This work is supported by the Biotechnology and Biological Sciences Research Council (BBSRC; BB/L021668/1), the MRC and Arthritis Research UK as part of the MRC - Arthritis Research UK Centre for Integrated Research into Musculoskeletal Ageing (CIMA) and the Wellcome Trust Institutional Strategic Support Fund (097826/Z/11/A). The authors would like to thank Dr Dada Pisconti (University of Liverpool) for her expertise and advice in the isolation of muscle progenitor cells.

여기에 설명 된 인체 조직을 포함하는 모든 실험은 리버풀의 대학, 대학 병원 도날드 병원과 사우스 웨스트 웨일즈 연구 윤리위원회의 사전 승인되지 않았다 (승인 번호 : 13 / WA / 0374) 및 실험은 좋은 연습 지침에 따라 수행 하였다. 윤리는이 연구를 위해 후원으로 리버풀의 대학은 행동했다. 모든 기부자는이 연구의 등록에 대한 동의서를 부여했다. 근육이 사람들로부터 분리 하였다 (BMI &lt;25) : 성인 : 30 ± 2.8 세 세 : 69 ± 5 세. 문화 1. 준비 <ol><li> 문화의 코팅 라미닌과 표면 <ol><li> 1X DPBS에서 라미닌의 10 μg의 / ㎖ (둘 베코 인산염 완충 생리 식염수)의 작업 솔루션을 준비합니다. </li><li> 완전 세포 (표 1) 도금 될 예정에있는 표면을 덮도록 라미닌 용액 최소량 피펫. t을 품어세포 도금 전에 가습 37 ° C에서 그 배양 접시에 적어도 30 분, 5 % CO 2 인큐베이터. 와류의 사용을 피하고, 신중 라미닌 핸들. DPBS에 희석하여 10 μg의 / ㎖의 라미닌 작동 용액은 39 ° C에서 저장 될 수 있고, 여러 번 재 - 사용된다. </li><li> 6 웰 플레이트에서 60mm (20cm 2) 페트리 접시 또는 2 우물을 사용 (2 × 10cm 2) ~ (18) 당 - 골격 근육의 19 mg의 세포 (총 5.50 × 10 4 셀) 판입니다. 기능 연구에 세포를 도금 할 때 항상 휴대 계산을 수행합니다. 참고 : 샘플은 원래 여성 환자 (30 ± 2.8 세, 나이 : 69 ± 5 세, BMI &lt;25 성인)의 발 수술 (신근 심지 브레비스, 전 경골근 또는 외전 halluces 근육)에서 얻었다. </li></ol></li><li> 효소 용액의 제조 <ol><li> 10 ㎖ 1X DPBS에 재고 CaCl2를 277 mg을 250 mM의 CaCl2를 작업 솔루션을 준비합니다. 소위 필터4 ℃에서 0.2 μm의 필터 멤브레인 및 저장과 lution. </li><li> 콜라게나 D의 1.5 U / mL로, 스파 아제 (Dispase) II 2.4 U / mL의 무 혈청 DMEM에 2.5 mM의 염화칼슘 2 (둘 베코의 수정 이글의 중간) (표 2)의 작업 솔루션을 준비합니다. </li><li> 잘 혼합하고 살균을위한 0.2 μm의 필터 멤브레인을 통해 효소 솔루션을 필터링 할 수 있습니다. 사전에 효소 솔루션을 준비하고 아래로 동결 (-20 ° C) 나중에 사용하기 위해 분취한다. </li></ol></li></ol> 2. 조직 소화 : 기계 및 효소 해리 <ol><li> 샘플 수집에 따라, 소화 될 때까지 DPBS 4 ° C에서 근육을 유지합니다. (18) 당 콜라게나-CaCl2를 디스 파제 용액 2ml를 최소 부피 준비 - 근육 조직의 19 mg의 조직을 분리하기 전에 37 ℃로 가온. </li><li> 신선한 DPBS로 세척, 간단히 70 % 에탄올에 근육 생검을 담그고 효소의 1 mL의 새로운 배양 접시에 조직을 배치해결책. </li><li> 가능한 한 많은 섬유 성 지방 조직을 취소하고 작지만 구별 조각으로 빠르게 조심스럽게 근육을 눈물 (약&gt; 0.5 mm 2) 멸균 가위 또는 수술 용 메스 (블레이드 제 10 호)과 함께. </li><li> 콜라게나 제 - 디스 파제-CaCl2를 나머지 1 mL로 한 50㎖ 튜브에 시료를 옮긴다. </li><li> 40 분 - 30까지 37 ° C에서 조직을 품어. 10 분 - 부드럽게 튜브 매 5 교반하여 근육 조직을 이동합니다. </li><li> 코팅 매체를 사용하여 피펫을 피펫의 플라스틱의 벽에 방출 세포의 부착을 방지한다. 소화를 중지 예를 들어 멸균 성장 매체의 2 권, DMEM 20 % FBS (태아 소 혈청), 1 % L- 글루타민 및 1 % P / S (페니실린 - 스트렙토 마이신)의 4 mL로 추가합니다. </li><li> 피펫 위로 5 mL를 피펫으로 아래로 여러 번 근육 섬유 세포의 방출을 도와줍니다. 참고 : 샘플은 일반적으로 완전히 작은 크기로 인해 해리된다. However, 근육의 조각이 남아있는 경우, 근육의 나머지 조각과 신선한 효소 솔루션과 함께 두 번째 배양을 사용합니다. </li><li> 50 ML 원뿔 튜브를 통해 70 μm의 셀 스트레이너를 통해 근육의 솔루션을 필터링합니다. 스트레이너를 통해 더 많은 미디어와 필터가 남아있는 세포를 씻으십시오. </li><li> 세포 펠렛을 실온에서 5 분 동안 443 XG에 원심 분리기. 조심스럽게 상층 액을 버린다. </li><li> F-12 미디어 (햄의 F-12 영양소 믹스), 20 % FBS,에 펠렛을 녹이고 10 % HS (말 혈청), 1 % P / S, 1 % α-글루타민과 2.5 NG / FGF-B의 ㎖ ( 재조합 인간 염기성 섬유 아세포 성장 인자). 여기, 60mm 페트리 접시 당 미디어의 4 mL로 사용합니다. </li></ol> 세포의 3 시드 <ol><li> 이전에 인큐베이터 (섹션 1.1)에서 10 μg의 / ML의 라미닌으로 코팅 된 배양 용기를 수집합니다. </li><li> 조심스럽게 배양 접시에서 라미닌의 초과를 제거하고 표면에 닿지 않도록 (또는 단백질의 구조를 방해합니다). 빨래(선택 사항) DPBS로 배양 접시. </li><li> 라미닌 코팅 용기에 직접 세포를 플레이트 및 가습 37 ° C, 5 % CO 2 인큐베이터에서 24 시간 동안 배양한다. </li><li> 밝은 필드 현미경 (100X 종합 배율) 다음날 하에서 세포를 시각화. 라운드 작은 세포 표면에 부착되고 남은 찌꺼기는 배양 배지에서 볼 수있다. </li><li> 20 % FBS, 10 % HS, 1 % P / S, 1 % α-글루타민과 2.5 NG / FGF-B mL의 보완 신선한 F-12 미디어 매체를 변경합니다. </li></ol> 4. 문화와 세포의과 Passaging <ol><li> 3 D 자발적 피하기 위하여 셀 그룹 (7 D 후, 100 배의 총 배율이,도 2의 예를, 노인에서 세포 통로 0) 현미경으로 볼 수 자마자 셀 분할 - 미디어마다이 변경 분화. </li><li> 제 1 통로 (P1)에, 20 % FBS, 10 % HS 1 % 보완 하이 글루코스 DMEM 용지로 바꾸P / S, 1 % α - 글루타민. FGF는 문화의 시작 부분에 강력한 미토 겐 중요한 요소로,이 시점에서 FGF-B를 사용하지 마십시오,하지만 문화에서 이상 사용하는 경우는 섬유 아세포의 증식을 촉진 할 수 있습니다. </li><li> 세포의 계대의 경우 : <ol><li> 용지를 제거하고 DPBS로 두 번 세포를 씻으십시오. </li><li> 세포의 표면을 커버하는 0.25 %의 EDTA-트립신 최소 볼륨. 모든 셀이 박리 액에 의해 커버되도록, 실온에서 10 초 동안 부화 및 제거 부드럽게 흔들. </li><li> 가습 37 °의 C에서 세포를 품어, 3, 5 % CO 2 배양기 - 5 분. 가볍게 누르고 세포가 둥근하지만 완전히 표면에서 분리되지 않도록 밝은 빛 현미경 (100X 총 배율)에서 확인하십시오. 변화가 세포에서 관찰되지 않는 경우, 추가 5 분 동안 배양한다. </li><li> 5 ㎖의 성장 매체 세포를 수집하는 (고 글루코스 DMEM은 20 % FBS, 10 % HS 1 % P / S, 1 % 글루타민 α 보완)를 첨가, 혼합잘와 T75 플라스크에 새로운 미디어 세포를 전송합니다. 성장 매체의 또 다른 5 mL를이 단계 (하나 T75 플라스크에 대한 총 10 ㎖)을 반복 남아있는 세포를 씻으십시오. </li><li> (제 1 통로에서 바람직) preplate 위해서는 40 분 동안, 5 % CO 2 인큐베이터 가습 37 ° C에서 세포를 배양한다. 새로운 T75 플라스크에 그들을 연결하고 부화하지 않은 세포 상층 액을 수집합니다. 섬유 아세포의 대부분이 첫 번째 플라스크에 부착해야 이것은, 근육 아세포의 문화를 풍부하게한다. </li></ol></li><li> 3 일 그들은 최대 수율 70 % 포화 상태에 도달하자마자 4 셀 1 분할 - 미디어마다 2를 변경합니다. </li><li> 2 % HS 1 % P / S, 1 % α 글루타민 보완 하이 글루코스 DMEM을 : 분화 매체 (DM)에 배양액을 변경, 80 % 컨 플루 - 분화, 세포 일단 70 이르렀다. 7 D를 근육 모세포 (C)의 품질 및 순도에 따라 - 세포 5에서 구별되어야ulture. </li></ol> 5. 형질 프로토콜 <ol><li> 씨앗 50,000 세포 / 웰의 MF (20), 노화 및 생존 분석을위한 12 웰 플레이트. 커버 전표 또는 라미닌으로 코팅 된 접시에 배양 세포. 사료된다 염색의 경우, 12 웰 플레이트에 / 잘 25,000 세포를 시드. </li><li> 형질 들어, 1 ㎖의 전체 부피로 형질 감염 시약 5 μL, 마이크로 RNA 모방 제어 또는 억제제는 100nm 마이크로 RNA를 모방하거나 웰당 마이크로 RNA 억제제 100 nM 내지 100 nM의를 사용하여 제조자의 절차를 따른다. </li><li> 형질 전환 후 차별화 보통 6 시간으로 변경 (높은 혈당 DMEM 2 % HS, 1 % P / S, 1 % α-글루타민 보완). 증식 실험을 위해, 형질 전환 후 세포에게 2 일 얼룩; 노화에 대한, 형질 전환 후 7 일 이내; 및 MF20 염색 용, 칠일 형질 전환 후. </li></ol> 세포의 면역 염색 (6) <ol><li> 사료된다, MyoD 및 MF (20) 면역 염색 <ol><li> 준비 블록 1 (10% HS 0.1 % PBS에 트리톤-X) 및 PBS) 솔루션의 2 (10 % HS 0.05 % 트리톤-X를 차단합니다. 12 웰 플레이트에 잘 당 시약 500 μL를 사용합니다. 참고 : 배양 단계 쉐이커를 사용하여 다음 단계를 수행합니다. </li><li> 세포에서 용지를 제거합니다. </li><li> PBS로 세포를 씻어. </li><li> 로커에 10 분간 냉 메탄올로 세포를 고정한다. </li><li> 세포에서 메탄올을 제거하고 5 분마다 PBS로 3 배 씻어. </li><li> 1 시간 동안 실온에서 로커에 셀을 블록 1 솔루션을 추가하고 품어. </li><li> 일차 항체 솔루션을 추가 사료된다 염색을 위해, 사료된다에 토끼 단클론 항체를 사용 (1 : 블록 1,000 희석 2); MyoD를 들어, MyoD1 (D8G3) XP 토끼 단클론 항체를 사용 (1 : 블록 100 희석 2); MF (20) 염색, 사용 MYH1E (MF 20) 차 항체 (DSHB, 1 : 블록 1,000 희석 2). </li><li> 로커에 O 1 시간 (RT) / N (4 °에 C)에 대한 일차 항체와 세포를 품어. </li><li> STO 경우 여러 번 재사용 될 수있다 (주 AB 모아서빨간색) 4 ° C에서. </li><li> 세포를 PBS, 5 분마다와 배 헹군다. </li><li> 적절한 이차 항체를 추가 사료된다 또는 MyoD 염색, 염소 항 - 토끼 IgG를 (H + 1) 차 항체에 대한 알렉사 플 루어 488 켤레 (1 : PBS에서 1000 희석) (: PBS에서 1000 희석 1) MF (20) 염색, 염소 항 - 마우스 IgG (H + 1) 차 항체, 알렉사 형석 488 공액합니다. </li><li> 세포를 포함하는 판을 싸서 실온에서 로커에 어둠 속에서 2 시간 동안 차 항체를 품어. </li><li> 세포를 5 분마다 PBS로 3 배 헹군다. </li><li> 세포에 : (PBS 1,000 희석 1) 5 RT에서 로커에 품어 - 10 분 DAPI 솔루션을 추가합니다. </li><li> 세포를 5 분마다 PBS로 3 배 헹군다. </li><li> 신선한 PBS 1 ML을 추가합니다. </li><li> 장착 용액 커버 슬립에 세포를 장착 또는 증발을 방지하기 위해 파라 필름 PBS에 세포를 포함하는 플레이트를 밀봉. </li><li> 4 ℃에서 보관하십시오. </li><li> 함께 세포를 시각화형광 현미경 가능한 한 빨리 (늦어도 2보다 주). </li></ol></li><li> 생존 분석 <ol><li> 세포에서 용지를 제거합니다. </li><li> PBS에서 세포를 씻어. </li><li> 1000 에티 디움 브로마이드와 1 : PBS에 희석 1,000 아 크리 딘 오렌지 하나를 추가합니다. 주의 :주의 보건 및 안전 규정 내에서 작동 - 에티 디움 브로마이드 발암 물질이다. </li><li> 염색 액에 세포를 포함하는 플레이트를 감싸고 5 분간 로커에 RT에서 배양한다. </li><li> 형광 현미경으로 세포의 이미지를 가지고 : 아 크리 딘 오렌지 녹색 채널을; 에티 디움 브로마이드 빨간색 채널. </li></ol></li></ol>

There is nothing to disclose.

여기, 우리는 신전 digitorium 브레비스, 정강 뼈 앞쪽 또는 외전 halluces 근육에서 성인과 나이 든 사람에서 근육 전구 세포 / 차 근육 아세포를 분리하는 간단하고 강력한, 저렴 재현하고 효율적인 방법을 제시한다. 이 프로토콜은 FACS- 또는 MACS-정렬과 같은보다 정교한 방법이 실제 가능 여부 없습니다 특히, 성인 및 노인 인간에서 인간의 기본 근육 아세포를 이용하여 연구를 허용하는 것을 목표로하고있다. 이 논문에 제시된 분리 방법은 약 2 시간이 소요됩니다. 근육 분리 동안 근육은 오염을 방지하기 위해 70 % 에탄올로 세척 하였다. 근육의 분해 효소를하기에 앞서 작지만 표시 조각으로 근육을 절단하고, 너무 닦지에서 세포의 손상을 방지하는 것이 중요하다. 근섬유의 해리 위성 세포 및 근육 조직 전구 세포의 분리에 소화 결과. 골격 근육의 ~ 20 ㎎, 하나의 60mm에 대한 우리의 경우(20cm 2) 배양 접시의 세포를 수확하기 위해 가장 적합한 표면의 영역이었다. 세포가 작은 표면이 세포사 및 응집을 증가 보여준 반면에 도금 큰 표면 상에 도금 된 세포는 감소 된 증식을 보였다. 분리 후, 세포 배양 및 라미닌 커버 플레이트 상에 전개. 비 코팅 된 표면의 사용은 분리의 성공을 감소시키는 경향이 있었다. 이 때문에, 세포는 바람직하게는 직접 차단 후 사전에 피복 된 표면에 채취 할 수있다. 세포를 직접 분리 한 후 비 코팅면에 수확되는 경우 섬유 아세포 - 농후 배양 아세포 유래의 세포보다 우세 할 것이다. 그렇다 라미닌에서 이러한 마트 리겔 콜라겐 계 시약과 같은 다른 세포 부착 솔루션의 사용이 이용 될 수있다. 코팅 용액은 세포 성장을 촉진 성장 인자 및 다른 화합물을 포함 할 수 있지만 이러한 셀 동작하므로 실험 결과를 변경할 수있다. 에서그것은 임의의 성장 인자 또는 다른 보수 부족으로 경험 10 μg의 / ㎖의 라미닌 최적 농도 및 위성 세포 근원 세포 부착 및 증식을위한 적절한 시약을 도포한다. 또한, 라미닌 직접 골격근 섬유를 통해 위성 세포 부착 및 이주에 중요한 기능을 재생하는 sarcolemma에 연결된 기저판에 자연적으로 존재한다. 배양 배지의 보충은 기본 근원 세포의 거동에 불리한 영향을 미칠 수있다. 이러한 FGFs 또는 IGF-I과 IGF-II와 같은 예를 들어 성장 인자 그룹 들어, FGF-2 분열 및 프로그래밍 된 세포 사멸에 대한 응답 (31) 모두를 제어하여, 차 근원 세포 배양에서다면 발현 성 효과를 갖는다. 성인 및 노인의 근육 아세포로부터 단리 기본 동작의 차이 때문에 순도 O로 할 가능성이 매우 높다 특히 때문에 엄격 배양 조건을 제어하는 ​​것이 필요하다문화 및 장기 문화 35시 문화에서 근육 아세포를 초과하는 섬유 아 세포의 가능성 바. 우리는 섬유 아세포와 배양 물의 오염을 감소시키기 위해 비 - 코팅 표면 상 분리 제 중에 셀 1 시간 예비 도금을 사용 하였다. 우리는 설명 방법은 성인 및 노인 모두 인간 근육에서 근육 조직 선조 세포를 분리에 적합하다. 근육 조직 세포를 높은 비율로 나타낸 (도 1 MF20 면역 염색하여 가시화 MyoD 발현 및 근육 조직 특성 및 2) 및 프로세스의 기능 연구를위한 시험 관내 모델로서 사용될 수있는 바와 같이, 격리 된 셀은 셀의 대표 근원 성 집단으로 구성 근육 항상성과 관련. 이전의 연구는 인간의 기본 아세포의 분리 및 특성의 차이, 또는 이들의 부족으로부터 특징했다성인 및 노인 6, 20, 27, 28, 29, 30, 31, 35, 3, 6, 37, 38. 노인 및 / 또는 비 기능적 MPC와 인간의 존재는, (22) 6 (20)을 보여왔다. 그러나, 갓 고립 된 인간의 MPC와의 행동에 차이는 27을 표시 없습니다. 우리 프로토콜은 노인의 근육으로부터 격리 기본 아세포 증식의 감소 또는 노화 전위 적어도 부분적으로 자신의 표현형을 유지 차 아세포의 분리를 허용하고 이들의 사용을 허용(22) 노화하는 동안 근육 항상성의 분자 메커니즘의 기능 연구를위한 세포. 여기에 설명 된 방법을 사용하여 격리 된 기본 아세포는 근육 조직 분화 과정뿐만 아니라 이러한 에이징 동안 인간 근육 조직 전구 세포에서 발생하는 유전자 발현의 변화와 같은 세포 내 변화를 조사하기 위해 사용될 수있다. 그러나 장기간의 체외 배양시 세포에서 발생하는 변화는 노화 중에 발생하는 표현형과 유전자형 변화를 분석 할 때 고려 될 필요가있다. 우리는이 목적을 위해 갓 고립 된 세포를 사용하는 것이 좋습니다. 또한, 여기에 설명 된 기본 근원 세포 배양 방법은 강력한 시험 관내 기능 연구를 허용 팽창 및 일차 인간 근육 아세포의 비교적 장기 배양이 가능. 우리는 이전에 제안 된 방법을 사용하여 격리 된 근육 조직 전구 세포가 발현 프로파일 링 및 푸 모두에 사용될 수 있음을 보여 주었다근육 22 노화와 관련된 프로세스 nctional 연구. 이 방법은 성인 오래된 설치류의 근육에 적용하고 노화 및 기능 연구 (22) 중 유전 적, 후생 유전 학적 변화를 프로파일 링에 사용할 수있는 근육 아세포의 풍부한 문화 격리 수 있습니다. 이 방법의 제한은 어느 정도의 사용을 포함하는보다 복잡한 문서의 방법 6, 28, 29, 39, 40, 41, 42 사용하여 수득 할 수있는 셀이 아닌 위성 세포의 순수 인구의 혼합 집단, 43. 우리는 성인 및 노인에서 주요 근육 아세포 세포의 분리에 대한 단순화 저렴하고 재현성 프로토콜을 제시인간. 우리의 경험에 의하면, (위성 세포를-분류 FACS 등 MACS- 또는) 분리 및 인간의 기본 근육 아세포의 배양 가능한,보다 정교한 방법은 세포에 transcriptomic 또는 단백체 변화를 프로파일 링과 같은 연구의 몇 가지 유형에 이상적이다. 그러나, 이러한 방법은 고가의 전문 적어도 어느 정도 필요로 인해 순수한 차 근원 세포 배양 및 근육 아세포를 overgrowing 섬유 아세포의 낮은 증식 속도 어려울 수있다. 우리는 기능 연구에 사용하기 위해 인간의 기본 근육 아세포의 단순한 격리와 문화를 허용하는 재생 가능한 프로토콜을 제시한다. 또한, 우리는 라미닌 (42)의 사용과 성공적인 문화 (44)에 대한 핵심 요소로의 bFGF의 제한된 사용을 제안한다. 또한 세포를 분리하고, 제 1 통로 (45)에 하나의 프리 - 도금 공정시 원심 분리에 의해 발생 된 응력을 피하고 제안한다. 우리가, 요약하면격리 또한 설치류의 근육에 적용하고 표현과 근육 항상성의 기능 연구를 가능하게 성인 및 노인 인간의 근육에서 주요 근육 아세포 / MPC와 문화에 대한 효율적인 프로토콜을 최적화.

나약함에서 골격 근육 질량과 기능 결과의 질환 - 연령 관련 진보적 인 손실, 노인의 삶의 질에 강도 감소의 감소. 골격근은 약 40 %의 체질량 하나를 차지한다. 인해 지방 섬유증의 침투에 개별 근섬유 근육 품질 저하 점진적인 위축 노화 및 질병 중 1, 2, 3, 4, 5, 6을 발생한다. 최근에는 특히 설치류에서 발생하는 근육 섬유 손실은 인간 7에서 발생하지 않을 수 골격근의 노화 종 특이 차이가 발생하는 것이 제안되었다. 그럼에도 불구하고, 세 포유류의 나머지 근육 섬유 손상 및 장애의 재생에 대한 감수성을 증가 특징 <sup클래스 = &quot;외부 참조&quot;&gt; 8. 성인 근육의 유지 보수 및 수리 위성 세포 (9), (10)에 의해 매개된다. 근육 손상 및 다른 중요한 단서시 위성 세포 활성화 및 증식된다. 세포의 일부는 대기 상태로 반환하고 나머지는 근육 아세포 (근육 조직 전구 세포 - MPC와)로 진행한다. 이들은 기존의 근섬유 (11)의 복구에 기여. 위성 세포의 기능은 근육 재생의 성공, 12, 13, 14, 15을 입증되었다 노화 위성 세포의 가용성의 변경을 결정한다. 또한, 이전 인간과 쥐의 근육에서 위성 세포가 전사 프로파일 스위치를 표시하고 재생 환원 전위 (16), (17) </sup&gt; 18, 19. 이전 마우스 및 인간에서 근육 위성 세포가 또한 감소 기능 (20)에서 생성 된 노화를 겪는 것으로 밝혀졌다. 근육 항상성의 연구를 가능하게하는 가장 확립 된 세포주는 뮤린 C2C12 세포주 (21)이다. 연구의 상당량은 뮤린 차 아세포 (22)를 사용했다. 이러한 배양 뮤린 및 척추 근육 생성뿐만 아니라 근육의 재생, myotube / 근섬유 위축, 근육 질환 중에 발생, 23, 24, 25, 26 노화 비대증 공정의 상당한 이해를 이끌어왔다. 최근에, 몇몇 그룹은 근육 생성 근육 노화를 연구 인간의 기본 아세포를 사용하여 설명했다. 그러나 레가와 합의가 부족하다성인 및 노인 인간 27, 28, 29, 30, 31의 근 아세포로부터 단리 주 간의 차이 DS. 전신 및 지역 환경, 노화와 질병 6, 32, 33, 34, 개발 과정에서 발생하는 특징 차이에도 불구하고 체외 근원 세포와 myotube 문화는 근육 발달, 성장과 위축과 관련된 분자 메커니즘을 연구하기위한 가장 접근 도구 남아있다. 또한 이러한 연구는 단지 강력한를 제공 할뿐만 아니라 시험관 도구 비교적 빠르고 저렴하고 높은 처리량. 또한, 인간의 근육의 연구와 관련된 윤리적 의미는 유전자 발현의 조작과 관련된 기능 실험을 위해 의미 <em&gt; 시험 관내 인간의 근원 세포와 myotube 문화는 척추 동물 모델 생물에 사용할 수있는 유일한 대안이 남아있다. 여기서 우리는 성인 및 노인의 근육에서 주요 근육 아세포 또는 MPC와의 강력한 저렴하고 재현성 절연을위한 간단한 실험 프로토콜을 표시하고 체외 배양 (그림 1)의 표준화 된 조건을 설명합니다. 근육의 차 문화는 일반적으로 근육 아세포 외에 섬유 아세포를 포함, 우리는 개선 된 순도 및 기본 근육 아세포의 품질에 목표로 예비 도금 공정을 사용하는 것이 좋습니다. 요약하면, 우리는 효율적이고 재현 가능한 분리, 문화, 성인 및 노인의 골격근에서 농축 및 기능 MPC와 / 주요 근육 아세포의 기능 연구를 허용하는 프로토콜을 설립했다.

<table border="0" cellpadding="0" cellspacing="0" width="916">
	<tbody>
		<tr height="37">
			<td height="37" style="height:37px;width:183px;">60mm Petri dishes</td>
			<td style="width:101px;">Greiner Bio One</td>
			<td style="width:151px;">628160</td>
			<td style="width:483px;">Cellstar Cell culture dish, PS, 60/15 MM, VENTS.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Cell culture plates (6 wells)</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">CLS3516</td>
			<td style="width:483px;">Corning Costar cell culture plates. 6 well, flat bottom (Individually wrapped) .&#160;</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Cell culture plates (12 wells)</td>
			<td style="width:101px;">Greiner bio-one</td>
			<td style="width:151px;">657 160</td>
			<td style="width:483px;">Cellstar Cell culture Multiwell Plates.&#160;</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Culture flasks</td>
			<td style="width:101px;">Greiner Bio One</td>
			<td style="width:151px;">&#160;690175 (25cm2); 658175 (75cm2).</td>
			<td style="width:483px;">Cellstar Filter Cap Cell Culture Flasks.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Standard Disposable Scalpel</td>
			<td style="width:101px;">Granton</td>
			<td style="width:151px;">91310</td>
			<td style="width:483px;">Sterile stainless steel blade, pattern: 10.&#160;</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Pipettes</td>
			<td style="width:101px;">Greiner bio-one</td>
			<td style="width:151px;">606 180 (5 ml); 607 180 (10 ml); 760 180 (25 ml)</td>
			<td style="width:483px;">Cellstar Serological Pipettes.&#160;</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Pasteur plastic pipettes</td>
			<td style="width:101px;">Starlab</td>
			<td style="width:151px;">E1414-0311</td>
			<td style="width:483px;">3.0ml Graduated Pasteur Pipette (Sterile), Ind. Wrapped.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Syringe</td>
			<td style="width:101px;">BD</td>
			<td style="width:151px;">300613</td>
			<td style="width:483px;">20 mL BD eccentric tip syringe.&#160;</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">0.2 &#181;m filters</td>
			<td style="width:101px;">Gilson</td>
			<td style="width:151px;">ALG422A</td>
			<td style="width:483px;">Sterile Syringe Filters CA 0.2um 33mm Pk50.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Cell strainers</td>
			<td style="width:101px;">Fisher Scientific</td>
			<td style="width:151px;">11597522</td>
			<td style="width:483px;">Cell culture strainer sterile individually packed 70&#181;m polypropylene.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Collagenase D</td>
			<td style="width:101px;">Roche</td>
			<td style="width:151px;">11088882001</td>
			<td style="width:483px;">Collagenase D; ctivity: &#62;0.15 U/mg&#160;</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Dispase II</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">D4693</td>
			<td style="width:483px;">Dispase II Protease from Bacillus polymyx. Activity: &#8805;0.5 units/mg solid.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">CaCl2</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">449709</td>
			<td style="width:483px;">Calcium chloride, anhydrous, beads, &#8722;10 mesh, &#8805;99.9% trace metals basis&#160;</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Laminin</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">114956-81-9&#160;</td>
			<td style="width:483px;">Laminin from Engelbreth-Holm-Swarm murine sarcoma basement membrane. 1mg/mL.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">DMEM-high glucose</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">D5671</td>
			<td style="width:483px;">Dulbecco&#8217;s Modified Eagle&#8217;s Medium - high glucose. With 4500 mg/L glucose and sodium bicarbonate, without L-glutamine and sodium pyruvate.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">F-12 media</td>
			<td style="width:101px;">Gibco</td>
			<td style="width:151px;">21765029</td>
			<td style="width:483px;">Ham&#39;s F-12 Nutrient Mix. 1x + L-glutamine.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">FGF-b</td>
			<td style="width:101px;">PetroTech</td>
			<td style="width:151px;">100-18B&#160;</td>
			<td style="width:483px;">Recombinant Human Fibroblast Growth Factor-basic.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Fetal Bovine Serum (FBS)</td>
			<td style="width:101px;">Gibco</td>
			<td style="width:151px;">10270-106</td>
			<td style="width:483px;">Fetal Bovine Serum.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Horse serum (HS)</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">H1270</td>
			<td style="width:483px;">Horse Serum. Donor herd, USA origin, sterile-filtered.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Penicillin-Streptomycin</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">P0781</td>
			<td style="width:483px;">Penicillin-Streptomycin with 10,000 units penicillin and 10 mg streptomycin per mL in 0.9% NaCl, sterile-filtered.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">L-Glutamine</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">G7513</td>
			<td style="width:483px;">L-Glutamine solution. 200 mM, solution, sterile-filtered.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Trypsin-EDTA</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">T4049</td>
			<td style="width:483px;">Trypsin-EDTA solution. 0.25%, sterile-filtered.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">TrypLE Express&#160;</td>
			<td style="width:101px;">Gibco</td>
			<td style="width:151px;">12604-013</td>
			<td style="width:483px;">TrypLE Express Enzyme (1X), no phenol red.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">DPBS (cell culture)</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">D8537</td>
			<td style="width:483px;">Dulbecco&#8217;s Phosphate Buffered Saline. Modified, without calcium chloride and magnesium chloride.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">PBS (immunostaining)</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">P4417-50TAB</td>
			<td style="width:483px;">Phosphate buffered saline tablet. One tablet per 200 mL of deionized water (0.01 M phosphate buffer, 0.0027 M potassium chloride and 0.137 M sodium chloride, pH 7.4).&#160;</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Methanol</td>
			<td style="width:101px;">Fisher</td>
			<td style="width:151px;">M/4000/PC17</td>
			<td style="width:483px;">Methanol Analytical Reagent Grade</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Triton X-100</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">T8787</td>
			<td style="width:483px;">Triton X-100 for molecular biology.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">anti-MF 20 antibody</td>
			<td style="width:101px;">DSHB</td>
			<td style="width:151px;">MF20-c 2ea 211 &#181;g/ml.</td>
			<td style="width:483px;">MYH1E (MF 20) Mouse mAb.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">anti-MyoD antibody</td>
			<td style="width:101px;">Cell Signaling Technology</td>
			<td style="width:151px;">13812P</td>
			<td style="width:483px;">MyoD1 (D8G3) XP Rabbit mAb.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">anti-Ki67 antibody</td>
			<td style="width:101px;">Abcam</td>
			<td style="width:151px;">ab16667</td>
			<td style="width:483px;">Rabbit mAb to Ki67 [SP6].</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Anti-mouse 488 secondary antibody&#160;</td>
			<td style="width:101px;">Invitrogen</td>
			<td style="width:151px;">A-11029</td>
			<td style="width:483px;">Goat anti-Mouse IgG (H+L) Secondary Antibody, Alexa Fluor 488 conjugate.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Anti-rabbit 488 secondary antibody</td>
			<td style="width:101px;">ThermoFisher Scientific</td>
			<td style="width:151px;">A-11034</td>
			<td style="width:483px;">Goat anti-Rabbit IgG (H+L) Secondary Antibody, Alexa Fluor 488 conjugate.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">DAPI</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">Sigma-Aldrich</td>
			<td style="width:483px;">DAPI (4&#39;,6-Diamidino-2-Phenylindole, Dihydrochloride)</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Senescence &#946;-Galactosidase Staining Kit</td>
			<td style="width:101px;">Cell Signaling Technology</td>
			<td style="width:151px;">9860</td>
			<td style="width:483px;">Senescence &#946;-Galactosidase Staining kit.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">DMSO</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">41639</td>
			<td style="width:483px;">Dimethyl sulfoxide. BioUltra, for molecular biology, &#8805;99.5% (GC).&#160;</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Acridine Orange</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">A8097</td>
			<td style="width:483px;">Acridine Orange hydrochloride solution, 10 mg/mL in H2O.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Ethidium bromide</td>
			<td style="width:101px;">Sigma-Aldrich</td>
			<td style="width:151px;">E1510</td>
			<td style="width:483px;">Ethidium bromide solution. BioReagent, for molecular biology, 10 mg/mL in H2O.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Lipofectamine 2000</td>
			<td style="width:101px;">ThermoFisher Scientific</td>
			<td style="width:151px;">11668019</td>
			<td style="width:483px;">Lipofectamine 2000 Transfection Reagent</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Scramble control for transfections</td>
			<td style="width:101px;">Qiagen</td>
			<td style="width:151px;">1027271</td>
			<td style="width:483px;">miScript Inhibitor Neg. Control (5 nmol)</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Hsa-miR-378a-3p miScript Primer Assay</td>
			<td style="width:101px;">Qiagen</td>
			<td style="width:151px;">218300</td>
			<td style="width:483px;">Hs_miR-422b_1 miScript Primer Assay (targets mature miRNA: hsa-miR-378a-3p). MIMAT0000732: 5&#39;ACUGGACUUGGAGUCAGAAGGC</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Anti-hsa-miR-378a-3p miScript miRNA Inhibitor</td>
			<td style="width:101px;">Qiagen</td>
			<td style="width:151px;">219300</td>
			<td style="width:483px;">Anti-hsa-miR-378a-3p miScript miRNA Inhibitor (targets mature miRNA: hsa-miR-378a-3p). MIMAT0000732: 5&#39;ACUGGACUUGGAGUCAGAAGGC</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Megafuge 2.0 R Centrifuge</td>
			<td style="width:101px;">Heraeus</td>
			<td style="width:151px;">75003085</td>
			<td style="width:483px;">n/a</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Centrifuge rotor</td>
			<td style="width:101px;">Heraeus</td>
			<td style="width:151px;">3360</td>
			<td style="width:483px;">Heraeus Sepatech Megafuge Centrifuge Rotor BS4402/A. Max. radius: 15.5 cm.</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Eclipse Ti-E Inverted Microscope System</td>
			<td style="width:101px;">Nikon</td>
			<td style="width:151px;">n/a</td>
			<td style="width:483px;">Eyepieces: CFI 10x/22; Total magnification: 100x (MF20, Live/dead and Ki67).</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Axiovert 200 inverted microscope</td>
			<td style="width:101px;">Carl Zeiss</td>
			<td style="width:151px;">n/a</td>
			<td style="width:483px;">Eyepieces: Carl Zeiss 1016-758 W-PI 10x/25; Total magnification: 100x (Senescence &#946;-Galactosidase Staining).</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Axiovert 25 inverted microscope</td>
			<td style="width:101px;">Carl Zeiss</td>
			<td style="width:151px;">n/a</td>
			<td style="width:483px;">Eyepieces: E-PL 10x/20. Total magnification: 100x (bright field).</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:38px;width:183px;">Diaphot Inverted Tissue Culture Microscope</td>
			<td style="width:101px;">Nikon</td>
			<td style="width:151px;">n/a</td>
			<td style="width:483px;">Eyepiece: CFWN 10x/20. Total magnification: 100x (bright field).</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:183px;">Hydromount</td>
			<td style="width:101px;">National Diagnostics</td>
			<td style="width:151px;">HS-106</td>
			<td style="width:483px;">Hydromount</td>
		</tr>
	</tbody>
</table>

preparation and culture of myogenic precursor cells/primary myoblasts from skeletal muscle of adult and aged humans

골격 근육 항상성은 근육 성장 (비대), 위축 및 재생에 따라 달라집니다. 노화 동안 여러 질환, 근육 낭비가 발생합니다. 근육 질량 및 기능의 상실은 근육 섬유 계 위축증, 섬유 형 스위칭 위성 세포, 근육 모세포, 기타 병태 생리 학적 과정의 기능 장애와 관련된 결함이 근육 재생과 관련된다. 이러한 변화는 세포의 변화뿐만 아니라 지역 및 전신 틈새 시장과 연결되어 있습니다. 근육 노화 가장 일반적으로 사용되는 설치류 모델 이외에도,이 근육 항상성을 연구 할 필요가있다 의한 윤리적 의미로 주로 체외 배양 이루어져 인체 모델을 사용 낭비. 인간의 근육 조직 전구 세포 (MPC와)과 근육 생성의 주요 근육 아세포의 광범위한 사용에도 불구하고, 분자 메커니즘은 나이 관련 뮤스의 다양한 측면을 규제 연구하는 인간의 기본 근육 모세포와 myotube 문화를 사용하는 방법에 대한 제한적인 데이터를이CLE 낭비, 쥐의 근육에서 제안 노화의 메커니즘의 검증을 돕는. 성인 및 노인에서 고립 된 인간의 MPC와, 기본 근육 아세포 및 myotubes의 사용은 근육 성장, 위축 및 재생과 관련된 프로세스의 분자 메커니즘의 생리 관련 모델을 제공합니다. 효소 소화를 사용하여 인간의 근육 샘플에서 근육 아세포 및 myotubes - 여기에서 우리는 세부 사항에 격리와 인간의 MPC와 그들의 자손의 유지 관리를 위해 강력한 저렴 재현하고 효율적인 프로토콜을 설명합니다. 또한, 우리는 성인과 노인에서 주요 근육 아세포는 체외 문화 노화를 받아야하는 통로 수를 결정했다. 마지막으로, 이러한 근육 아세포를 형질 감염 할 수있는 능력 및 증식 및 분화 능력을 특성화하고 근육 생성 및 근육 체외 낭비 분자 메커니즘의 기능 시험을 수행하기위한 적합성을 제시하는 능력을 나타낸다. </p&gt;

MPC와 / 주요 근육 아세포는 라미닌 - 코팅 된 표면 (그림 2) 상에 표시 24 시간 후 파종해야한다. 세포 (그림 1A를, B) 스핀들 형상을 채택해야하며, 통로 (4) 아직 MyoD을 표현한다. 섬유 아세포는 별 모양 형태와 MyoD (도 1B, C)의 발현의 부족에 의해 구별 될 수있다. 셀은 다음 날에 부착하면 미디어 bFGF를 신선한 배지로 교체한다. 문화 미디어는 모든 48 시간을 교체해야합니다. 대표 결과는 여기에 표시하고 고립과 문화 프로토콜을 지원하고 인간의 기본 근육 아세포의 기능 연구에 사용할 수있는 다른 기술을 보여주기 위해 우리의 실험실 (22)의 목표에서 데이터를 발표했다. 근원 세포 증식 stainin 사용하여 사료된다 면역 염색과 생존을 사용하여 공부하실 수 있습니다세포 생존 분석을위한 g (그림 3). 분화, 배양 배지는 차별화 매체로 변경해야합니다. Myotubes 5에 형성한다 - 7 일 이내 무거운 체인 플러스 (그림 3) 미오신합니다. 근육 아세포가 세 명 (그림 3)의 근육에서 분리 될 때 myotube 형성이 덜 효율적이 될 수도 있습니다. 노화 (SA-β 갈 락토시다 제) 염색은 배양에서 노화 세포의 비율을 설정하기 위해 (도 3)에서 수행 될 수있다. 우리는 더 이상 문화 (그림 3, 유로 4)와, 세 사람의 근육에서 분리 된 더 많은 근육 아세포는 노화를 보여줄 것을 관찰했다. 기능 연구를 들면, 유전자와 마이크로 RNA 발현은 발현 벡터, siRNA를, 마이크로 RNA의 모방과 antimiRs (그림 4)의 친 유성 형질 전환 시약 - 매개 전달을 사용하여 조작 할 수 있습니다. 이 40 수 있습니다 -유전자 / 마이크로 RNA 레벨 업되는 70 %의 형질 전환 효율 또는 생리 학적 범위 (그림 4; 22) 내에서 조정 다운. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 배양 용기 </td><td> 약. 지역 (물론 당) </td><td> 10 μg의 / ML의 라미닌의 볼륨 </td></tr><tr><td> 35mm 요리 </td><td> 10cm 2 </td><td> 1 mL의 </td></tr><tr><td> 60mm 요리 </td><td> 20cm 2 </td><td> 2 mL의 </td></tr><tr><td> 100mm 요리 </td><td> 60cm 2 </td><td> 4 mL의 </td></tr><tr><td> 24 웰 플레이트 </td><td> 2cm 2 </td><td> 200 μL / 웰 </td></tr><tr><td> 12 웰 플레이트 </td><td> 4cm 2 </td><td> 500 μL / 웰 </td></tr><tr><td> 6 잘 판 </td><td> 10cm 2 </td><td> 1 mL의 /도 </td></tr><tr><td> T25 </td><td> 25cm 2 </td><td> 3 mL의 </td></tr><tr><td> T75 </td><td> 75cm 2 </td><td> 5 ㎖ </td></tr></tbody></table> 표 1. 코팅 문화 표면에 대한 라미닌 DPBS 솔루션 (10 μg의 / ㎖)의 권장 최소 볼륨. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td></td><td> 특정 활동 / 몰 질량 </td><td> 최종 농도 </td><td> 10 mL의 솔루션에 필요한 질량 또는 부피 </td></tr><tr><td> 콜라게나 D </td><td> 0.15 U / mg의 </td><td> 10 ㎎ / ㎖ (150 U / ㎖) </td><td> 100 mg의 </td></tr><tr><td> 디스 파제 II </td><td> 0.5 U / mg의 </td><td> 4.8 ㎎ / ㎖ (2.4 U / mL) 중 </td><td> 48 mg의 </td></tr><tr><td> 250 mM의 염화칼슘 (2) </td><td> (110)0.98 g / 몰 </td><td> 2.5 밀리미터 </td><td> 100 μL </td></tr></tbody></table> 표 근육 소화 2. 효소 준비. <img alt="그림 1" src="/files/ftp_upload/55047/55047fig1.jpg" /> 의정서의 단계를 요약 그림 1. 그래픽 개요입니다. 위 또는 수술 메스 (I)와 인간의 근육 조직 검사의 해리. 40 분 (II) - (30) 37 ℃에서의 효소 용액과 함께 인큐베이션. 원심 분리 튜브에 70 ㎛의 멤브레인 필터를 통해 용액을 성장 배지를 첨가하고, 여과를 통해 소화 단부 (III). 5 분 (IV) 443 XG에 원심 분리. 상층 액을 버리고 2.5 NG / mL의 FGF (V)를 포함 성장 배지에 재현 탁. (10)로 코팅 접시에 세포를 도금81; g / 라미닌, 24 시간 (VI) 후 용지를 변경 용액. <a href="http://ecsource.jove.com/files/ftp_upload/55047/55047fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/55047/55047fig2.jpg" /> 다른 구절에서 성인 및 노인 인간의 근육에서 분리 2. 근육 아세포 그림. 를했다. (: 세 30 ± 2.8 세, 69 ± 5 세, BMI &lt;25 성인) 이미지는 신근 심지 브레비스, 여성 환자의 정강 뼈 앞쪽 또는 납치범 halluces 근육에서 분리 된 근육 아세포를 나타냅니다. 통로 0과 도금되는 5 일 후, 세포는 여전히 라운드 작은, 그러나 눈에 보이는 밝은 빛 현미경 (A) 아래에 있습니다. 통로 (2) (A)에 도시 한 바와 같이 근육 아세포는, 장척 형상을 채용한다. MyoD는 섬유 아 세포에서 근육 아세포에서 발현되지 않지만,<html> (B). MyoD 양성 세포의 정량화가 표시됩니다; 오차 막대는 표준 편차를 보여; N = 3 (B). 근원 세포 및 섬유 아세포의 형태 (C) 사이의 차이를 보여주는 대표적인 이미지. <a href="http://ecsource.jove.com/files/ftp_upload/55047/55047fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/55047/55047fig3.jpg" /> 그림 3. 인간의 기본 근육 아세포는 다른 염색 기법을 사용하여 특징이 될 수 있습니다. 세포의 생존 능력은 세포 생존 분석을위한 염색을 사용하여 시각화 할 수 있으며, 확산 사료된다 면역 염색을 사용하여 평가 될 수 있으며, 분화가 MF20을 사용하여 평가 될 수있다 (마이 오신 중쇄) 면역과 노화 노화 관련 베타 갈 락토시다 제를 사용하여 시각화 할 수있다 (SA-β-갈 락토시다 ) 염색.<html> ecsource.jove.com/files/ftp_upload/55047/55047fig3large.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 4" src="/files/ftp_upload/55047/55047fig4.jpg" /> 그림 4. 인간의 기본 근육 아세포는 체외에서 근육 항상성의 기능 연구에 사용할 수 있습니다. A. MF20 (마이 오신 중쇄) myotube 크기와 수에은 miR-378의 과발현 또는 억제의 효과를 보여주는 성인 인간에서 차별화 된 기본 myotubes의 면역 염색. 인간의 기본 근육 아세포에서은 miR-378의 과발현 또는 억제 다음은 miR-378과 IGF1R, 검증은 miR-378 표적 유전자의 상대적 발현을 보여주는 B. qPCR에. RNU-6 및 β-2 마이크로 글로불린에 대하여 식을 각각 나타낸다. 오차 막대는 SEM을 보여; N = 3, * - P &lt;0.05, 학생 T 테스트.JPG &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Watch this Scientific Journal Video about Preparation and Culture of Myogenic Precursor Cells/Primary Myoblasts from Skeletal Muscle of Adult and Aged Humans at JoVE.com

Preparation and Culture of Myogenic Precursor Cells/Primary Myoblasts from Skeletal Muscle of Adult and Aged Humans

이 프로토콜은 성인과 노인의 골격 근육에서 분리 및 근원 세포의 전구 세포의 문화의 강력한 재현하고 간단한 방법을 설명합니다. 여기에 사용되는 근육은 발과 다리 근육을 포함한다. 이 방법은 기능 연구를위한 주요 근육 아세포의 풍부한 인구의 분리를 할 수 있습니다.

성인 및 노인 인간의 골격 근육에서 근육 조직 전구체 세포 / 차 근육 아세포의 준비 및 문화

Skeletal muscle homeostasis depends on muscle growth (hypertrophy), atrophy and regeneration. During ageing and in several diseases, muscle wasting ...

preparation-culture-myogenic-precursor-cellsprimary-myoblasts-from

Research

JoVE Journal

Developmental Biology

21.7K 조회수.  University of Liverpool.  이 프로토콜은 성인과 노인의 골격 근육에서 분리 및 근원 세포의 전구 세포의 문화의 강력한 재현하고 간단한 방법을 설명합니다. 여기에 사용되는 근육은 발과 다리 근육을 포함한다. 이 방법은 기능 연구를위한 주요 근육 아세포의 풍부한 인구의 분리를 할 수 있습니다. 

비디오: Preparation and Culture of Myogenic Precursor Cells/Primary Myoblasts from Skeletal Muscle of Adult and Aged Humans

Isolation and Quantitative Immunocytochemical Characterization of Primary Myogenic Cells and Fibroblasts from Human Skeletal Muscle

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated from human muscle biopsy samples using enzymatic digestion and their myogenic properties studied in culture. Quantitatively, the two main adherent cell types obtained from enzymatic digestion are: (i) the satellite cells (termed myogenic cells or muscle precursor cells), identified initially as CD56+ and later as CD56+/desmin+ cells and (ii) muscle-derived fibroblasts, identified as CD56&#8211; and TE-7+. Fibroblasts proliferate very efficiently in culture and in mixed cell populations these cells may overrun myogenic cells to dominate the culture. The isolation and purification of different cell types from human muscle is thus an important methodological consideration when trying to investigate the innate behavior of either cell type in culture. Here we describe a system of sorting based on the gentle enzymatic digestion of cells using collagenase and dispase followed by magnetic activated cell sorting (MACS) which gives both a high purity (&#62;95% myogenic cells) and good yield (~2.8 x 106 &#177; 8.87 x 105 cells/g tissue after 7 days in vitro) for experiments in culture. This approach is based on incubating the mixed muscle-derived cell population with magnetic microbeads beads conjugated to an antibody against CD56 and then passing cells though a magnetic field. CD56+ cells bound to microbeads are retained by the field whereas CD56&#8211; cells pass unimpeded through the column. Cell suspensions from any stage of the sorting process can be plated and cultured. Following a given intervention, cell morphology, and the expression and localization of proteins including nuclear transcription factors can be quantified using immunofluorescent labeling with specific antibodies and an image processing and analysis package.

The main adherent cell types derived from human muscle are myogenic cells and fibroblasts. Here, cell populations are enriched using magnetic-activated cell sorting based on the CD56 antigen. Subsequent immunolabelling with specific antibodies and use of image analysis techniques allows quantification of cytoplasmic and nuclear characteristics in individual cells.

인간의 골격근에서 기본 근육 조직 세포와 섬유 아 세포의 분리 및 정량 면역 세포 화학 특성

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated ...

연구

발생학

Analysis of Zebrafish Larvae Skeletal Muscle Integrity with Evans Blue Dye

The zebrafish model is an emerging system for the study of neuromuscular disorders. In the study of neuromuscular diseases, the integrity of the muscle membrane is a critical disease determinant. To date, numerous neuromuscular conditions display degenerating muscle fibers with abnormal membrane integrity; this is most commonly observed in muscular dystrophies. Evans Blue Dye (EBD) is a vital, cell permeable dye that is rapidly taken into degenerating, damaged, or apoptotic cells; in contrast, it is not taken up by cells with an intact membrane. EBD injection is commonly employed to ascertain muscle integrity in mouse models of neuromuscular diseases. However, such EBD experiments require muscle dissection and/or sectioning prior to analysis. In contrast, EBD uptake in zebrafish is visualized in live, intact preparations. Here, we demonstrate a simple and straightforward methodology for performing EBD injections and analysis in live zebrafish. In addition, we demonstrate a co-injection strategy to increase efficacy of EBD analysis. Overall, this video article provides an outline to perform EBD injection and characterization in zebrafish models of neuromuscular disease.

In this study, we describe a straightforward method to perform Evans Blue Dye (EBD) analysis on zebrafish larvae. This technique is a powerful tool for the characterization of skeletal muscle integrity and delineation of zebrafish models of muscular dystrophy, and is a valuable method for the development of novel therapeutics.

에반스 블루 염료와 Zebrafish의 애벌레 골격 근육 무결성 분석

The zebrafish model is an emerging system for the study of neuromuscular disorders.  In the study of neuromuscular diseases, the integrity of the muscle ...

Isolation and Culture of Adult Zebrafish Brain-derived Neurospheres

The zebrafish is a highly relevant model organism for understanding the cellular and molecular mechanisms involved in neurogenesis and brain regeneration in vertebrates. However, an in-depth analysis of the molecular mechanisms underlying zebrafish adult neurogenesis has been limited due to the lack of a reliable protocol for isolating and culturing neural adult stem/progenitor cells. Here we provide a reproducible method to examine adult neurogenesis using a neurosphere assay derived from zebrafish whole brain or from the telencephalon, tectum and cerebellum regions of the adult zebrafish brain. The protocol involves, first the microdissection of zebrafish adult brain, then single cell dissociation and isolation of self-renewing multipotent neural stem/progenitor cells. The entire procedure takes eight days. Additionally, we describe how to manipulate gene expression in zebrafish neurospheres, which will be particularly useful to test the role of specific signaling pathways during adult neural stem/progenitor cell proliferation and differentiation in zebrafish.

Here we provide a reproducible method to examine adult neurogenesis using a neurosphere assay derived from the whole brain or from either the telencephalic, tectal or cerebellar regions of the adult zebrafish brain. Additionally, we describe the procedure to manipulate gene expression in zebrafish neurospheres.

성인 Zebrafish의 뇌 유래 neurosphere를의 분리 및 문화

The zebrafish is a highly relevant model organism for understanding the cellular and molecular mechanisms involved in neurogenesis and brain regeneration ...

Induction of Acute Skeletal Muscle Regeneration by Cardiotoxin Injection

Skeletal muscle regeneration is a physiological process that occurs in adult skeletal muscles in response to injury or disease. Acute injury-induced skeletal muscle regeneration is a widely used, powerful model system to study the events involved in muscle regeneration as well as the mechanisms and different players. Indeed, a detailed knowledge of this process is essential for a better understanding of the pathological conditions that lead to skeletal muscle degeneration, and it aids in identifying new targeted therapeutic strategies. The present work describes a detailed and reproducible protocol to induce acute skeletal muscle regeneration in mice through a single intramuscular injection of cardiotoxin (CTX). CTX belongs to the family of snake venom toxins and causes myolysis of myofibers, which eventually triggers the regeneration events. The dynamics of skeletal muscle regeneration is evaluated by histological analysis of muscle sections. The protocol also illustrates the experimental procedures for dissecting, freezing, and cutting the Tibialis Anterior muscle, as well as the routine Hematoxylin &#38; Eosin staining that is widely used for subsequent morphological and morphometric analysis.

This manuscript describes a detailed protocol to induce acute skeletal muscle regeneration in adult mice and subsequent manipulations of the muscles, such as dissection, freezing, cutting, routine staining, and myofiber cross-sectional area analysis.

Cardiotoxin 주입에 의한 급성 골격 근육 재생 유도

Skeletal muscle regeneration is a physiological process that occurs in adult skeletal muscles in response to injury or disease. Acute injury-induced ...

Isolation of Human Myoblasts, Assessment of Myogenic Differentiation, and Store-operated Calcium Entry Measurement

Satellite cells (SC) are muscle stem cells located between the plasma membrane of muscle fibers and the surrounding basal lamina. They are essential for muscle regeneration. Upon injury, which occurs frequently in skeletal muscles, SCs are activated. They proliferate as myoblasts and differentiate to repair muscle lesions. Among many events that take place during muscle differentiation, cytosolic Ca2+ signals are of great importance. These Ca2+ signals arise from Ca2+ release from internal Ca2+ stores, as well as from Ca2+ entry from the extracellular space, particularly the store-operated Ca2+ entry (SOCE). This paper describes a methodology used to obtain a pure population of human myoblasts from muscle samples collected after orthopedic surgery. The tissue is mechanically and enzymatically digested, and the cells are amplified and then sorted by flow cytometry according to the presence of specific membrane markers. Once obtained, human myoblasts are expanded and committed to differentiate by removing growth factors from the culture medium. The expression levels of specific transcription factors and in vitro immunofluorescence are used to assess the myogenic differentiation process in control conditions and after silencing proteins involved in Ca2+ signaling. Finally, we detail the use of Fura-2 as a ratiometric Ca2+ probe that provides reliable and reproducible measurements of SOCE.

Here, we describe a methodology to obtain a pure population of human myoblasts from adult muscle tissue. These cells are used to study in vitro skeletal muscle differentiation and, in particular, to study proteins involved in Ca2+ signaling.

인간의 Myoblast의 분리, Myogenic 분화의 평가 및 저장 운영 칼슘 항목 측정

Satellite cells (SC) are muscle stem cells located between the plasma membrane of muscle fibers and the surrounding basal lamina. They are essential for ...

Application of Chronic Stimulation to Study Contractile Activity-induced Rat Skeletal Muscle Phenotypic Adaptations

Skeletal muscle is a highly adaptable tissue, as its biochemical and physiological properties are greatly altered in response to chronic exercise. To investigate the underlying mechanisms that bring about various muscle adaptations, a number of exercise protocols such as treadmill, wheel running, and swimming exercise have been used in the animal studies. However, these exercise models require a long period of time to achieve muscle adaptations, which may be also regulated by humoral or neurological factors, thus limiting their applications in studying the muscle-specific contraction-induced adaptations. Indirect low frequency stimulation (10 Hz) to induce chronic contractile activity (CCA) has been used as an alternative model for exercise training, as it can successfully lead to muscle mitochondrial adaptations within 7 days, independent of systemic factors. This paper details the surgical techniques required to apply the treatment of CCA to the skeletal muscle of rats, for widespread application in future studies.

This protocol describes the use of the chronic contractile activity model of exercise to observe stimulation-induced skeletal muscle adaptations in the rat hindlimb.

수축 성 활동 유도 된 쥐 골격 근육 Phenotypic 적응 연구 만성 자극에의 응용

Skeletal muscle is a highly adaptable tissue, as its biochemical and physiological properties are greatly altered in response to chronic exercise. To ...

Identification of Skeletal Muscle Satellite Cells by Immunofluorescence with Pax7 and Laminin Antibodies

Immunofluorescence is an effective method that helps to identify different cell types on tissue sections. In order to study the desired cell population, antibodies for specific cell markers are applied on tissue sections. In adult skeletal muscle, satellite cells (SCs) are stem cells that contribute to muscle repair and regeneration. Therefore, it is important to visualize and trace the satellite cell population under different physiological conditions. In resting skeletal muscle, SCs reside between the basal lamina and myofiber plasma membrane. A commonly used marker for identifying SCs on the myofibers or in cell culture is the paired box protein Pax7. In this article, an optimized Pax7 immunofluorescence protocol on skeletal muscle sections is presented that minimizes non-specific staining and background. Another antibody that recognizes a protein (laminin) of the basal lamina was also added to help identify SCs. Similar protocols can also be used to perform double or triple labeling with Pax7 and antibodies for additional proteins of interest.

The precise identification of satellite cells is essential for studying their functions under various physiological and pathological conditions. This article presents a protocol to identify satellite cells on adult skeletal muscle sections by immunofluorescence-based staining.

Pax7 Laminin 항 체와 면역 형광에 의해 골격 근육 인공위성 세포의 식별

Immunofluorescence is an effective method that helps to identify different cell types on tissue sections. In order to study the desired cell population, ...

The Isolation and Culture of Primary Epicardial Cells Derived from Human Adult and Fetal Heart Specimens

The epicardium, an epithelial cell layer covering the myocardium, has an essential role during cardiac development, as well as in the repair response of the heart after ischemic injury. When activated, epicardial cells undergo a process known as epithelial to mesenchymal transition (EMT) to provide cells to the regenerating myocardium. Furthermore, the epicardium contributes via secretion of essential paracrine factors. To fully appreciate the regenerative potential of the epicardium, a human cell model is required. Here we outline a novel cell culture model to derive primary epicardial derived cells (EPDCs) from human adult and fetal cardiac tissue. To isolate EPDCs, the epicardium is dissected from the outside of the heart specimen and processed into a single cell suspension. Next, EPDCs are plated and cultured in EPDC medium containing the ALK 5-kinase inhibitor SB431542 to maintain their epithelial phenotype. EMT is induced by stimulation with TGF&#946;. This method enables, for the first time, the study of the process of human epicardial EMT in a controlled setting, and facilitates gaining more insight in the secretome of EPDCs that may aid heart regeneration. Furthermore, this uniform approach allows for direct comparison of human adult and fetal epicardial behavior.

The epicardium plays a crucial role in the development and repair of the heart by providing cells and growth factors to the myocardial wall. Here, we describe a method to culture human primary epicardial cells that enables the study and comparison of their developmental and adult characteristics.

분리와 인간 성인 그리고 태아 심장 표본에서 파생 하는 기본 Epicardial 세포의 문화

The epicardium, an epithelial cell layer covering the myocardium, has an essential role during cardiac development, as well as in the repair response of ...

Isolation, Culture, Characterization, and Differentiation of Human Muscle Progenitor Cells from the Skeletal Muscle Biopsy Procedure

The use of primary human tissue and cells is ideal for the investigation of biological and physiological processes such as the skeletal muscle regenerative process. There are recognized challenges to working with human primary adult stem cells, particularly human muscle progenitor cells (hMPCs) derived from skeletal muscle biopsies, including low cell yield from collected tissue and a large degree of donor heterogeneity of growth and death parameters among cultures. While incorporating heterogeneity into experimental design requires a larger sample size to detect significant effects, it also allows us to identify mechanisms that underlie variability in hMPC&#160;expansion capacity, and thus allows us to better understand heterogeneity in skeletal muscle regeneration. Novel mechanisms that distinguish the expansion capacity of cultures have the potential to lead to the development of therapies to improve skeletal muscle regeneration.

We present techniques for isolating, culturing, characterizing, and differentiating human primary muscle progenitor cells (hMPCs) obtained from skeletal muscle biopsy tissue. hMPCs obtained and characterized through these methods can be used to subsequently address research questions related to human myogenesis and skeletal muscle regeneration.

골격 근 생검 절차에서 인간 근육 선조 세포의 격리, 배양, 특성화 및 분화

The use of primary human tissue and cells is ideal for the investigation of biological and physiological processes such as the skeletal muscle ...

Performing Human Skeletal Muscle Xenografts in Immunodeficient Mice

Treatment effects observed in animal studies often fail to be recapitulated in clinical trials. While this problem is multifaceted, one reason for this failure is the use of inadequate laboratory models. It is challenging to model complex human diseases in traditional laboratory organisms, but this issue can be circumvented through the study of human xenografts. The surgical method we describe here allows for the creation of human skeletal muscle xenografts, which can be used to model muscle disease and to carry out preclinical therapeutic testing. Under an Institutional Review Board (IRB)-approved protocol, skeletal muscle specimens are acquired from patients and then transplanted into NOD-Rag1null IL2r&gamma;null (NRG) host mice. These mice are ideal hosts for transplantation studies due to their inability to make mature lymphocytes and are thus unable to develop cell-mediated and humoral adaptive immune responses. Host mice are anaesthetized with isoflurane, and the mouse tibialis anterior and extensor digitorum longus muscles are removed. A piece of human muscle is then placed in the empty tibial compartment and sutured to the proximal and distal tendons of the peroneus longus muscle. The xenografted muscle is spontaneously vascularized and innervated by the mouse host, resulting in robustly regenerated human muscle that can serve as a model for preclinical studies.

Complex human diseases can be challenging to model in traditional laboratory model systems. Here, we describe a surgical approach to model human muscle disease through the transplantation of human skeletal muscle biopsies into immunodeficient mice.

면역 결핍 마우스에서 인간 골격 근 이종이식 수행

Treatment effects observed in animal studies often fail to be recapitulated in clinical trials. While this problem is multifaceted, one reason for this ...