우리는 실험실 지원되었습니다 Angelika 버그 감사합니다. 이 작품은 막스 플랑크 사회와 미생물 통신 (JSMC)에 대한 예나 학교에서 지원하고 자금을했다.

1. 곤충 사육 <ol><li> 구입 또는 스포 도프 테라의 계란 클러치를 얻을 자신의 양육에서 리토 랄. 부화 할 때까지 실온 (RT)에서 무균 배양 접시에서 그들을 유지합니다. </li><li> 다음과 같이 사육 곤충의 인공 사료를 준비합니다 : <ol><li> 물 100 ㎖에 하룻밤 500g 지상 흰 콩을 적신다. </li><li> H 2 O 증류수 1,000 ml로 9.0 g 아스 코르 빈산 및 75g의 한천을 추가하고, 그 후 가열한다. </li><li> 혼합물이 냉각하게하고 (흰색 밀랍 고체 혼합물) 응고 할 때 사용할 때까지 4 ° C에 보관하십시오. </li></ol></li><li> 조명의 16 시간과 어둠의 8 시간과 긴 하루 정권 깨끗한 플라스틱 상자와 23 ~ 25 ° C에서 인공 사료에 후면을에 부화 된 유생을 전송합니다. 애벌레가 여섯 애벌레 령충을 통과 할 때까지 매일 음식을 변경합니다. </li></ol> 대사 활성 창자 박테리아의 DNA의 2. 13 C-라벨 <ol><li> 증류수, 탈 이온수 (DDH 2 O)와 완벽하게 13 C-표지 된 포도당 186.1 mg의 용해 및 SIP 실험을위한 인공 사료 100 g을 잘 혼합. 인공 사료에 10 mm의 최종 13 C - 포도당 농도를 확인합니다. 이것은 S.의 창자에있는 현장의 포도당 농도를 모방 샤오 등에 따라면 식물에 리토 랄 유충의 먹이. (제출). </li><li> 전송 9-15 신선한 13 C - 포도당을 함유하는 멸균 플라스틱 페트리 접시 (세균 배양 용 접시 당 하나의 유충)에 사육 상자에서 건강한 두 번째 령 유충은 인공 사료를 아군. 한 바와 같이 대조군 수유를 들어, 네이티브 포도당 (글루코스 C-12)의 동일한 양을 함유하는 인공 사료를 사용한다. </li><li> 배양 기간 (1 일) 동안 자주 인공 사료를 갱신. 단계 1.3에서와 같이 양육 조건을 사용합니다. </li><li> 후 처리 (DNA 추출)에 대한 각각의 치료에서 아홉 애벌레를 수집합니다. 각각의세 개인에 의해 구성되고, 복제, 처리 당 적어도 세 개의 반복을합니다. </li></ol> 3. 곤충 해부 <ol><li> 깨끗하고 에탄올 70 % (도구 = Vannas 가위, 집게 및 미세 일회용 블레이드 메스)에 대한 작업의 시작 부분에 해부 도구를 소독. </li><li> 부드러운 집게와 곤충을 가지고 증류수로 표면적으로 자신의 피부를 씻는다. 를 마취하기 위해 적어도 30 분 동안 얼음에 배치합니다. </li><li> 여전히 그들을 죽일 1 시간 동안 0 ℃에서 장소를 마취하는 동안. 몇 분 에탄올 (70 %)에서 그들을 담가 표면으로 죽은 곤충을 소독. </li><li> 7.4으로 산도를 조정, 약 15 ㎖의 1X PBS의 멸균 페트리 접시 (1XPBS = 137 밀리의 NaCl, 2.7 밀리미터의 KCl, 4.3 mM의 나 2 HPO 4, 1.47 mM의 KH 2 PO 4에 증착의 볼륨으로 곤충 해부를 수행 , 오토 클레이브). 완전히 한 solut에 몰두 전체 곤충의 몸을 갖는하십시오전체 해부 기간 동안 이온. </li><li> 머리에 시작하여 항문에 완료, 오른쪽과 곤충의 왼쪽 측면을 따라 피부를 절개하여 절개를 시작합니다. 피부 전체, Malpighian 세관, 지방의 몸을 제거합니다. 창자를 열고 절단하기 전에 신선한 버퍼로 변경합니다. 절은 앞, 미드, 그리고 hindgut의 용기가 필요합니다. 냉동실에 조직을 보관 (-80 ~ -20 ℃)​​까지 D​​NA 추출 </li></ol> 4. DNA 추출 및 증폭 <ol><li> 1.5 ㎖의 멸균 원심 분리 관에있는 곤충의 조직을 놓고 진공 집중 장치에서 45 ° C에서의 모든 샘플을 건조. 멸균 플라스틱 유봉 건조 조직을 분쇄. </li><li> 토양 DNA 추출에 적합한 키트를 사용하여 게놈 DNA를 추출합니다. 키트의 반응 관에 건조 조직을 전송하고 제조업체가 표시된 지시 사항을 따르십시오. </li><li> 분광 광도계를 사용하여 최종 용출 된 DNA의 농도를 결정. </li><li> Verif와 1492r (5 - GGTTACCTTGTTACGACTT -3) - Eubacterial 일반 프라이머를 27F (AGAGTTTGATCCTGGCTCAG -3 5)를 사용하여 진단 PCR 분석을 준비하여 곤충의 창자에서 미생물 metagenomic DNA의 나중에 성공 추출. 다음과 같이 PCR 반응을 설정 <ol><li> 1X 버퍼, 1.5 mM의 MgCl2를, 10 mM의 네 옥시 뉴 클레오 시드 트리 포스페이트 (dNTPs를), 2.5 U의 Taq의 DNA 중합 효소, 각 프라이머의 0.5 ㎜, 템플릿으로 추출 된 DNA의 60 NG를 포함하는 50 ㎕의 반응 액을 설정합니다. </li><li> 30 초 동안 55 ° C에서 45 초, 어닐링 94 ° C, 1 분 72 ° C의 확장 :; 35 회 반복 처음 3 분 동안 94 ° C에서의 변성을 다음과 같이 열 순환기를 사용하여 PCR 반응을 실행 . 10 분 동안 72 ° C에서 최종 확장 단계를 사용합니다. </li><li> 1 % 아가로 오스의 성공적인 PCR 증폭 에티 디움 브로마이드 (EB) 스테인드 젤 (100 1X TAE 버퍼링 ㎖의 1μL EB와 얼룩에 아가로 오스의 1g을 용해) 전기 영동 확인합니다. 일의 예금 5 μL젤 주머니에 배의 로딩 염료 + 1μL 전자 PCR 제품. (1X TAE pH를 8로 조정, 40 MM 트리스 -베이스, 20 mM의 빙하 아세트산, 1 mM의 EDTA를 =). </li><li> CA에 대한 300 V, 115mA에서 1xTAE 버퍼를 사용하여 젤을 실행합니다. 전기 챔버에서 20 분. 젤 문서 실 (디지털 카메라를 컴퓨터에 연결 UV 트랜스 일루미네이터)를 사용하여 젤을 관찰하고도로드 유전자 마커를 사용하여 최종 제품의 크기를 비교, 증폭 산물의 정확한 크기는 약 1.5 KB이어야합니다. </li></ol></li><li> 우선적으로, 깊은 냉동 조건에서 PCR 제품을 보관 -80 ° C, 사용할 때까지. </li></ol> 5. DNA 분리 - CSCL 그라데이션 초 원심 분리 <ol><li> 다음과 같이 초 원심의 그라데이션의 시약을 준비 <ol><li> 점차 DDH 2 O에서 협동 학습의 603.0 g을 용해시켜 7.163 M 염화 세슘 (CSCL) 솔루션을 준비하고 500 ML의 최종 볼륨을 채워. </li><li> 정확하게 해제삼중 의해 세자리 밸런스에 1.0 ml의 분취 량을 계량하여 준비된 CSCL 용액의 밀도 테르. 이것은 일반적으로 1.88 및 1.89 g / ㎖에서 RT에서 배열한다. </li><li> 1 M 트리스-HCl (pH 8.0), 0.5 M EDTA 1 ㎖ (산도 8) 및 마지막에서의 KCl 3.75 g의 50 ㎖를 조합하여 구배 완충액 (100 mM 트리스, 100 ㎜의 KCl, 1 mM의 EDTA)를 준비 DDH 2 O를 사용하여 500 ㎖의 부피 (0.22 μm의) 필터이 솔루션을 살균 압력솥. </li></ol></li><li> DNA 분리 <ol><li> 포인트 4.3로 측정 처리 된 곤충의 개별 DNA 농도를 결정하는 데, 함께 복제에 대응하는 하나 하나가 동일하게 풀링 된 샘플에 기여하고 있는지 확인하기 위해 DNA 농도를 정상화하는 곤충을 풀. DNA의 500 ~ 5,000 NG (다시 최종 농도를 측정)의 최종 농도는 원심 분리 공정 (21)에 적합하다. </li><li> 그라데이션 매체를 설정하려면, 정량화 된 DNA, 그라데이션 버퍼를 결합D 4.8 멸균 15 ML 스크류 캡 튜브 (그라데이션 중간 DNA 혼합물의 생성)에 6.0 ㎖를 혼합 볼륨에 함께 7.163 M 협동 학습 솔루션의 ML. </li><li> 조심스럽게 주사기와 바늘을 사용하여 (튜브 목의 기초까지 기입) 5.1 ㎖의 초원 심 분리기 튜브로 제조 된 그라데이션 중간 DNA 혼합물을 배치합니다. 공기 방울을 펌핑하거나 형성하지 마십시오. 참조 그라데이션 각 원심 분리기 실행에 (대신 DNA의 DDH 2 O를 사용하여) 하나 이상의 빈 그라디언트를 포함합니다. </li><li> 각 필수 그라데이션 매체 후 중량 10 ㎎ 이내로 밸런스 관 쌍은 각각의 초원 심 분리기 튜브로 가득 차 있습니다. &quot;튜브 토퍼&quot;로 튜브를 밀봉하고 인감 누출이없는 튜브를 반전 손으로 적당한 압력을 적용하여 있는지 확인합니다. </li><li> 초 원심 5.1 ML의 원심 분리 튜브를 들고 8 개의 우물에 가까운 수직 로터를 사용합니다. 조심스럽게 로터 우물을 봉인하고 엄마에 따라 초 원심 분리기로 로터를로드nufacturer의 지시. 초 원심 분리 조건을 설정 스핀을 진공 40 시간 동안 실행 시간 50,000 (177,000 XG 정도) 회전 수, 온도 20 ° C에서, 및 초 원심에서. 브레이크없이 최대 가속과 감속을 선택합니다. </li><li> 일단 완료, 조심스럽게 집게를 사용하여 원심 분리기 회 전자에서 튜브를 제거합니다. 튜브 내에서 형성 그라데이션을 방해하지 않고 랙에 배치합니다. 가능한 빨리 임의의 확산을 최소화하기 위해 구배 분획 샘플들을 처리한다. </li></ol></li><li> 분별로 Isopycnic 분리 그라디언트에서 DNA의 검색 <ol><li> 똑같이 초원 심 분리기 관 정상 변위 방법에서 형성 그라데이션을 구분하는 그라데이션 분별을 수행하기 위해 정확한 HPLC 펌프 시스템을 사용합니다. DDH 2 O 1 L 변위로 채워진 병에 HPLC 펌프 (100 % 흐름 구배를) 연결하고 단단히 주사기 바늘에 23 G 1 오픈 펌프 호스에 연결합니다. 충분한 B 추가그것을 다크 블루 색상을 제공하기 위해 DDH 2 O에 파란색 염료를 romophenol. 이것은 그라데이션 매체 DDH 2 O.의 변위 사이의 인터페이스의 시각화를 용이 </li><li> 850 μL / 분의 유속으로 펌프를 설정하고, 블루 컬러 DDH 2 O 주사기 바늘 밖으로 나온다 한 방울까지 시스템을 평형. </li><li> 조심스럽게 클램프 스탠드에 초원 심 분리기 튜브를 수정하고 긴 바늘에 주사기 23 G 1 관의 바닥을 관통. 관의 상부에 펌프 호스에 부착 된 바늘을 삽입하여 초원 심 분리기 튜브에 펌프를 연결하고, 직접 멸균 1.5 ML의 마이크로 원심 튜브에 바닥에서 방울을 수집합니다. 약 425 분수 당 μL 및 그라데이션 당 12 분수의 총 금액, 일부마다 30 초를 수집합니다. 마지막 부분 (부분 12) 일반적으로 변위 DDH 2 O를 포함하고 폐기해야합니다. </li><li> 분별 한 후에, 저단계 5.1.2에서 설명한 것처럼 분석 저울을 사용하여 모든 분리 된 분획의 밀도를 asure 수. </li><li> 첫 번째 DNA의 적은 양의 강수량을위한 캐리어로 (멸균 DDH 2 O에서 20 ㎍ / μL) 1 μL 글리코겐을 추가하여 (425 μL 정도) 각 부분의 DNA를 침전. 반전으로 잘 섞는다. </li><li> 폴리에틸렌 글리콜 (PEG) 용액 (500 ml의 총 부피에 폴리에틸렌 글리콜 6000 150g과 DDH 2 염화나트륨 O 46.8 g을 용해의 두 개의 볼륨 (850 μL)를 추가합니다. 필터, 살균 및 오토 클레이브. PEG 용액은 30입니다 % PEG 6000 1.6 M의 NaCl), 및 열 번 반전하여 다시 섞는다. </li><li> (필요한 경우 하룻밤) DNA를 침전 적어도 두 시간 동안 RT에서 튜브를 남긴다. </li><li> RT에서 30 분 동안 13,000 XG에서 침전물을 원심 분리기. 눈에 보이는 펠릿 형성한다. </li><li> 조심스럽게 피펫으로 뜨는을 제거하고 70 % 에탄올 500 μL로 펠렛을 씻으십시오. 동일에서 원심 분리기다시 10 분의 조건. </li><li> 조심스럽게 뜨는을 취소하고 15 분 동안 실온에서 펠렛을 공기 건조. </li><li> DDH 2 O 30 μL에서 건조 된 DNA 펠렛을 재용 부드럽게 튜브를 활용하여 잘 섞는다. 단계 4.3 스토어 -20 또는 -80 ° C에서 샘플을 장기 보관이 필요한 경우에 각 그라데이션 부분에있는 DNA의 양을. </li></ol></li></ol> 6. pyrosequencing 기법에 의한 DNA 특성 <ol><li> 13 C-표지 된 DNA는 약 1.720-1.735 ㎍ / ㎖의 밀도를 갖는 반면, 레이블이없는 네이티브 (12 C) DNA는 1.705 ㎍ / ㎖에서 1.720 ㎍ / ㎖의 농도 범위를 차지하고 있는지 확인합니다. 네이티브 및 환경 시료에서 추출 된 13 C-표지 된 DNA가 모두 몇 그라데이션 분수를 확장 할 수 있습니다. 빛 DNA 분수 9-11 분수 4-6과 연관 될 수있는 무거운 DNA와 연관 될 것으로 예상된다. </li><li> 하나의 &quot;컴파일&quot;대표 분수 교류를 만드는 주요 분수를 결합농도 - 해결 DNA의 특정 피크 할당으로 묶는. 대안 적으로, 이러한 구배 겔 전기 영동 (DGGE) (23)을 변성으로, 동위 원소 비율 질량 분석법 (IRMS) (22) 또는 핑거 프린팅 방법을 사용하여 분리 된 분획을 검사하는 다른 방법은 시퀀싱 전에 적절한 분획을 선택하는 것을 도울 수있다. </li><li> 각 그라데이션의 컴파일, 무거운 중간과 빛 분수에서 PCR 증폭 세균의 16S rRNA의의 유전자의 pyrosequencing 기법을 수행합니다. SIP이 방법의 혈통의 식별 및 대사 활성 박테리아 종의 상대 풍부하게 사용이 가능합니다 샘플을 배양 하였다. 다음과 같이 pyrosequencing 기법을 수행 <ol><li> 티타늄 시약 로슈 454 FLX 악기를 사용하여 앰플 리콘의 pyrosequencing 기법을 수행합니다. </li><li> 번째로 확장 (24, 25) (- - GAGTTTGATCNTGGCTCAG -3 5)과 Gray519r (GTNTTACNGCGGCKGCTG -3 5) Gray28F을 설정 융합 프라이머를 사용하여 다중에 대한 바코드 증폭 산물을 준비전자 각각의 프라이머 어댑터 A / B 및 샘플 별 다중 식별자 (MID). </li><li> 시퀀싱 라이브러리를 생성하기 위해, 핫 스타트의 Taq 중합 효소를 사용하여, 30 사이클을 가진 한 단계 PCR을 적용한다. </li><li> 공급 업체의 프로토콜에 따라 증폭 산물을 시퀀싱 및에 설명 된대로 진행 방향 (Gray28F)에서 읽어 연장 <a href="http://www.researchandtesting.com/">http://www.researchandtesting.com/</a> . </li></ol></li></ol> 7. pyrosequencing 기법 데이터 분석 <ol><li> 원시 시퀀스가 &quot;미생물 생태에 풍부한 통찰력&quot;, QIIME 소프트웨어 파이프 라인 (26) 454 pyrosequencing 기법에 의해 생성 된 읽기 분석합니다. 다음과 같이 처리를 수행 <ol><li> 처음에는 process_sff.py 스크립트 FASTA, QUAL과 Flowgram 파일을 454 기계 생성 SFF 파일을 변환합니다. </li><li> (check_id_map.py 기준) 매핑 파일의 유효성을 검사하고 멀티 플렉스 생물 샘을 읽고 할당PLES split_libraries.py 스크립트를. 낮은 품질의 50의 슬라이딩 윈도우의 크기와 25의 평균 품질 차단 매개 변수로 끝 트림, 데이터 집합의 짧은 모호한 시퀀스 (길이 &lt;200 BP)도 제거한다. </li><li> denoise_wrapper.py를 사용하여 454 데이터를 노이즈 제거. </li><li> 다음에, 여러 OTU 피킹 방법 (pick_otus.py 97 % 서열 유사성 컷 오프 가진)를 사용하여 고품질이 작동 분류학 유닛 (OTUs)로 판독 클러스터. </li><li> pick_rep_set.py 사용하여 각 OTU의 대표 시퀀스를 선택합니다. </li><li> assign_taxonomy.py에 따라 대표 시퀀스 세트에 분류를 지정합니다. 0.80로 설정 기록 할당에 대한 최소한의 신뢰와 리보솜 데이터베이스 프로젝트 (RDP) 분류를 사용합니다. </li><li> 알고리즘 PyNast (align_seqs.py를 사용하여 prealigned Greengenes 코어 16S 시퀀스에 대해 설정을 대표하는 순서를 맞 춥니 다75 최소한의 서열 동일성 %의 집합). </li><li> 또한, identify_chimeric_seqs.py을 실행하여 추가 분석에서 키메라를 고갈. </li><li> 이전의 계통 발생 (make_phylogeny.py)를 구축하는 lanemask 템플릿 (filter_alignment.py)와 (계통 발생 추론에 유용하지 않음) 모든 간격의 위치를 제거합니다. </li><li> 마지막으로, 각 샘플 내의 박테리아 phylotypes의 발생을 설명하는, make_otu_table.py로 OTU 테이블을 생성. 세균 풍부하고 활동을 비교하기위한 히트 맵을 구성하는 OTU 테이블을 사용합니다. </li><li> 필요한 경우, 각각의 샘플 내 사이 알파 및 베타 다양성을 계산한다. 동일하게, 진공 곡선 (시퀀싱 깊이 대 다양성의 그래프) 및 ​​미생물 공동체 간의 관계를 나타내는 주 코디네이트 분석 (PCoA) 플롯도 제조 할 수있다. </li></ol></li></ol>

<ol>
	<li>Pais, R., Lohs, C., Wu, Y. N., Wang, J. W., Aksoy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+obligate+mutualist+Wigglesworthia+glossinidia+influences+reproduction,+digestion,+and+immunity+processes+of+its+host,+the+tsetse+fly.">The obligate mutualist Wigglesworthia glossinidia influences reproduction, digestion, and immunity processes of its host, the tsetse fly.</a> Appl. Environ. Microbiol. 74, 5965-5974 (2008).</li><li>Freitak, D., Heckel, D. G., Vogel, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dietary-dependent+trans-generational+immune+priming+in+an+insect+herbivore.">Dietary-dependent trans-generational immune priming in an insect herbivore.</a> Proc. Biol. Sci. 276, 2617-2624 (2009).</li><li>Dillon, R. J., Vennard, C. T., Charnley, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Note:+Gut+bacteria+produce+components+of+a+locust+cohesion+pheromone.">A Note: Gut bacteria produce components of a locust cohesion pheromone.</a> J. Appl. Microbiol. 92, 759-763 (2002).</li><li>Douglas, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutritional+interactions+in+insect-microbial+symbioses:+Aphids+and+their+symbiotic+bacteria+Buchnera.">Nutritional interactions in insect-microbial symbioses: Aphids and their symbiotic bacteria Buchnera.</a> Annu. Rev. Entomol. 43, 17-37 (1998).</li><li>Reichardt, N., Barclay, A. R., Weaver, L. T., Morrison, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+stable+isotopes+to+measure+the+metabolic+activity+of+the+human+intestinal+microbiota.">Use of stable isotopes to measure the metabolic activity of the human intestinal microbiota.</a> Appl. Environ. Microbiol. 77, 8009-8014 (2011).</li><li>Dumont, M. G., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+isotope+probing+-+linking+microbial+identity+to+function.">Stable isotope probing - linking microbial identity to function.</a> Nat. Rev. Microbiol. 3, 499-504 (2005).</li><li>Gil, R., Latorre, A., Moya, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+endosymbionts+of+insects:+insights+from+comparative+genomics.">Bacterial endosymbionts of insects: insights from comparative genomics.</a> Environ. Microbiol. 6, 1109-1122 (2004).</li><li>Brune, A., VH, R. e. s. h., Card&#233;, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Encyclopedia of Insects. , 1132 (2005).</li><li>Breznak, J. A., Brune, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+microorganisms+in+the+digestion+of+lignocellulose+by+termites.">Role of microorganisms in the digestion of lignocellulose by termites.</a> Annu. Rev. Entomol. 39, 453-487 (1994).</li><li>Broderick, N. A., Raffa, K. F., Goodman, R. M., Handelsman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Census+of+the+bacterial+community+of+the+gypsy+moth+larval+midgut+by+using+culturing+and+culture-independent+methods.">Census of the bacterial community of the gypsy moth larval midgut by using culturing and culture-independent methods.</a> Appl. Environ. Microbiol. 70, 293-300 (2004).</li><li>Funke, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hydrolysis+of+quorum-sensing+molecules+in+the+gut+of+lepidopteran+larvae.">Rapid hydrolysis of quorum-sensing molecules in the gut of lepidopteran larvae.</a> Chembiochem. 9, 1953-1959 (2008).</li><li>Tang, X. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complexity+and+variability+of+gut+commensal+microbiota+in+polyphagous+lepidopteran+larvae.">Complexity and variability of gut commensal microbiota in polyphagous lepidopteran larvae.</a> PloS One. 7, (2012).</li><li>Amann, R. I., Ludwig, W., Schleifer, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylogenetic+identification+and+in-situ+detection+of+individual+microbial-cells+without+cultivation.">Phylogenetic identification and in-situ detection of individual microbial-cells without cultivation.</a> Microbiol. Rev. 59, 143-169 (1995).</li><li>Olsen, G. J., Lane, D. J., Giovannoni, S. J., Pace, N. R., Stahl, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+ecology+and+evolution+-+a+ribosomal-rna+approach.">Microbial ecology and evolution - a ribosomal-rna approach.</a> Annu. Rev. Microbiol. 40, 337-365 (1986).</li><li>Pilloni, G., von Netzer, F., Engel, M., Lueders, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electron+acceptor-dependent+identification+of+key+anaerobic+toluene+degraders+at+a+tar-oil-contaminated+aquifer+by+Pyro-SIP.">Electron acceptor-dependent identification of key anaerobic toluene degraders at a tar-oil-contaminated aquifer by Pyro-SIP.</a> FEMS Microbiol. Ecol. 78, 165-175 (2011).</li><li>Lu, Y. H., Conrad, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+stable+isotope+probing+of+methanogenic+archaea+in+the+rice+rhizosphere.">In situ stable isotope probing of methanogenic archaea in the rice rhizosphere.</a> Science. 309, 1088-1090 (2005).</li><li>Radajewski, S., Ineson, P., Parekh, N. R., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable-isotope+probing+as+a+tool+in+microbial+ecology.">Stable-isotope probing as a tool in microbial ecology.</a> Nature. 403, 646-649 (2000).</li><li>Lueders, T., Pommerenke, B., Friedrich, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable-isotope+probing+of+microorganisms+thriving+at+thermodynamic+limits:+Syntrophic+propionate+oxidation+in+flooded+soil.">Stable-isotope probing of microorganisms thriving at thermodynamic limits: Syntrophic propionate oxidation in flooded soil.</a> Appl. Environ. Microbiol. 70, 5778-5786 (2004).</li><li>Kunapuli, U., Lueders, T., Meckenstock, R. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+stable+isotope+probing+to+identify+key+iron-reducing+microorganisms+involved+in+anaerobic+benzene+degradation.">The use of stable isotope probing to identify key iron-reducing microorganisms involved in anaerobic benzene degradation.</a> ISME J. 1, 643-653 (2007).</li><li>Fuhrer, T., Fischer, E., Sauer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+identification+and+quantification+of+glucose+metabolism+in+seven+bacterial+species.">Experimental identification and quantification of glucose metabolism in seven bacterial species.</a> J. Bacteriol. 187, 1581-1590 (2005).</li><li>Dunford, E. A., Neufeld, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Stable-Isotope+Probing+(DNA-SIP).">DNA Stable-Isotope Probing (DNA-SIP).</a> J. Vis. Exp. (42), (2010).</li><li>Yamasaki, S., Nomura, N., Nakajima, T., Uchiyama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cultivation-independent+identification+of+candidate+dehalorespiring+bacteria+in+tetrachloroethylene+degradation.">Cultivation-independent identification of candidate dehalorespiring bacteria in tetrachloroethylene degradation.</a> Environ. Sci. Technol. 46, 7709-7716 (2012).</li><li>Lueders, T., Manefield, M., Friedrich, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+sensitivity+of+DNA-+and+rRNA-based+stable+isotope+probing+by+fractionation+and+quantitative+analysis+of+isopycnic+centrifugation+gradients.">Enhanced sensitivity of DNA- and rRNA-based stable isotope probing by fractionation and quantitative analysis of isopycnic centrifugation gradients.</a> Environ. Microbiol. 6, 73-78 (2004).</li><li>Ishak, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+diversity+in+Solenopsis+invicta+and+Solenopsis+geminata+ant+colonies+characterized+by+16S+amplicon+454+pyrosequencing.">Bacterial diversity in Solenopsis invicta and Solenopsis geminata ant colonies characterized by 16S amplicon 454 pyrosequencing.</a> Microb. Ecol. 61, 821-831 (2011).</li><li>Sun, Y., Wolcott, R. D., Dowd, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tag-encoded+FLX+amplicon+pyrosequencing+for+the+elucidation+of+microbial+and+functional+gene+diversity+in+any+environment.">Tag-encoded FLX amplicon pyrosequencing for the elucidation of microbial and functional gene diversity in any environment.</a> Methods Mol. Biol. 733, 129-141 (2011).</li><li>Kuczynski, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+QIIME+to+Analyze+16S+rRNA+Gene+sequences+from+microbial+communities.">Using QIIME to Analyze 16S rRNA Gene sequences from microbial communities.</a> Curr. Protoc. Microbiol. Chapter 1, Unit1E 5 (2012).</li><li>Dillon, R. J., Dillon, V. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gut+bacteria+of+insects:+nonpathogenic+interactions.">The gut bacteria of insects: nonpathogenic interactions.</a> Annu. Rev. Entomol. 49, 71-92 (2004).</li><li>Neufeld, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+stable-isotope+probing.">DNA stable-isotope probing.</a> Nat. Protoc. 2, 860-866 (2007).</li><li>Dumont, M. G., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+isotope+probing+-+linking+microbial+identity+to+function.">Stable isotope probing - linking microbial identity to function.</a> Nat. Rev. Microbiol. 3, 499-504 (2005).</li></ol>

우리는 공개 아무것도 없어.

대부분의 곤충의 창자는 풍부하고 복잡한 미생물 군집을 품고, 일반적으로 10 ~ 12 -10 9 원핵 세포는 대부분의 경우 호스트의 자신의 세포를 상회하는, 거기에 제기. 따라서, 곤충의 창자는 상리 공생 (27)를 의무하는 기전에서 미생물 관계의 여러 측면을 대표하는 다양한 미생물의 활동에 대한 &quot;핫 스팟&quot;입니다. 많은 연구가 곤충 장내 미생물 사회의 놀라운 다양성을 ...

곤충 박테리아의 공생 협회는 곤충 종 7의 큰 숫자에 대한 알려져있다. 이러한 공생 협회에서, 미생물은 곤충의 성장과 발달에 중요한 역할을한다. 미생물은 호스트에 곤충 필수 아미노산 (4)의 합성을 포함하여 재생 1, 페로몬 생합성 3, 영양, 및 액세스 음식의 소화에 기여하는 것으로 나타났다. 장내 세균 협회의 광대 한 다양한에도 불구하고, 훨씬 적은들은 곤충에 찬성 재생 기능 역할에 대한 알려져있다. 만 흰개미의 경우에는 목질 섬유소의 공생 소화가 원핵 생물, 원생 동물, 곰팡이에 의해 수행, 널리 8,9를 공부하고 있습니다. 이와 대조적으로, 거의가 제너럴 곤충의 용기면 leafworm 즉에 존재하는 공생 관계에 대해 잘 알려져 있습니다, 스포 도프 테라는 일반적으로 인해 식물 호스트의 자신의 빈번한 이동에, 또한. 리토 랄IST 곤충과 그들의 창자 관련된 세균성 지역 사회가 영구적으로 자신의 식습관은 식물성 화학 물질의 과다로 식물을 소비에 연결된 새로운 도전에 노출되어 있습니다. 이 옆에 lepidopterans의 창자 환경은 본질적으로 높기 때문에 장내의 pH 10의 박테리아의 성장을위한 가혹한 환경을 나타냅니다. 특히 S.의 경우 리토 랄, 그것은 범위 foregut 10.5에서 중장 캘리포니아. 9 거의 7 hindgut (11)를 PH합니다. 한편, 세균성 커뮤니티 S.의 가트와 관련된 리토 랄은 간단합니다. 당나라, Freitak, 등. (12)는이 곤충과 관련된 세균성 지역 사회의 구성원 만 아니라 7 개의 다른 박테리아 종의 총에 속하는 36 phylotypes 최대를보고했다. 이 외에도, 복잡한 양육 절차는 실험실에서 곤충 성장을 위해 필요하지 않습니다. 또한, 이것과 곤충의 짧은 수명주기가 다 g 용이enerational 연구, 창자 - 미생물 상호 작용 연구를위한 이상적인 모델 시스템에이 종을 선회. PCR 기반 시퀀싱 기술의 출현으로, 몇개의 미생물 (즉, 인간, 곤충이나 해양 생물)의 가트 생물상 다루는 연구의 수는 증가하고있다. 더욱이, 결과는 과거뿐만 고립과 가트 숨겨 세균 배양으로부터 독립적이다. 박테리아의 약 99 %는 경작되지 않고 장내에서 일반적인 환경 조건의 시뮬레이션은 12 어렵다. PCR을 이용하여 16S rRNA 유전자 단편 (세균 가운데 널리 계통 유전자 마커) 선택적 서열화 가트 세균 공동체의 혼합 DNA 템플릿에서 증폭 및 복제 될 수있다. 이 정보를 통해, 사용자는 공개 13,14 데이터베이스로부터 서열 정보를 검색 한 후 종의 박테리아를 식별 할 수있다. 그럼에도 불구하고, 순서는 박테리아를 설명하는 접근사회 인해 지역 사회 내의 개별 종의 고유 대사 공헌에 대한 정보의 부족으로 충분한 남아있다. 안정 동위 원소 (SIP)를 프로빙 유망 문화가없는 기술이다. 그것은 종종 특정 신진 대사 활동에 링크 된 미생물의 계통 발생을 분석하는 환경 미생물학에서 사용된다. 이는 같은 인지질 유래 지방산, DNA 및 RNA 5와 같은 미생물의 생체에 기판에서 안정 동위 원소 표지 원자를 추적하여 달성된다. 핵산을 고려하면, 방법론은 밀도 구배 초 원심 분리 (6)에 의해 비 표지 DNA의 13 C-표지 된 DNA 또는 RNA의 분리에 기초한다. 때문에 DNA 라벨과 신진 대사 활동 사이의 직접 연결로, 핵산의 하류 분자 분석은 종을 식별하고 신진 대사 활동에 대한 정보를 제공합니다. 또한, DNA-SIP와 pyrosequencing 기법의 조합에 의해 적용되는Pilloni 폰 쩌르 교수, 등. (15)는 무거운 13 C-표지 된 DNA 분획에 존재하는 세균 종의 특정 간단하고 민감한 식별을 허용합니다. 지금까지이 기술은 호기성 및 혐기성 조건 16, 17, 18, ​​19에서 토양 생지 화학 과정에 포함 된 세균의 지역 사회를 설명하기 위해 적용되었습니다. 난소 화성 탄수화물에 대한 응답으로 인간의 장내 미생물의 서로 다른 계통 발생 그룹의 신진 대사 활동을 설명 Reichardt, 등. 5에 의해보고 된 환경 과학에서의 사용 외에,이 기술은 의료 과학에 적용되었습니다. 여기에서 우리는 창자의 대사 활성 박테리아 종의 DNA &#39;라벨&#39;에 13 C-포도당을 사용합니다. 포도당은 예외가 20 알려져 있지만, 광범위한 엔트 - Doudoroff (ED) 경로를 따라 대부분의 세균 종에 의해 이용 당합니다. 이또한 대사 확립 경로를 따라 탄소원 간의 링크를 제공 신뢰성 대사 프로브로서 13 C-글루코스 사용을 정당화한다. 과학적 질문에, 다른 기판, 즉 13 C-메탄, 13 CO 2, 13 CO 2 분위기하에 발생 식물에 따라 대사 활동을 해결하는데 사용될 수있다. 이 시점에서, 우리는 제너럴 곤충, 즉 S.의 장내 세균 공동체의 대사 특성에 적용되는 프로토콜을 제시한다 리토 랄 (나비목, Noctuidae). 또한, 기술은 다시 높은 해상도와 정밀도를 가진 곤충 장내 세균 공동체의 식별을 허용 pyrosequencing 기법에 결합했다. 메인 기판으로서, 13 C-표지 된 글루코스는 실험 동안 사용 하였다.

<table border="0" cellpadding="0" cellspacing="0" width="872"> 
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:384px;">Dumont #5 Mirror Finish Forceps</td>
			<td style="width:203px;">Fine Science Tools</td>
			<td style="width:135px;">11251-23</td>
			<td style="width:151px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vannas Spring Scissors</td>
			<td>Fine Science Tools</td>
			<td>15000-00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Speed Vacuum Concentrator 5301</td>
			<td>Eppendorf Germany</td>
			<td>5305 000.304</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Plastic pestle</td>
			<td>Carl Roth GmbH Co. Germany</td>
			<td>P986.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NanoVue spectrophotometer</td>
			<td>GE HealthCare, UK</td>
			<td>28-9569-58</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mastercycler pro/thermocycler</td>
			<td>Eppendorf Germany</td>
			<td>6321 000.515</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agagel Standard Horizontal Gel Electrophoresis chamber</td>
			<td>Biometra</td>
			<td>Discontinued</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultracentrifuge (Optima L-90K)</td>
			<td>Beckman</td>
			<td>A20684</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultracentrifuge rotor (NVT 90)</td>
			<td>Beckman</td>
			<td>362752</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HPLC pump</td>
			<td>Agilent</td>
			<td>1100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Quick-Seal, Polyallomer tube</td>
			<td>Beckman</td>
			<td>342412</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Transilluminator UVstar 15 </td>
			<td>Biometra</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

identification of metabolically active bacteria in the gut of the generalist spodoptera littoralis via dna stable isotope probing using 13c-glucose

대부분의 곤충의 내장은 공생 비병원성 박테리아의 복잡한 사회에서 살고있다. 이러한 미생물 지역 사회 내에서 그것은 공생이나 공생 박테리아 종을 식별 할 수 있습니다. 후자의 것, 즉 다른 사람의 사이에서, 필수 아미노산 (4)의 합성을 포함하여 면역 반응 2, 페로몬 생산 3,뿐만 아니라 영양을 증폭, 곤충 재생 1 도움, 곤충에 여러 기능을 제공하는 것으로 관찰되었다. 때문에 이러한 연결의 중요성에 많은 노력이 개별 구성원에 이르기까지 지역 사회의 특성을되었습니다. 그러나, 이러한 노력의 대부분은 하나 재배 방법에 근거하거나 최종 식별 서열화 된 16S rRNA 유전자 단편의 생성에 의존 하였다. 불행히도, 이러한 방법은 장내에 존재하는 세균 종을 파악하고 더 INFORMAT을 제공하지미생물의 대사 활동에 이온. 곤충의 창자의 대사 활성 세균 종의 특성을 위해, 우리는 보편적 인 기질로 13 C-포도당을 이용한 생체 내 (SIP)를 프로빙 안정 동위 원소를 사용했습니다. 이것은 그들의 특정 신진 대사 활동에 미생물 계통의 결합을 할 수있는 유망한 문화가없는 기술이다. 이는 DNA와 RNA 5와 같은 미생물의 생체에 기판에서 안정 동위 원소 표지 원자를 추적 가능합니다. DNA가 비 표지 (12 C)에 비해 한 표지 DNA의 밀도를 증가시킨다 (13)에 C의 혼입 동위 원소. 결국, 13 C-표지 된 DNA 또는 RNA는 12 C-레이블이없는 유사 하나 6에서 밀도 구배 초 원심 분리에 의해 분리된다. 분리 된 핵산 분자 동위 원소의 후속 분석 종의 대사 활동 및 ID 사이의 연결을 제공한다. 여기에서, 우리는 제너럴 곤충 (우리의 모델 시스템), 스포 도프 테라 리토 랄 (나비목, Noctuidae)의 창자에있는 대사 활성 박테리아의 특성을하는 데 사용되는 프로토콜을 제시한다. DNA의 계통 발생 학적 분석은 곤충 장내 세균 공동체의 식별에 높은 해상도와 정밀도를 허용 pyrosequencing 기법을 사용하여 수행 하였다. 메인 기판으로서, 13 C-표지 된 글루코스가 실험에 사용 하였다. 기판은 인공 사료를 사용하여 곤충에 공급 하였다.

곤충 장내 본 대사 활성 균의 충분한 표시를 달성하기 위해, 곤충 한 비 표지 라이터로부터 용이하게 표지 된 중질 분획의 분리를 허용하기에 충분한 미리 최적화 동안 13 C가 풍부한 기판에 노출되어야한다. 우리의 경우는, 13 C-글루코스는 일일 (도 1a)에 대한 10 mM의 최종 농도 인공 사료에 첨가 하였다. 정상 글루코스 (도 1b)의 동일 량을 제어 곤충의 인공 ...

Watch this Scientific Journal Video about Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose at JoVE.co

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

스포 도프 테라 리토 랄리스의 가트와 연관된 활성 박테리아 여행자는 pyrosequencing 기법에 결합 안정 동위체 프로빙 (SIP)에 의해 결정되었다. 이 방법을 사용하여, 지역 사회 내에서 대사 활성 박테리아 종의 식별은 높은 해상도와 정밀도로 이루어졌다.

제너럴의 장내 대사 활성 박테리아의 식별<em&gt; 스포 도프 테라 리토 랄</em&gt; DNA 안정 동위 원소를 통해 사용 프로빙<sup&gt; 13</sup&gt; C-포도당

Guts of most insects are inhabited by complex communities of symbiotic nonpathogenic bacteria. Within such microbial communities it is possible to ...

identification-metabolically-active-bacteria-gut-generalist

Research

JoVE Journal

Biology

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

15.2K 조회수.  Max Planck Institute for Chemical Ecology.  스포 도프 테라 리토 랄리스의 가트와 연관된 활성 박테리아 여행자는 pyrosequencing 기법에 결합 안정 동위체 프로빙 (SIP)에 의해 결정되었다. 이 방법을 사용하여, 지역 사회 내에서 대사 활성 박테리아 종의 식별은 높은 해상도와 정밀도로 이루어졌다. 

비디오: Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

Extracting DNA from the Gut Microbes of the Termite (Zootermopsis Angusticollis) and Visualizing Gut Microbes

Termites are among the few animals known to have the capacity to subsist solely by consuming wood.  The termite gut tract contains a dense and species-rich microbial population that assists in the degradation of lignocellulose predominantly into acetate, the key nutrient fueling termite metabolism (Odelson &amp; Breznak, 1983).  Within these microbial populations are bacteria, methanogenic archaea and, in some ("lower") termites, eukaryotic protozoa. Thus, termites are excellent research subjects for studying the interactions among microbial species and the numerous biochemical functions they perform to the benefit of their host.  The species composition of microbial populations in termite guts as well as key genes involved in various biochemical processes has been explored using molecular techniques (Kudo et al., 1998; Schmit-Wagner et al., 2003; Salmassi &amp; Leadbetter, 2003). These techniques depend on the extraction and purification of high-quality nucleic acids from the termite gut environment.  The extraction technique described in this video is a modified compilation of protocols developed for extraction and purification of nucleic acids from environmental samples (Mor  et al., 1994; Berthelet et al., 1996; Purdy et al., 1996; Salmassi &amp; Leadbetter, 2003; Ottesen et al. 2006) and it produces DNA from termite hindgut material suitable for use as template for polymerase chain reaction (PCR).

Extracting DNA from the Gut Microbes of the Termite Zootermopsis Angusticollis and Visualizing Gut Microbes

This video illustrates the technique for extracting DNA from the species of microbes resident in the termite hindgut. The preparation of a wet mount slide, which is useful for visualizing the gut microbial community is also illustrated, and a tour through the species-rich gut environment is given.

마이트의 굿 미생물 (Zootermopsis Angusticollis)에서 DNA를 추출하고 굿 미생물을 떠올리

Termites are among the few animals known to have the capacity to subsist solely by consuming wood.  The termite gut tract contains a dense and ...

연구

생물학

DNA Stable-Isotope Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

DNA Stable-Isotope Probing DNA-SIP

DNA stable-isotope probing is a cultivation-independent method to identify and characterize active communities of microorganisms that are capable of utilizing specific substrates. Assimilation of substrate enriched in heavy isotope leads to incorporation of labelled atoms into microbial biomass. Density gradient ultracentrifugation retrieves labelled DNA for downstream molecular analyses.

DNA 안정 - 동위 원소 (DNA - SIP) 탐색

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

활성 T.의 체외의 Reconstitution에서 castaneum의 Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not only ensure faithful genome duplication in the face of endogenous and exogenous DNA damage but also prevent genomic instability, a recognized causative factor in tumor development.
Here, we describe a simple and cost-effective fluorescence microscopy-based method to visualize DNA replication in the avian B-cell line DT40. This cell line provides a powerful tool to investigate protein function in vivo by reverse genetics in vertebrate cells1. DNA fiber fluorography in DT40 cells lacking a specific gene allows one to elucidate the function of this gene product in DNA replication and genome stability. Traditional methods to analyze replication fork dynamics in vertebrate cells rely on measuring the overall rate of DNA synthesis in a population of pulse-labeled cells. This is a quantitative approach and does not allow for qualitative analysis of parameters that influence DNA synthesis. In contrast, the rate of movement of active forks can be followed directly when using the DNA fiber technique2-4. In this approach, nascent DNA is labeled in vivo by incorporation of halogenated nucleotides (Fig 1A). Subsequently, individual fibers are stretched onto a microscope slide, and the labeled DNA replication tracts are stained with specific antibodies and visualized by fluorescence microscopy (Fig 1B). Initiation of replication as well as fork directionality is determined by the consecutive use of two differently modified analogues. Furthermore, the dual-labeling approach allows for quantitative analysis of parameters that influence DNA synthesis during the S-phase, i.e. replication structures such as ongoing and stalled forks, replication origin density as well as fork terminations. Finally, the experimental procedure can be accomplished within a day, and requires only general laboratory equipment and a fluorescence microscope.

DT40, a model vertebrate genetic system, provides a powerful tool to analyze protein function. Here we describe a simple method that allows qualitative analysis of parameters that influence DNA synthesis during the S-phase in DT40 cells at the single molecule level.

DNA 복제의 시각화는 척추 모델 시스템 DT40의 DNA 섬유 기술을 사용하여

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

식물 단백질 복합체의 번역 후 변형의 확인

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

애기 장대 단백질 DNA 상호 작용의 식별을위한 염색질 면역 침전 분석<em&gt; 생체</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

레트로 바이러스 통합 사이트의 증폭, 차세대 시퀀싱 및 게놈 DNA 매핑

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ecologically-important endpoints, though they are rarely considered in toxicological studies. D. melanogaster is emerging as a toxicology model for the behavioral, neurological, and genetic impacts of toxicants, to name a few. More importantly, species in the genus Drosophila can be utilized as a model system for an integrative framework approach to incorporate emergent properties and answer ecologically-relevant questions in&#160;toxicology research. The aim of this paper is to provide a protocol for exposing species in the genus Drosophila to pollutants to be used as a model system for a range of phenotypic outputs and ecologically-relevant questions. More specifically, this protocol can be used to 1) link multiple biological levels of organization and understand the impact of toxicants on both individual- and population-level fitness; 2) test the impact of toxicants at different stages of developmental exposure; 3) test multigenerational and evolutionary implications of pollutants; and 4) test multiple contaminants and stressors simultaneously.

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

In this paper, we provide a detailed protocol for exposing species in the genus Drosophila to pollutants with the goal of studying the impact of exposure on a range of phenotypic outputs at different developmental stages and for more than one generation.

무척 추 동물 모델 시스템으로 독성 테스트 실험실에서 초파리 를 사용 하 여 실험 프로토콜

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ...

Establishing Stable Binary Cultures of Symbiotic Saccharibacteria from the Oral Cavity

Many bacterial species cannot be cultured in the laboratory using standard methods, posing a significant barrier to studying the majority of microbial diversity on earth. Novel approaches are required to culture these uncultured bacteria so that investigators can effectively study their physiology and lifestyle using the powerful tools available in the laboratory. The Candidate Phyla Radiation (CPR) is one of the largest groups of uncultivated bacteria, comprising ~15% of the living diversity on earth. The first isolate of this group was a member of the Saccharibacteria phylum, 'Nanosynbacter lyticus' strain TM7x. TM7x is an unusually small bacterium that lives as a symbiont in direct contact with a bacterial host, Schaalia odontolytica, strain XH001. Taking advantage of the unusually small cell size and its lifestyle as a symbiotic organism, we developed a protocol to rapidly culture Saccharibacteria from dental plaque. This protocol will show how to filter a suspension of dental plaque through a 0.2 &#181;m filter, then concentrate the collected Saccharibacteria cells and infect a culture of host organisms. The resulting coculture can be passaged as any normal bacterial culture and infection is confirmed by PCR. The resulting binary culture can be maintained in the laboratory and used for future experiments. While contamination is a possibility, the binary culture can be purified by either further filtering and reinfection of host, or by plating the binary culture and screening for infected colonies. We hope this protocol can be expanded to other sample types and environments, leading to the cultivation of many more species in the CPR.

We demonstrate a method for isolating difficult-to-grow members of the novel bacterial phylum, Saccharibacteria, by filtering dental plaque and co-culturing with host bacteria.

구강에서 공생 사카리박테리아의 안정적인 이진 문화 구축

Many bacterial species cannot be cultured in the laboratory using standard methods, posing a significant barrier to studying the majority of microbial ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also be utilized to explore other complex regulatory mechanisms at the exon level. Alternative splicing and polyadenylation play a crucial role in the functional diversity of a gene by generating different isoforms to regulate gene expression at the post-transcriptional level, and limiting analyses to the whole gene level can miss this important regulatory layer. Here, we demonstrate detailed step by step analyses for identification and visualization of differential exon and polyadenylation site usage across conditions, using Bioconductor and other packages and functions, including DEXSeq, diffSplice from the Limma package, and rMATS.

Alternative splicing (AS) and alternative polyadenylation (APA) expand the diversity of transcript isoforms and their products. Here, we describe bioinformatic protocols to analyze bulk RNA-seq and 3' end sequencing assays to detect and visualize AS and APA varying across experimental conditions.

RNA-seq 데이터에서 대체 스플라이싱 및 폴리아데닐화 식별

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...