuronal outgrowths이 특징입니다. 전체 neuronal 차별화 효율성은 hESCs과 hiPSCs 10 모두 적용될 수 있었던 원래의 절차 (~ 70 %) (그림 3)과 비교 된 것 같습니다. 우리는 지금까지 multiwell 프로 시저에 두 개의 독립적 인 hESC 라인, HuES6 및 NCL3을 고용 한 differentiatio의 세포 라인에 의존 다양성 반면N 효율은 일반적으로 배제 할 수 없습니다. hPSC - 파생 뉴런의 여러 응용 프로그램이 아닌 도금 EBS의 차별화 된 세포의 monolayers가 필요합니다. 따라서 우리는 또한 프로토콜의 일 4 (그림 2, 중)에서 putative neuroectodermal 전지 분야는 Accutase를 사용하여 하나의 셀에 dissociated 될 수 있는지의 여부도 조사 한 후 monolayers로 아웃 도금 할 수 있습니다. 사실, 일 4 neuroectodermal 세포의 단일 세포를 도금시, neuronal이 replated 세포의 분화 약 60 %의 효율 (그림 3C)에서 얻을 수 있습니다 발음. <img src="/files/ftp_upload/4335/4335fig1.jpg" alt="그림 1" fo:content-width="5.5in" fo:src="/files/ftp_upload/4335/4335fig1highres.jpg"/> 1 그림. EB 형성 절차. EB 형성 절차 A) 도식. differe의 개시 하루 전날<html> ntiation (D-1), 100 μl 당 수천 여러 셀을 포함하는 hESCs의 정지는 원심 분리 한 다음, 96V 우물에 놓는 있습니다. EBS는 더 치료 초저 첨부 파일 96U 우물로 전송됩니다 밤새 형성 될 수있다. B) EB 형성에 PVA와 Y-27632의 효과를 테스트합니다. EB 형성 만 PVA와 Y-27632 (화살표 머리 참조) 모두를 포함하는 매체에서 관찰 될 수 C) 톱 :. 종래의 방법에 의해 형성 EBS는 보통 크기의 이기종 있습니다. 아래 : EBS 입력 셀의 다른 번호를 사용하여 A.에 묘사 된 &#39;스핀 EB&#39;기법으로 형성, EB 크기가 단단하게 제어 할 수 있으며, 매우 균일 있었다. <a href="http://www.jove.com/files/ftp_upload/4335/4335fig1large.jpg" target="_blank">큰 그림을 보려면 여기를 클릭하십시오</a> . <html> 35fig2highres.jpg &quot;/&gt; 그림 2. 신경 세포 형성 흐름 차트는. 어느 날 차별화의 개시 (D-1) 전에 EBS는 지정된 EB 형성 매체를 사용하여 96V 접시에 생성됩니다. 96U 접시에 EBS의 양도시, 신경 유도는 차별화 매체를 사용하여 시작됩니다. 4 일후, EBS가 원하는 multiwell 형식의 Matrigel 코팅 우물에서 도금되어 있습니다. 대표 morphologies는 각 단계 표시됩니다. 오른쪽 사진은 도금 EBS의 전형적인 neuronal outgrowths 표시 -에서 높은 세포 밀도 영역을 매우 권리는 뉴런이 방사형 방식으로 성장하는 경향이있는 도금 EB 센터의 일부입니다. 또한, 하루 4, EBS는 단일 셀에 dissociated 수 있으며 monolayers (텍스트 및 자세한 내용은 3C 그림).로 터미널 차별화를 위해 밖으로 도금 <a href="http://www.jove.com/files/ftp_upload/4335/4335fig2large.jpg" target="_blank">큰 그림을 보려면 여기를 클릭하십시오</a> . ontent &quot;강한 : 유지 - together.within 페이지 =&quot;항상 &quot;&gt; <img src="/files/ftp_upload/4335/4335fig3.jpg" alt="그림 3" fo:content-width="5.5in" fo:src="/files/ftp_upload/4335/4335fig3highres.jpg"/> 그림 3. 뉴런의 특성화. 하루 A) 실시간 RT-PCR 특성화 팔 대량 neuronal 문화. 차별화 된 샘플에 신경 문장과 범 neuronal 마커 유전자 undifferentiated 제어 세포에 비해 강력 upregulated 있다고합니다. 16000 세포를 가지고 시작 샘플이 가장 neuronal 표현 수준 (로그 크기 조절에 유의), EBS를 보여 주었다 있지만 8,000 4,000 사이의 세포는 형태학의 기준에 따라 가장 유용한이었다. B) 도금 EBS에서 자라는 대부분의 세포가 양성 반응을 얼룩 뉴런 아르 베타 III의 Tubulin (적색) 및 감각 신경 세포 마커 BRN3A (녹색). C) 뉴런은 하나의 세포 도금 대신 EBS를 도금 후 형성했다. 프로토콜의 일 4 (그림 2), 부동 EBS는 Accutase를 사용하여 dissociated하고 말기 monolayers으로 차별화 할 하나의 세포로 알아 놓는했다. 세포 생존과 같은 EB 도금에 비해 다소 감소 할 것으로 보이는 반면으로 왼쪽에 표시, 베타-III의 Tubulin에 대한 긍정적 인 물들 것을 전형적인 neuronal 형태로 세포가 쉽게, 수득 하였다. 오른쪽 : neuronal 수율의 Immunocytochemistry 기반 정량화 (N + / 분석 = 3 담당자 섹션 - SD)를. <a href="http://www.jove.com/files/ftp_upload/4335/4335fig3large.jpg" target="_blank">큰 그림을 보려면 여기를 클릭하십시오</a> . <table border="1"><tbody><tr><td> 유전자의 이름 </td><td> Fwd의 프라이머 순서 </td><td> 수익 프라이머 순서 </td></tr><tr><td> ACTB (하우스 키핑 유전자) </td><td> TCAAGATCATTGCTCCTCCTGAG </td><td> ACATCTGCTGGAAGGTGGACA </td></tr><tr><td> RPL37A (하우스 키핑 유전자) </td><td> GTGGTTCCTGCATGAAGACAGTG </td><td> TTCTGATGGCGGACTTTACCG </td></tr><tr><td> DCX </td><td> AGGGCTTTCTTGGGTCAGAGG </td><td> GCTGCGAATCTTCAGCACTCA </td></tr><tr><td> ISL1 </td><td> TTTATTGTCGGAAGACTTGCCACTT </td><td> TCAAAGACCACCGTACAACCTTTATCT </td></tr><tr><td> MAPT </td><td> TTACCCTGGGCACTGGCCTA </td><td> TCCTGCTCAACATGGCAAACTC </td></tr><tr><td> NEUROD1 </td><td> GACTGATTGCACCAGCCCTTC </td><td> CGGACGGTTCGTGTTTGAAAG </td></tr><tr><td> NEUROG1 </td><td> CAGAGACAAGGAGTGGGCTTCA </td><td> CTCCAGCCCTGTGCCTGAAT </td></tr><tr><td> SOX10 </td><td> TCCTTGCCAGCTCCCTCTTC </td><td> CAAGGGTTAGGGCCTGAGCA </td></tr><tr><td> SYT4 </td><td> GCCAATCTCACCACCCAAATG </td><td> CACACACCATGCTTCCTTCCA </td></tr></tbody></table> 표 2. 프리 머은 RT-qPCR에 사용됩니다.

Watch this Scientific Journal Video about Rapid and Efficient Generation of Neurons from Human Pluripotent Stem Cells in a Multititre Plate Format at JoVE.com

Rapid and Efficient Generation of Neurons from Human Pluripotent Stem Cells in a Multititre Plate Format

만능 인간 줄기 세포의 neuronal 차별화 (hPSCs)에 대한 프로토콜은 종종 시간이 소요되어 있으며 상당한 세포 배양 기술을 필요로합니다. 여기, 우리는 통제 된 방식으로 인간의 뉴런의 간단 신속하고 효율적인 생성을 허용하는 multititre 판 형식으로 작은 분자 기반의 차별화 절차를 적응하고 있습니다.

Multititre 판 형식으로 인간 만능의 줄기 세포에서 뉴런의 신속하고 효율적인 생성

Existing protocols for the generation of neurons from human pluripotent stem cells (hPSCs) are often tedious in that they are  multistep procedures ...

rapid-efficient-generation-neurons-from-human-pluripotent-stem-cells

Nanyang Technological University

Research

JoVE Journal

Biology

43.5K 조회수.  Max Planck Institute for Molecular Biomedicine. 만능 인간 줄기 세포의 neuronal 차별화 (hPSCs)에 대한 프로토콜은 종종 시간이 소요되어 있으며 상당한 세포 배양 기술을 필요로합니다. 여기, 우리는 통제 된 방식으로 인간의 뉴런의 간단 신속하고 효율적인 생성을 허용하는 multititre 판 형식으로 작은 분자 기반의 차별화 절차를 적응하고 있습니다.

비디오: Rapid and Efficient Generation of Neurons from Human Pluripotent Stem Cells in a Multititre Plate Format

Generation of Human CD40-activated B cells

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer immunotherapy 1-3. Compared to Dendritic cells (DCs), the best characterized APC, CD40-B cells have several distinct biological and technical properties. Similar to DCs, B cells show an increased expression of MHC and co-stimulatory molecules (Fig.1b), exhibit a strong migratory capacity and present antigen presentation efficiently to T cells, after stimulation with interleukin-4 and CD40 ligand (CD40L). However, in contrast to immature or mature DCs, CD40-B cells express the full lymph node homing triad consisting of CD62L, CCR7/CXCR4, and leukocyte function antigen-1 (LFA1, CD11a/CD18), necessary for homing to secondary lymphoid organs (Fig.1a) 3. CD40-B cells can be generated without difficulties from very small amounts of peripheral blood which can be further expanded in vitro to very large amounts of highly-pure CD40-B cells (&gt;109 cells per patient) from healthy donors as well as cancer patients (Fig.1c,d) 1,4. 
In this protocol we demonstrate how to obtain fully activated CD40-B cells from human PBMC. Key molecules for the cell culture are CD40 ligand, interleukin-4 (IL-4) and cyclosporin A (CsA), which are replenished in a 3-4 day culture cycle. For laboratory purposes CD40-stimulation is provided by NIH/3T3 cells expressing recombinant human CD40 ligand (tCD40L NIH/3T3) 5. To avoid contamination with non-transfected cells, expression of the human CD40 ligand on the transfectants has to be checked regularly (Fig.2). 
After 14 days CD40-B cell cultures consist of more than 95% pure B cells and an expansion of CD40-B cells over 65 days is frequently possible without any loss of function 1, 4. CD40-B cells efficiently take up, process and present antigens to T cells 6. They do not only prime na&#970;ve, but also expand memory T cells 7,8. CD40-activated B cells can be used to study B-cell activation, differentiation and function. Moreover, they represent a promising tool for therapeutic or preventive vaccination against tumors 9.

In this video we present the ex vivo generation and expansion of human CD40-activated B cells (CD40-B) from peripheral blood mononuclear cells (PBMC) by stimulation with CD40 ligand and interleukin-4.

인간 CD40 - 활성화된 B 세포의 생성

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

연구

생물학

Transfecting and Nucleofecting Human Induced Pluripotent Stem Cells

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human embryonic stem cells (HESCs)1. While improvements in several gene delivery methods have been described2-9, transfection remains a capricious process for HESCs, and has not yet been reported in human induced pluripotent stem cells (iPSCs). In this video, we demonstrate how our lab routinely transfects and nucleofects human iPSCs using plasmid with an enhanced green fluorescence protein (eGFP) reporter. Human iPSCs are adapted and maintained as feeder-free cultures to eliminate the possibility of feeder cell transfection and to allow efficient selection of stable transgenic iPSC clones following transfection. For nucleofection, human iPSCs are pre-treated with ROCK inhibitor11, trypsinized into small clumps of cells, nucleofected and replated on feeders in feeder cell-conditioned medium to enhance cell recovery. Transgene-expressing human iPSCs can be obtained after 6 hours. Antibiotic selection is applied after 24 hours and stable transgenic lines appear within 1 week. Our protocol is robust and reproducible for human iPSC lines without altering pluripotency of these cells.

Despite recent advancements in genetic modification, transfection of human embryonic stem cells (HESCs) remains a capricious process. To our knowledge, systematic and efficient methods to transfect human induced pluripotent stem cells (iPSCs) have not been reported. Here, we describe robust protocols to efficiently transfect and nucleofect human iPSCs.

인간 유도 만능의 줄기 세포를 Transfecting 및 Nucleofecting

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

작은 분자와 유도 Pluripotent 인간 배아 줄기 세포로부터 인간 심장 엽 성의 전구 물질과 Cardiomyocytes의 효율 유도

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

GFP와 Retroviral 벡터를 사용하여 유도 Pluripotent 줄기 세포 (iPSCs)로 인간 체세포를 프로그래밍

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

유도 만능의 줄기 세포에서 파생 마우스의 생성

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Generation of Human Induced Pluripotent Stem Cells from Peripheral Blood Using the STEMCCA Lentiviral Vector

Through the ectopic expression of four transcription factors, Oct4, Klf4, Sox2 and cMyc, human somatic cells can be converted to a pluripotent state, generating so-called induced pluripotent stem cells (iPSCs)1-4. Patient-specific iPSCs lack the ethical concerns that surround embryonic stem cells (ESCs) and would bypass possible immune rejection. Thus, iPSCs have attracted considerable attention for disease modeling studies, the screening of pharmacological compounds, and regenerative therapies5.
We have shown the generation of transgene-free human iPSCs from patients with different lung diseases using a single excisable polycistronic lentiviral Stem Cell Cassette (STEMCCA) encoding the Yamanaka factors6. These iPSC lines were generated from skin fibroblasts, the most common cell type used for reprogramming. Normally, obtaining fibroblasts requires a skin punch biopsy followed by expansion of the cells in culture for a few passages. Importantly, a number of groups have reported the reprogramming of human peripheral blood cells into iPSCs7-9. In one study, a Tet inducible version of the STEMCCA vector was employed9, which required the blood cells to be simultaneously infected with a constitutively active lentivirus encoding the reverse tetracycline transactivator. In contrast to fibroblasts, peripheral blood cells can be collected via minimally invasive procedures, greatly reducing the discomfort and distress of the patient. A simple and effective protocol for reprogramming blood cells using a constitutive single excisable vector may accelerate the application of iPSC technology by making it accessible to a broader research community. Furthermore, reprogramming of peripheral blood cells allows for the generation of iPSCs from individuals in which skin biopsies should be avoided (i.e. aberrant scarring) or due to pre-existing disease conditions preventing access to punch biopsies.
Here we demonstrate a protocol for the generation of human iPSCs from peripheral blood mononuclear cells (PBMCs) using a single floxed-excisable lentiviral vector constitutively expressing the 4 factors. Freshly collected or thawed PBMCs are expanded for 9 days as described10,11 in medium containing ascorbic acid, SCF, IGF-1, IL-3 and EPO before being transduced with the STEMCCA lentivirus. Cells are then plated onto MEFs and ESC-like colonies can be visualized two weeks after infection. Finally, selected clones are expanded and tested for the expression of the pluripotency markers SSEA-4, Tra-1-60 and Tra-1-81. This protocol is simple, robust and highly consistent, providing a reliable methodology for the generation of human iPSCs from readily accessible 4 ml of blood.

Here we show a simple and effective protocol for the generation of human iPSCs from 3-4 ml of peripheral blood using a single lentiviral reprogramming vector. Reprogramming of readily available blood cells promises to accelerate the utilization of iPSC technology by making it accessible to a broader research community.

STEMCCA Lentiviral 벡터를 사용하여 말초 혈에서 인간 유도 만능 줄기 세포의 생성

Through the ectopic expression of four transcription factors, Oct4, Klf4, Sox2 and cMyc, human somatic cells can be converted to a pluripotent state, ...

Generation of Human Cardiomyocytes: A Differentiation Protocol from Feeder-free Human Induced Pluripotent Stem Cells

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is essential first to generate functional human cardiomyocytes (CMs). The use of these cells in drug discovery and toxicology studies would also be highly beneficial, allowing new pharmacological molecules for the treatment of cardiac disorders to be validated pre-clinically on cells of human origin. Of the possible sources of CMs, induced pluripotent stem (iPS) cells are among the most promising, as they can be derived directly from readily accessible patient tissue and possess an intrinsic capacity to give rise to all cell types of the body 1. Several methods have been proposed for differentiating iPS cells into CMs, ranging from the classical embryoid bodies (EBs) aggregation approach to chemically defined protocols 2,3. In this article we propose an EBs-based protocol and show how this method can be employed to efficiently generate functional CM-like cells from feeder-free iPS cells.

Pluripotent stem cells, either embryonic or induced pluripotent stem (iPS) cells, constitute a valuable source of human differentiated cells, including cardiomyocytes. Here, we will focus on cardiac induction of iPS cells, showing how to use them to obtain functional human cardiomyocytes through an embryoid bodies-based protocol.

인간의 Cardiomyocytes의 생성 : 피더없는 인간 유도 만능 줄기 세포에서 분화 프로토콜

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

고해상도 용융 분석과 PCR을 이용하여 신속하고 효율적인 Zebrafish의 유전자형

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

Efficient Production and Purification of Recombinant Murine Kindlin-3 from Insect Cells for Biophysical Studies

Kindlins are essential coactivators, with talin, of the cell surface receptors&#160;integrins and also participate in integrin outside-in signalling, and the control of gene transcription in the cell nucleus. The kindlins are ~75 kDa multidomain proteins and bind to an NPxY motif and upstream T/S cluster of the integrin &#946;-subunit cytoplasmic tail. The hematopoietically-important kindlin isoform, kindlin-3, is critical for platelet aggregation during thrombus formation, leukocyte rolling in response to infection and inflammation and osteoclast podocyte formation in bone resorption. Kindlin-3&#39;s role in these processes has resulted in extensive cellular and physiological studies. However, there is a need for an efficient method of acquiring high quality milligram quantities of the protein for further studies. We have developed a protocol, here described, for the efficient expression and purification of recombinant murine kindlin-3 by use of a baculovirus-driven expression system in Sf9 cells yielding sufficient amounts of high purity full-length protein to allow its biophysical characterization. The same approach could be taken in the study of the other mammalian kindlin isoforms.

Kindlins are fundamental to cell adhesion through integrins but studies of them have been hampered by the difficulty encountered in expressing them recombinantly in bacterial hosts. We describe here methods for their efficient production in baculovirus-infected insect cells.

의 효율적인 생산 및 정제 재조합 쥐과 Kindlin-3 생물 물리학 연구 곤충 세포에서

Kindlins are essential coactivators, with talin, of the cell surface receptors&#160;integrins and also participate in integrin outside-in signalling, and ...

Efficient Generation Human Induced Pluripotent Stem Cells from Human Somatic Cells with Sendai-virus

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs include modeling pathogenesis of human genetic diseases, autologous cell therapy after gene correction, and personalized drug screening by providing a source of patient-specific and symptom relevant cells. However, there are several hurdles to overcome, such as eliminating the remaining reprogramming factor transgene expression after human iPSCs production. More importantly, residual transgene expression in undifferentiated human iPSCs could hamper proper differentiations and misguide the interpretation of disease-relevant in vitro phenotypes. With this reason, integration-free and/or transgene-free human iPSCs have been developed using several methods, such as adenovirus, the piggyBac system, minicircle vector, episomal vectors, direct protein delivery and synthesized mRNA. However, efficiency of reprogramming using integration-free methods is quite low in most cases.
Here, we present a method to isolate human iPSCs by using Sendai-virus (RNA virus) based reprogramming system. This reprogramming method shows consistent results and high efficiency in cost-effective manner.

Here, we present our established method to reprogram human somatic cells into transgene-free human iPSCs with Sendai virus, which shows consistent outcome and enhanced efficiency.

센다이 바이러스와 인간의 체세포의 효율적인 생성 인간 유도 만능 줄기 세포

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs ...