저자는 자신의 플라스미드 인 Xiaobin Zhang에게 감사 드리고자합니다. 우리는 또한 Shaorong Gao와 Qianfei Wang에게 실험 중에 도움을 주신 것에 대해 감사드립니다. 이 연구는 중국 국립 자연 과학 재단 (No.81101346, 81271963, 81100331), 베이징 215 고급 인재 프로젝트 (No.2014-3-025) 및 베이징 차오양 병원 기금 (No CYXX-2017-01), 중국 과학 아카데미 청소년 혁신 진흥 협회 (YL).

PBCs로부터 hiPSC를 생성하기위한 프로토콜은 이전의 연구 5 에서 찾을 수있다. 이 연구는 우리 기관의 기관 검토위원회 (Institutional Review Board)의 승인을 받았습니다. 1. 배아 체 (EB) 형성 <ol><li> hiPSC 배지 50 ML : 15 % 녹아웃 혈청 대체 (KSR), 5 % 태아 소 혈청 (FBS), 1 × 비 필수 아미노산, 55 μM 2- 메르 캅토 에탄올, 2 MM L을 보충 한 녹아웃 Dulbecco의 수정 이글 매체 (DMEM) - 글루타민 및 8 ng / mL 기본 섬유 아세포 성장 인자 (bFGF). </li><li> 50 ML의 EB 형성 매체 : 15 % KSR, 5 % FBS, 1x 비 필수 아미노산, 55 μM 2- 메르 캅토 에탄올 및 2 MM L - 글루타민으로 보충 DMEM을 확인하십시오. </li><li> 기본 배양 배지 50 ML : 20 % FBS, 1 × 비 필수 아미노산, 55 μm의 2 - mercaptopoethanol, 2 MM L - 글루타민으로 보충 DMEM을 확인하십시오. </li><li> 디스 패아 제 용액 10 mL를 녹아웃 DMEM에 1 mg / mL로 준비합니다. </li><li> 문화피더 세포 ( 즉, 조사 된 마우스 배아 섬유 아세포 세포의 단일 층)를 갖는 60-mm 조직 배양 접시에 hiPSCs를 재현한다. 세포가 80-90 % 합류되면 dispasis로 세포를 분리하고 4-5 일마다 hiPSCs 1 : 3을 통과시킵니다. 37 ° C와 5 % CO 2 배양기에 세포를 놓습니다. </li><li> iPSCs가 80-90 % 합류하는 경우, 불 - 그린 유리 바늘을 사용하여 미분 hiPSC 식민지를 작은 조각 (직경 약 50-100 μm)으로 해부합니다. 일반적으로, 100mm 페트리 접시에 EBs를 생성하는 60mm 요리에 hiPSC 식민지를 사용하십시오. <ol><li> 10 mm의 EB 형성 배지가 들어있는 100 mm 비 접착 성 배양 접시에서 100 개 미만의 작은 콜로니 조각을 배양합니다. 접시를 37 ° C 및 5 % CO 2 배양기에 넣으십시오. </li></ol></li><li> 초기 배지의 약 25 %를 2 일마다 동일한 양의 배양 배지로 교체하십시오. EB를 고정 시키도록 접시를 기울이십시오. 조심스럽게 3 mL신선한 배지 4 mL를 넣는다. EB를 방해하지 마십시오. 참고 : EBs는 현미경으로 부드러운 테두리와 둥근 모양을 취하는 식민지 조각에 의해 형태학 특징입니다. </li><li> 비 접착 성 배양 접시에서 10 일간 배양 한 후 사용하기 전에 37 ℃에서 30 분 동안 0.1 % 젤라틴 4 mL로 새로운 100 mm 조직 배양 접시를 코팅하십시오. </li><li> 매체 플러스 EB를 100mm, 비 접착 성 페트리 접시에서 15mL 원추형 튜브로 옮기십시오. EBs가 4-5 분 동안 침전되게하십시오. 조심스럽게 상청액을 흡인하고 중성 플러스 EB 0.5 mL 미만을 남겨 둡니다 </li><li> 10 ㎖의 기본 배양 배지가있는 100 mm 젤라틴 코팅 조직 배양 접시에 100 EB 미만의 종자를 뿌립니다. 접시를 37 ° C 및 5 % CO 2 배양기에 넣으십시오. </li></ol> 2. 세포 펠렛 형성과 연골 세포의 분화 <ol><li> 0.25 % 트립신 / 에틸렌 디아민 테트라 아세트산 (EDTA) 10 mL를 만든다. bas의 80 ML을 확인하십시오α 배양 배지 : 20 % FBS, 1x 비 필수 아미노산, 55μM 2- 메르 캅토 에탄올 및 2mM L- 글루타민으로 보충 된 DMEM. </li><li> 10 % 인슐린 - 트랜스페린 - 셀레늄 용액 (ITS), 0.1 μM dexamethasone, 1 mM ascorbic acid, 1 % sodium pyruvate 및 10 ng / mL transforming growth factor-로 보충 된 DMEM (고 포도당) 10 ml를 연골 분화 배지로 만든다. 베타 1 (TGF-β1). </li><li> 48 시간 후 기본 배지 10 ML로 매체를 새로 고침. 그 후, 기본 배지 10 mL로 3 일마다 배지를 새로 고친다. 참고 : 배양 10 일 후, 섬유 아세포 세포의 성장은 EB에서 확장되어야합니다. <ol><li> 37 ° C에서 30 분 동안 0.1 % 젤라틴 4 mL로 100 mm 접시를 코팅하십시오. 세포 상등액을 버리고 Dulbecco의 인산염 완충 식염수 (DPBS)로 한 번 씻으십시오. </li><li> 37 ℃에서 0.25 % 트립신 / EDTA 3 mL로 세포를 소화시키고 5 분간 처리하고 4 mL의 기본 배지. </li></ol></li><li> 5-10 배 위아래로 pipetting하고 70 μm의 나일론 메쉬를 통해 그들을 통과하여 단일 세포에 세포를 떼어. 5 분 200 XG에서 세포 현탁액을 원심 분리기. 세포를 새로운 100mm 젤라틴 코팅 조직 배양 접시에 다시 넣고 기본 배지 10 mL를 넣으십시오. </li><li> 48 시간 후 기본 배지 10 ML로 매체를 새로 고침. 그 후, 기본 배지 10 mL로 3 일마다 배지를 새로 고친다. 참고 : 세포는 균일 한 섬유 모세포 유사 형태를 획득합니다. </li><li> ~ 90-100 % 합류 ( 즉, 약 5-7 일)에 도달하면, 세포를 37 ℃에서 0.25 % 트립신 / EDTA 3 mL로 5 분 동안 수확한다. 4 mL의 기본 배지로 중화시킨다. 5 회 위아래로 pipetting하여 단일 세포로 세포를 떼어. hemocytometer를 사용하여 세포 번호를 계산합니다. <ol><li> 15 mL 폴리 프로필렌 튜브에 3 x 10 5 세포를 놓습니다. 200 xg로 원심 분리기실온 (RT)에서 5 분간. chondrogenic 차별화 매체 1 ML의 세포를 다시 일시 중지합니다. </li></ol></li><li> 3 분 동안 300 XG에서 세포를 재 원심 분리하고 작은 펠렛 형태로 세포를 유지하십시오. 21 일 동안 튜브를 37 ° C와 5 % CO 2 배양기에 넣으십시오. 뚜껑을 단단히 조이고 가스 교환을시키지 마십시오. </li><li> 신선한 chondrogenic 차별화 매체와 3 일마다 문화 매체 3/4을 교체하십시오. 참고 : 배양 후 21 일이 지나면 hiPSC 연쇄 펠릿 (hiPSC-Chon)이 형성되었을 것입니다. 양성 대조군 인 인간 간엽 줄기 세포 (MSCs)도 수집하여 연골 분화 배지에서 21 일간 배양하여 연골 형성 펠렛 (hMSC-Chon)을 형성시킨다. </li></ol> 3. 연골 분화 분석 <ol><li> 10 % 중성 완충 포르말린 10 ML을 준비합니다. </li><li> 0.1 % 알 시안 블루 시약 50 mL와 1 % 톨루이딘 블루 시약 50 mL를 준비한다. </li><li> Pr콜라겐 II (1:50)에 대한 토끼 폴리 클론 항체 또는 콜라겐 X (1:50)에 대한 마우스 단일 클론 항체의 1 차 항체를 발현. 또한, 항 토끼 또는 마우스 보조 항체를 준비하십시오. </li><li> 파파인 솔루션 1 ML : 0.1 M 나트륨 아세테이트, 2.4 MM EDTA 및 5 MM L - 시스테인과 PBS에 10 U / ML하십시오. </li><li> 100 mL의 디메틸 메틸렌 블루 (DMMB) 염료 용액을 만든다. 16 mg / L 1,9- 디메틸 메틸렌 블루, 40 mM 글리신, 40 mM NaCl, 9.5 mM HCl 100 μL; pH 3.0. </li><li> 펠렛 섹션의 alcian blue 및 toluidine blue 얼룩에 의한 연골 분화를 평가하십시오. <ol><li> 24 시간 동안 10 % 중성 완충 포르말린 1 ML에 하나의 hiPSC - 롱 펠렛 또는 hMSC - 롱 펠렛을 수정. </li><li> 펠렛을 H 2 O 중 70 % 에탄올 1 mL에 옮긴다. 펠렛을 등급이 매겨진 에탄올 시리즈 ( 즉, 25, 50, 75, 90, 95, 100 및 100 %, 각 3 분) 1 mL로 탈수시킨다. </li><li> 100 % 자일 렌 1 mL에 넣고 펠릿을 세 번 분쇄한다. 침입자65 ℃ 오븐에서 1 시간 동안 파라핀으로 펠렛을 만든다. 일상적인 조직학 절차 6 다음, 7 X 7 X 5 밀리미터 3 기본 금형과 파라핀 블록에 펠렛을 삽입. </li><li> 약 4 μm 두께의 마이크로톰으로 인접한 섹션을 만듭니다 7 . 유리 슬라이드 위에 섹션을 부착하십시오. </li><li> 슬라이드를 60 ° C에서 2 시간 동안 오븐에서 건조시킵니다. 100 % 크실렌을 사용하여 3 사이클 (각 3 분)으로 섹션을 비 파라핀 화합니다. </li><li> rehydration ( 즉, H 2 O에서 100, 100, 95, 95, 70, 50 및 25 %, 각각 3 분)을 위해 감소하는 알코올 시리즈를 사용하고 5 분 동안 탈 이온수로 최종 헹굼을 수행하십시오. </li><li> 0.1 % alcian blue 시약 또는 1 % toluidine blue 염색으로 4-5 시간 동안 염색 한 후 증류수로 헹구십시오. </li><li> 등급이 매겨진 에탄올 시리즈 ( 즉, 25, 50, 75, 90, 95, 100 및 100 %, 각각 3 분씩)로 3 번 연속해서 탈수하십시오eps of 100 % xylene. 슬라이드를 마운트하고 현미경으로 시각화하십시오. </li></ol></li><li> 면역 조직 화학 검사를 수행하십시오. 참고 : 추가 펠렛 섹션은 면역 조직 화학에 의해 추가로 평가됩니다. <ol><li> 탈 파라핀 및 rehydration 후, 1 밀리미터 EDTA, 산도 8.0 (오토 클레이브로 삶은 물에 방수)에서 종기에 슬라이드를 가져와. 그들이 끓는 온도에서 8 분 동안 앉아서 슬라이드를 RT에서 식히도록하십시오. </li><li> 탈 이온수로 슬라이드를 3 회 헹굽니다. 내인성 퍼 옥시 다제 활성을 차단하기 위해 15 분 동안 3 % H에 RT에서 메탄올 2 O 2 용액 섹션을 인큐베이션. </li><li> 탈 이온수로 슬라이드를 헹구고 DPBS에 5 분 동안 담그십시오. 슬라이드의 섹션에 적절하게 희석 한 (1시 50 분) 기본 항체의 50-100 μL를 적용 후 RT에서 습기 챔버에서 1 시간 품어. </li><li> DPBS로 슬라이드를 3 번 ​​(각각 5 분씩) 씻으십시오. sa를 품어 라.RT에서 15 분 동안 해당 이차 항체 ( 즉, 항 토끼 또는 마우스)와 mple. </li><li> DPBS로 슬라이드를 3 번 ​​(각각 5 분 동안) 씻으십시오. 현미경으로 DAB 탐지를 수행하십시오. </li><li> DPBS로 슬라이드를 3 번 ​​씻으십시오 (각각 2 분씩). 1 ~ 2 분 동안 헤 마톡 실린에 슬라이드를 담그어 세포 핵을 대조합니다. 등급이 매겨진 에탄올 시리즈 (25, 50, 75, 90, 95, 100 및 100 %; 각 3 분)로 탈수 한 다음 자일 렌으로 3 회 연속 해리합니다. 마지막으로, 슬라이드를 마운트하고 현미경으로 시각화하십시오. </li></ol></li><li> sGAG 콘텐츠를 탐지합니다. <ol><li> 60 ° C에서 2 시간 동안 파파인 용액으로 연골 화 펠렛을 분해하십시오. </li><li> dsDNA 분석 키트 및 형광 계 시스템을 사용하여 DNA 함량을 결정합니다. 525 nm에서 흡광도를 측정하여 DMMB 염료 용액과 혼합하여 sGAG 함량을 측정하십시오 8 . </li><li> 표준 곡선에 대한 sGAG의 농도를 계산하십시오.상어 콘드로이틴 황산염. </li></ol></li><li> hiPSC-Chon pellets에서 연골 분화 마커의 실시간 PCR 분석을 수행하십시오. <ol><li> 하나의 튜브에 500 μL의 얼음 차가운 추출 시약을 첨가하여 동일한 연질 펠렛 중 3-4 개를 수확하십시오. 완전히 소용돌이 치고. RT에서 5 분 샘플을 품어. </li><li> 클로로포름 0.1 mL를 넣는다. 샘플을 15 초 동안 볼 텍싱하고 3 분 동안 실온에서 배양합니다. 12,000 xg 및 4 ° C에서 15 분 동안 시료를 원심 분리하십시오. 상부 수성 상 (약 250 μL)을 새로운 1.5 mL 미세 원심 분리 튜브에 옮긴다. </li><li> 샘플에 아세트산 나트륨 25 μL와 글리코겐 1 μL를 첨가하십시오. 250 μL의 이소 프로필 알코올과 혼합하여 RNA를 침전시킵니다. 철저히 섞는다. 샘플을 실온에서 10 분 동안 배양하십시오. </li><li> 12,000 xg 및 4 ° C에서 10 분간 원심 분리하십시오. 뜨는 물을 완전히 제거하십시오. 75 % 에탄올 500 μL로 RNA 펠렛을 두 번 씻으십시오. </li><li> 5 분간 원심 분리기7,500 xg 및 4 ° C. 모든 남은 에탄올을 제거하고 RNA 펠렛을 5-10 분 동안 공기 건조시킵니다. RNA를 10 μL의 nuclease가없는 물에 녹입니다. </li><li> 역전사 효소 시스템을 사용하여 RNA를 cDNA로 전환하십시오. qPCR 키트 마스터 믹스 (2x)와 실시간 PCR 시스템을 사용하여 cDNA 샘플을 실시간 PCR에 적용하십시오. 9 . 참고 : 프라이머 순서는 다음과 같습니다 : h AGGRECAN -F : TCGAGGACAGCGAGGCC; h AGGRECAN -R : TCGAGGGTGTAGCGTGTAGAGA; h β-ACTIN -F : TTTGAATGATGAGCCTTCGTCCCC; h β-ACTIN -R : GGTCTCAAGTCAGTGTACAGGTAAGC; h COL2- F : TGGACGATCAGGCGAAACC; h COL2 -R : GCTGCGGATGCTCTCAATCT; h SOX9- F : AGCGAACGCACATCAAGAC; h SOX9 -R : CTGTAGGCGATCTGTTGGGG; h COL10 -F : ATGCTGCCACAAATACCCTTT; h COL10 -R : GGTAGTGGGCCTTTTATGCCT. </li></ol></li></ol>

<ol><li>Diekman, B. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cartilage+tissue+engineering+using+differentiated+and+purified+induced+pluripotent+stem+cells%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+USA%22%5BJournal%5D)">Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells.</a> Proc Natl Acad Sci USA. 109 (47), 19172-19177 (2012).</li>
<li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Disease-specific+induced+pluripotent+stem+cells%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Disease-specific induced pluripotent stem cells.</a> Cell. 134 (5), 877-886 (2008).</li>
<li>Loh, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generation+of+induced+pluripotent+stem+cells+from+human+blood%5BTitle%5D)+AND+%22Blood%22%5BJournal%5D)">Generation of induced pluripotent stem cells from human blood.</a> Blood. 113 (22), 5476-5479 (2009).</li>
<li>Zhang, X. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cellular+reprogramming+of+human+peripheral+blood+cells%5BTitle%5D)+AND+%22Genomics+Proteomics+Bioinformatics%22%5BJournal%5D)">Cellular reprogramming of human peripheral blood cells.</a> Genomics Proteomics Bioinformatics. 11 (5), 264-274 (2013).</li>
<li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Reprogramming+of+blood+cells+into+induced+pluripotent+stem+cells+as+a+new+cell+source+for+cartilage+repair%5BTitle%5D)+AND+%22Stem+Cell+Res+Ther%22%5BJournal%5D)">Reprogramming of blood cells into induced pluripotent stem cells as a new cell source for cartilage repair.</a> Stem Cell Res Ther. 7 (31), (2016).</li>
<li>Canene-Adams, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Preparation+of+formalin-fixed+paraffin-embedded+tissue+for+immunohistochemistry%5BTitle%5D)+AND+%22Methods+Enzymol%22%5BJournal%5D)">Preparation of formalin-fixed paraffin-embedded tissue for immunohistochemistry.</a> Methods Enzymol. 533, 225-233 (2013).</li>
<li>Solchaga, L. A., Penick, K. J., Welter, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chondrogenic+differentiation+of+bone+marrow-derived+mesenchymal+stem+cells%3A+tips+and+tricks%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Chondrogenic differentiation of bone marrow-derived mesenchymal stem cells: tips and tricks.</a> Methods Mol Biol. 698, 253-278 (2011).</li>
<li>Oldershaw, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Directed+differentiation+of+human+embryonic+stem+cells+toward+chondrocytes%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Directed differentiation of human embryonic stem cells toward chondrocytes.</a> Nat Biotechnol. 28 (11), 1187-1194 (2010).</li>
<li>Monje, L., Varayoud, J., Luque, E. H., Ramos, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neonatal+exposure+to+bisphenol+A+modifies+the+abundance+of+estrogen+receptor+alpha+transcripts+with+alternative+5%27-untranslated+regions+in+the+female+rat+preoptic+area%5BTitle%5D)+AND+%22J+Endocrinol%22%5BJournal%5D)">Neonatal exposure to bisphenol A modifies the abundance of estrogen receptor alpha transcripts with alternative 5'-untranslated regions in the female rat preoptic area.</a> J Endocrinol. 194 (1), 201-212 (2007).</li>
<li>Teramura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Induction+of+mesenchymal+progenitor+cells+with+chondrogenic+property+from+mouse-induced+pluripotent+stem+cells%5BTitle%5D)+AND+%22Cell+Reprogram%22%5BJournal%5D)">Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells.</a> Cell Reprogram. 12 (3), 249-261 (2010).</li>
<li>Su, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+generation+of+integration-free+ips+cells+from+human+adult+peripheral+blood+using+BCL-XL+together+with+Yamanaka+factors%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors.</a> PLoS One. 8 (5), e64496(2013).</li>
<li>Carey, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Reprogramming+factor+stoichiometry+influences+the+epigenetic+state+and+biological+properties+of+induced+pluripotent+stem+cells%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells.</a> Cell Stem Cell. 9 (6), 588-598 (2011).</li>
<li>Okita, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+efficient+nonviral+method+to+generate+integration-free+human-induced+pluripotent+stem+cells+from+cord+blood+and+peripheral+blood+cells%5BTitle%5D)+AND+%22Stem+Cells%22%5BJournal%5D)">An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells.</a> Stem Cells. 31 (3), 458-466 (2013).</li>
<li>Staerk, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Reprogramming+of+human+peripheral+blood+cells+to+induced+pluripotent+stem+cells%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Reprogramming of human peripheral blood cells to induced pluripotent stem cells.</a> Cell Stem Cell. 7 (1), 20-24 (2010).</li>
<li>Qu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chondrogenic+differentiation+of+human+pluripotent+stem+cells+in+chondrocyte+co-culture%5BTitle%5D)+AND+%22Int+J+Biochem+Cell+Biol%22%5BJournal%5D)">Chondrogenic differentiation of human pluripotent stem cells in chondrocyte co-culture.</a> Int J Biochem Cell Biol. 45 (8), 1802-1812 (2013).</li>
<li>Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+differentiation+of+human+iPSC-derived+mesenchymal+stem+cells+to+chondroprogenitor+cells%5BTitle%5D)+AND+%22J+Cell+Biochem%22%5BJournal%5D)">Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells.</a> J Cell Biochem. 114 (2), 480-490 (2013).</li>
<li>Koyama, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+induced+pluripotent+stem+cells+differentiated+into+chondrogenic+lineage+via+generation+of+mesenchymal+progenitor+cells%5BTitle%5D)+AND+%22Stem+Cells+Dev%22%5BJournal%5D)">Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells.</a> Stem Cells Dev. 22 (1), 102-113 (2013).</li>
<li>Liu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Role+of+insulin-transferrin-selenium+in+auricular+chondrocyte+proliferation+and+engineered+cartilage+formation+in+vitro%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">Role of insulin-transferrin-selenium in auricular chondrocyte proliferation and engineered cartilage formation in vitro.</a> Int J Mol Sci. 15 (1), 1525-1537 (2014).</li>
<li>Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Establishment+of+human+cell+type-specific+iPS+cells+with+enhanced+chondrogenic+potential%5BTitle%5D)+AND+%22Stem+Cell+Rev%22%5BJournal%5D)">Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential.</a> Stem Cell Rev. 10 (6), 820-829 (2014).</li>
<li>Goepfert, C., Slobodianski, A., Schilling, A. F., Adamietz, P., Portner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cartilage+engineering+from+mesenchymal+stem+cells%5BTitle%5D)+AND+%22Adv+Biochem+Eng+Biotechnol%22%5BJournal%5D)">Cartilage engineering from mesenchymal stem cells.</a> Adv Biochem Eng Biotechnol. 123, 163-200 (2010).</li>
<li>Ingber, D. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tissue+engineering+and+developmental+biology%3A+going+biomimetic%5BTitle%5D)+AND+%22Tissue+Eng%22%5BJournal%5D)">Tissue engineering and developmental biology: going biomimetic.</a> Tissue Eng. 12 (12), 3265-3283 (2006).</li>
<li>Yoshida, Y., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recent+stem+cell+advances%3A+induced+pluripotent+stem+cells+for+disease+modeling+and+stem+cell-based+regeneration%5BTitle%5D)+AND+%22Circulation%22%5BJournal%5D)">Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration.</a> Circulation. 122 (1), 80-87 (2010).</li>
</ol>

저자는 공개 할 것이 없습니다.

여기, 우리는 iPSCs를 통해 PBCs에서 연골 세포를 생성하는 프로토콜을 제공합니다. PBC는 임상 분야에서 보편적으로 널리 사용되기 때문에 재 프로그래밍을위한 잠재적 대안으로 제시됩니다. 이 연구에서, episomal vectors (EV)는 Zhang et al.에 의해 확립 된 방법에 따라 PBC를 iPSC로 재 프로그램하기 위해 이용되었다 . 11 . 이러한 통합이없는 접근 방식은 임상 필드 <sup class="xr...

An erratum was issued for: <a href="https://www.jove.com/video/55722/differentiating-chondrocytes-from-peripheral-blood-derived-human">Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells</a>.
The corresponding author was updated from:
Yueying Li 
yueyinglee2010@hotmail.com 
Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences
The corresponding author is now listed as:
Tie Liu 
waterkins@163.com 
Department of Orthopedics, Beijing Chao-Yang Hospital, Capital Medical University

An erratum was issued for: <a href="https://www.jove.com/video/55722/differentiating-chondrocytes-from-peripheral-blood-derived-human">Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells</a>.

Erratum: Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

연골 조직은자가 수복 및 재생 능력이 매우 낮습니다. 다양한 외과 적 중재 및 생물학적 치료법이 연골 및 관절 기능을 회복시키는 데 사용되고 있으며 만족스럽지 못한 결과가 있습니다. 최근 줄기 세포 기술의 발달로 전체 연골 치료 분야가 바뀔 수 있습니다 1 . 다양한 줄기 세포가 종자 세포로 연구되었지만 인간 유도 다 능성 줄기 세포 (hiPSCs)는 거부 반응을 일으키지 않으면 서 여러 유형의 환자 특정 세포를 제공 할 수 있기 때문에 가장 유망한 선택 인 것으로 보인다 2 . 또한, 그들은 성체 세포의 제한된 증식 성을 극복하고 자신의 재생 능력과 만능 능력을 유지할 수 있습니다. 또한, 유전자 표적화는 연골 세포의 특정 유형을 얻기 위해 유전자형을 변경하는 데 사용할 수 있습니다. 섬유 아세포는 재 프로그래밍 잠재력이 잘 연구 되었기 때문에 iPSC 생성에 널리 사용되었습니다.그러나 환자의 고통스런 생검 및 섬유 아세포의 시험 관내 팽창에 대한 필요성과 같이 유전자 돌연변이를 야기 할 수있는 몇 가지 한계가 아직 극복되어야합니다 3 . 최근, PBC는 리 프로그래밍 4에 유리한 것으로 나타 났으며; 게다가, 그들은 일반적으로 활용되었고 풍부하게 저장되었다. 연구 초점을 피부에서 방향을 바꿀 수도 있습니다. 그러나 우리가 아는 바로는 PBC 재 프로그램과 연골 세포로의 분화에 관한보고는 거의 없습니다. 현재 연구에서 우리는 연골 세포 형성을 모방하기 위해 pellet 배양 시스템을 통해 iPSCs를 연골 세포 계통으로 분화시킨 다음 iPSCs로 분화시켜 PBCs를 대체 소스로 이용한다.

<table><tbody><tr><td>Knockout DMEM</td><td>Invitrogen</td><td>10829018</td><td>Basal medium used for hiPSC culture and EB formation medium</td></tr><tr><td>Knockout Serum Replacement (KSR)</td><td>Invitrogen</td><td>10828028</td><td>A more defined, FBS-free medium supplement used for hiPSC culture and EB formation medium</td></tr><tr><td>Fetal bovine serum (FBS)</td><td>Hyclone</td><td>sh30070.03</td><td>Used for hiPSC culture and EB formation medium,offers excellent value for cell culture</td></tr><tr><td>Nonessential amino acids</td><td>Chemicon</td><td>TMS-001-C</td><td>Used as a growth supplement in all the cell culture medium, to increase cell growth and viability</td></tr><tr><td>L-glutamine</td><td>Invitrogen</td><td>TMS-002-C</td><td>An amino acid required for cell culture</td></tr><tr><td>Basic fibroblast growth factor (bFGF)</td><td>Peprotech</td><td>100-18B</td><td>A cytokine used for sustaining the pluripotency and self-renewal of hiPSCs</td></tr><tr><td>Dispase</td><td>Invitrogen</td><td>17105041</td><td>Used for hiPSC dissociation for subculture</td></tr><tr><td>DMEM</td><td>Gibco</td><td>C11960</td><td>Basal medium used for MSC culture medium</td></tr><tr><td>0.1% gelatin</td><td>Millipore</td><td>ES-006-B</td><td>Used for cell attachment onto the dishes</td></tr><tr><td>0.25% trypsin/EDTA</td><td>Gibco</td><td>25200072</td><td>Used for cell dissociation</td></tr><tr><td>DPBS</td><td>Gibco</td><td>14190250</td><td>A balanced salt solution used for cell wash or reagent preparing</td></tr><tr><td>2-mercaptoethanol</td><td>invitrogen</td><td>21985023</td><td>Used as a growth supplement in all the cell culture medium.</td></tr><tr><td>ITS</td><td>invitrogen</td><td>41400045</td><td>Insulin, Transferrin, Selenium Solution.Used for chondrogenic differentiation.</td></tr><tr><td>Ascorbic acid</td><td>Sigma</td><td>4403</td><td>Known as vitamin C. It helps in active growth and has antioxidant property.</td></tr><tr><td>Sodium pyruvate</td><td>Gibco</td><td>11360070</td><td>Added to cell culture medium as an energy source in addition to glucose.</td></tr><tr><td>Transforming growth factor-beta 1</td><td>Peprotech</td><td>AF-100-21C</td><td>A cytokine that regulate cell proliferation, growth and chondrogenic differentiation.</td></tr><tr><td>Rabbit polyclonal antibodies against Collagen II</td><td>Abcam</td><td>ab34712</td><td>This antibody reacts with Type II collagens,which is specific for cartilaginous tissues.</td></tr><tr><td>Mouse monoclonal antibodies to Collagen X</td><td>Abcam</td><td>ab49945</td><td>This antibody reacts with Type X collagen,which is a product of hyperthrophic chondrotocytes.</td></tr><tr><td>Permount</td><td>Fisher Scientific</td><td>SP15-100</td><td>For mounting and long-term storage of slides</td></tr><tr><td>Toluidine blue</td><td>Sigma</td><td>89640</td><td>Used for proteoglycans detection.</td></tr><tr><td>Alcian blue</td><td>Amresco</td><td>#0298</td><td>Used for glucosaminoglycans detection.</td></tr><tr><td>Papain</td><td>Sigma</td><td>P4762-25MG</td><td>Used to digest chondrogenic pellets.</td></tr><tr><td>Dimethylmethylene blue</td><td>Sigma</td><td>341088-1G</td><td>Used to quantitate glycosaminoglyans</td></tr><tr><td>Chondroitin sulfate sodium salt from shark cartilage</td><td>Sigma</td><td>C4384-250MG</td><td>Used to draw the standard curve for sGAG content measurement.</td></tr><tr><td>Qubit dsDNA HS assay kit</td><td>Invitrogen</td><td>Q32851 (100)</td><td>Used to determine DNA content</td></tr><tr><td>TRIzol</td><td>Invitrogen</td><td>15596018</td><td>Used for RNA isolation from cells</td></tr><tr><td>Reverse Transcriptase System</td><td>Promega</td><td>A3500</td><td>Used to convert RNA into cDNA</td></tr><tr><td>SYBR FAST qPCR kit Master Mix</td><td>Kapa</td><td>KK4601</td><td>Used for Real-time PCR</td></tr></tbody></table>

differentiating chondrocytes from peripheral blood-derived human induced pluripotent stem cells

이 연구에서, 우리는 말초 혈액 세포 (PBCs)를 통합 된 방법으로 유도 된 다 능성 줄기 세포 (iPSCs)를 통해 연골 세포를 생산하는 종자 세포로 사용했다. 배아 체 형성 (EB) 형성 및 섬유 아세포 세포 확장 후, iPSCs는 무 혈청 및 이종없는 조건 하에서 21 일 동안 연골 분화 유도된다. 연골 세포 유도 후 형태 학적, 면역 조직 화학적 분석 및 생화학 적 분석뿐만 아니라 연골 분화 마커의 정량적 실시간 PCR 검사를 통해 세포의 표현형을 평가한다. 연골 형성 펠릿은 알 시스 파랑 및 톨루이딘 블루 염색 양성 반응을 보였다. 콜라겐 II와 X 염색의 면역 조직 화학도 양성이다. 황화 글리코 사 미노 글 라이칸 (sGAG) 함량과 연골 분화 마커 인 콜라겐 2 ( COL2 ), 콜라겐 10 ( COL10 ), SOX9 및 아그로 칸 (AGGRECAN)hiPSCs 및 섬유 아세포와 비교하여 rogenic pellets. 이러한 결과는 PBC가 연골 수복을위한 iPSC를 생성하기위한 종자 세포로 사용될 수 있음을 시사한다.

hiPSCs의 연골 형성 분화 : EB 형성 배지 및 기초 배양 배지를 사용하여 hiPSC를 중간 엽 계통으로 분화시켰다. 다중 단계 배양 방법이 사용되었습니다 ( 그림 1 ). 첫째, hiPSCs는 10 일 동안 EB 형성을 통해 자발적으로 분화되었다 (D10, 도 2A ). 둘째, EBs에서 10 일 (D10 + 10) 동안 더 많은 세포가 ?...

Watch this Scientific Journal Video about Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells at JoVE.com

Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

우리는 배아 체 형성 (EB) 형성, 섬유 아세포 세포 확장 및 연골 형성 유도를 포함하는 통합없는 방법을 사용하여 유도 된 다 능성 줄기 세포 (iPSCs)를 통해 인간 말초 혈액 (PB)으로부터 연골 세포 계통을 생성하는 프로토콜을 제시한다.

말초 혈액 유래 인간 유래 다 능성 줄기 세포에서 연골 세포 분화

In this study, we used peripheral blood cells (PBCs) as seed cells to produce chondrocytes via induced pluripotent stem cells (iPSCs) in an ...

differentiating-chondrocytes-from-peripheral-blood-derived-human

Research

JoVE Journal

Developmental Biology

9.1K 조회수.  Capital Medical University.  우리는 배아 체 형성 (EB) 형성, 섬유 아세포 세포 확장 및 연골 형성 유도를 포함하는 통합없는 방법을 사용하여 유도 된 다 능성 줄기 세포 (iPSCs)를 통해 인간 말초 혈액 (PB)으로부터 연골 세포 계통을 생성하는 프로토콜을 제시한다. 

비디오: Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

Chondrogenic Differentiation Induction of Adipose-derived Stem Cells by Centrifugal Gravity

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes differentiated from stem cells using cytokines. Unfortunately, cytokine-induced chondrogenic differentiation is costly, time-consuming, and associated with a high risk of contamination during in vitro differentiation. However, biomechanical stimuli also serve as crucial regulatory factors for chondrogenesis. For example, mechanical stress can induce chondrogenic differentiation of stem cells, suggesting a potential therapeutic approach for the repair of impaired cartilage. In this study, we demonstrated that centrifugal gravity (CG, 2,400 &#215; g), a mechanical stress easily applied by centrifugation, induced the upregulation of sex determining region Y (SRY)-box 9 (SOX9) in adipose-derived stem cells (ASCs), causing them to express chondrogenic phenotypes. The centrifuged ASCs expressed higher levels of chondrogenic differentiation markers, such as aggrecan (ACAN), collagen type 2 alpha 1 (COL2A1), and collagen type 1 (COL1), but lower levels of collagen type 10 (COL10), a marker of hypertrophic chondrocytes. In addition, chondrogenic aggregate formation, a prerequisite for chondrogenesis, was observed in centrifuged ASCs.

Mechanical stress can induce the chondrogenic differentiation of stem cells, providing a potential therapeutic approach for the repair of impaired cartilage. We present a protocol to induce the chondrogenic differentiation of adipose-derived stem cells (ASCs) using centrifugal gravity (CG). CG-induced upregulation of SOX9 results in the development of chondrogenic phenotypes.

원심 중력에 의해 지방이 유래 줄기 세포의 연골 분화 유도

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes ...

연구

발생학

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem cells (hPSCs). Until recently, efforts to differentiate hPSCs into HSCs have predominantly generated hematopoietic progenitors that lack HSC potential, and instead resemble yolk sac hematopoiesis.&#160;These resulting hematopoietic progenitors may have limited utility for in vitro disease modeling of various adult hematopoietic disorders, particularly those of the lymphoid lineages. However, we have recently described methods to generate erythro-myelo-lymphoid multilineage definitive hematopoietic progenitors from hPSCs using a stage-specific directed differentiation protocol, which we outline here. Through enzymatic dissociation of hPSCs on basement membrane matrix-coated plasticware, embryoid bodies (EBs) are formed. EBs are differentiated to mesoderm by recombinant BMP4, which is subsequently specified to the definitive hematopoietic program by the GSK3&#946; inhibitor, CHIR99021. Alternatively, primitive hematopoiesis is specified by the PORCN inhibitor, IWP2. Hematopoiesis is further driven through the addition of recombinant VEGF and supportive hematopoietic cytokines. The resulting hematopoietic progenitors generated using this method have the potential to be used for disease and developmental modeling, in vitro.

Here, we present human pluripotent stem cell (hPSC) culture protocols, used to differentiate hPSCs into CD34+ hematopoietic progenitors. This method uses stage-specific manipulation of canonical WNT signaling to specify cells exclusively to either the definitive or primitive hematopoietic program.

기본 및 확실 한 조 혈 창시자 인간 만능 줄기 세포에서의 감독

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells

Human articular cartilage lacks the ability to repair itself. Cartilage degeneration is thus treated not by curative but by conservative treatments. Currently, efforts are being made to regenerate damaged cartilage with ex vivo expanded chondrocytes or bone marrow-derived mesenchymal stem cells (BMSCs). However, the restricted viability and instability of these cells limit their application in cartilage reconstruction. Human induced pluripotent stem cells (hiPSCs) have received scientific attention as a new alternative for regenerative applications. With unlimited self-renewal ability and multipotency, hiPSCs have been highlighted as a new replacement cell source for cartilage repair. However, obtaining a high quantity of high-quality chondrogenic pellets is a major challenge to their clinical application. In this study, we used embryoid body (EB)-derived outgrowth cells for chondrogenic differentiation. Successful chondrogenesis was confirmed by PCR and staining with alcian blue, toluidine blue, and antibodies against collagen types I and II (COL1A1 and COL2A1, respectively). We provide a detailed method for the differentiation of cord blood mononuclear cell-derived iPSCs (CBMC-hiPSCs) into chondrogenic pellets.

Here, we propose a protocol for chondrogenic differentiation from cord blood mononuclear cell-derived human induced pluripotent stem cells.

제대혈 유래 다 능성 줄기 세포로부터 연골 형성 펠렛 형성

Human articular cartilage lacks the ability to repair itself. Cartilage degeneration is thus treated not by curative but by conservative treatments. ...

Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily functions. Biomimetics is the imitation of the models, systems, and elements of nature for the purpose of solving complex human problems1. Skin biomimetics is a useful tool for in vitro disease research and in vivo regenerative medicine. Human induced pluripotent stem cells (iPSCs) have the characteristic of unlimited proliferation and the ability of differentiation to three germ layers. Human iPSCs are generated from various primary cells, such as blood cells, keratinocytes, fibroblasts, and more. Among them, cord blood mononuclear cells (CBMCs) have emerged as an alternative cell source from the perspective of allogeneic regenerative medicine. CBMCs are useful in regenerative medicine because human leukocyte antigen (HLA) typing is essential to the cell banking system. We provide a method for the differentiation of CBMC-iPSCs into keratinocytes and fibroblasts and for generation of a 3D skin organoid. CBMC-iPSC-derived keratinocytes and fibroblasts have characteristics similar to a primary cell line. The 3D skin organoids are generated by overlaying an epidermal layer onto a dermal layer. By transplanting this 3D skin organoid, a humanized mice model is generated. This study shows that a 3D human iPSC-derived skin organoid may be a novel, alternative tool for dermatologic research in vitro and in vivo.

We propose a protocol that shows how to differentiate induced pluripotent stem cell-derived keratinocytes and fibroblasts and generate a 3D skin organoid, using these keratinocytes and fibroblasts. This protocol contains an additional step of generating a humanized mice model. The technique presented here will improve dermatologic research.

코드 혈액 파생에서 3D 피부 Organoid의 생성 유도 만능 줄기 세포

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily ...

Directed Differentiation of Hemogenic Endothelial Cells from Human Pluripotent Stem Cells

Blood vessels are ubiquitously distributed within all tissues of the body and perform diverse functions. Thus, derivation of mature vascular endothelial cells, which line blood vessel lumens, from human pluripotent stem cells is crucial for a multitude of tissue engineering and regeneration applications. In vivo, primordial endothelial cells are derived from the mesodermal lineage and are specified toward specific subtypes, including arterial, venous, capillary, hemogenic, and lymphatic. Hemogenic endothelial cells are of particular interest because, during development, they give rise to hematopoietic stem and progenitor cells, which then generate all blood lineages throughout life. Thus, creating a system to generate hemogenic endothelial cells in vitro would provide an opportunity to study endothelial-to-hematopoietic transition, and may lead to ex vivo production of human blood products and reduced reliance on human donors. While several protocols exist for the derivation of progenitor and primordial endothelial cells, generation of well-characterized hemogenic endothelial cells from human stem cells has not been described. Here, a method for the derivation of hemogenic endothelial cells from human embryonic stem cells in approximately 1 week is presented: a differentiation protocol with primitive streak cells formed in response to GSK3&#946; inhibitor (CHIR99021), then mesoderm lineage induction mediated by bFGF, followed by primordial endothelial cell development promoted by BMP4 and VEGF-A, and finally hemogenic endothelial cell specification induced by retinoic acid. This protocol yields a well-defined population of hemogenic endothelial cells that can be used to further understand their molecular regulation and endothelial-to-hematopoietic transition, which has the potential to be applied to downstream therapeutic applications.

Presented here is a simple protocol for the directed differentiation of hemogenic endothelial cells from human pluripotent stem cells in approximately 1 week.

인간 만능 줄기 세포로부터 혈구 내피 세포의 유도 분화

Blood vessels are ubiquitously distributed within all tissues of the body and perform diverse functions. Thus, derivation of mature vascular endothelial ...

Differentiation and Characterization of Osteoclasts from Human Induced Pluripotent Stem Cells

This protocol details the propagation and passaging of human iPSCs and their differentiation into osteoclasts. First, iPSCs are dissociated into a single-cell suspension for further use in embryoid body induction. Following mesodermal induction, embryoid bodies undergo hematopoietic differentiation, producing a floating hematopoietic cell population. Subsequently, the harvested hematopoietic cells undergo a macrophage colony-stimulating factor maturation step and, finally, osteoclast differentiation. After osteoclast differentiation, osteoclasts are characterized by staining for TRAP in conjunction with a methyl green nuclear stain. Osteoclasts are observed as multinucleated, TRAP+ polykaryons. Their identification can be further supported by Cathepsin K staining. Bone and mineral resorption assays allow for functional characterization, confirming the identity of bona fide osteoclasts. This protocol demonstrates a robust and versatile method to differentiate human osteoclasts from iPSCs and allows for easy adoption in applications requiring large quantities of functional human osteoclasts. Applications in the areas of bone research, cancer research, tissue engineering, and endoprosthesis research could be envisioned.

This protocol presents the differentiation of human osteoclasts from induced pluripotent stem cells (iPSCs) and describes methods for the characterization of osteoclasts and osteoclast precursors.

인간 유도 만능 줄기 세포에서 파골세포의 분화 및 특성화

This protocol details the propagation and passaging of human iPSCs and their differentiation into osteoclasts. First, iPSCs are dissociated into a ...

High Efficiency Differentiation of Human Pluripotent Stem Cells to Cardiomyocytes and Characterization by Flow Cytometry

There is an urgent need to develop approaches for repairing the damaged heart, discovering new therapeutic drugs that do not have toxic effects on the heart, and improving strategies to accurately model heart disease. The potential of exploiting human induced pluripotent stem cell (hiPSC) technology to generate cardiac muscle &#8220;in a dish&#8221; for these applications continues to generate high enthusiasm. In recent years, the ability to efficiently generate cardiomyogenic cells from human pluripotent stem cells (hPSCs) has greatly improved, offering us new opportunities to model very early stages of human cardiac development not otherwise accessible. In contrast to many previous methods, the cardiomyocyte differentiation protocol described here does not require cell aggregation or the addition of Activin A or BMP4 and robustly generates cultures of cells that are highly positive for cardiac troponin I and T (TNNI3, TNNT2), iroquois-class homeodomain protein IRX-4 (IRX4), myosin regulatory light chain 2, ventricular/cardiac muscle isoform (MLC2v) and myosin regulatory light chain 2, atrial isoform (MLC2a) by day 10 across all human embryonic stem cell (hESC) and hiPSC lines tested to date. Cells can be passaged and maintained for more than 90 days in culture. The strategy is technically simple to implement and cost-effective. Characterization of cardiomyocytes derived from pluripotent cells often includes the analysis of reference markers, both at the mRNA and protein level. For protein analysis, flow cytometry is a powerful analytical tool for assessing quality of cells in culture and determining subpopulation homogeneity. However, technical variation in sample preparation can significantly affect quality of flow cytometry data. Thus, standardization of staining protocols should facilitate comparisons among various differentiation strategies. Accordingly, optimized staining protocols for the analysis of IRX4, MLC2v, MLC2a, TNNI3, and TNNT2 by flow cytometry are described.

The article describes the detailed methodology to efficiently differentiate human pluripotent stem cells into cardiomyocytes by selectively modulating the Wnt pathway, followed by flow cytometry analysis of reference markers to assess homogeneity and identity of the population.

유동 세포 계측법에 의한 고효율 심근에 인간 다 능성 줄기 세포의 분화 및 특성

There is an urgent need to develop approaches for repairing the damaged heart, discovering new therapeutic drugs that do not have toxic effects on the ...

생물학

Generating Spheroids from Various Chondrocytes using Low-Adhesive Conditions under Gravity and Homemade Mini-Bioreactors

Cartilage repair in chronic joint diseases demands advanced cell-based therapies to regenerate damaged tissues effectively. This protocol provides a step-by-step method for differentiating induced pluripotent stem cells (iPSCs) into chondrocyte-based spheroids, supporting tissue engineering and cell therapy applications. The differentiation process is carefully structured to promote chondrogenic lineage commitment, beginning with iPSCs cultured in specific media that sequentially guide cells through critical stages of differentiation. Initially, iPSCs are expanded to reach optimal confluency before induction toward chondrogenic lineage using a series of defined media changes. By day 10, cells are transitioned to a chondrogenesis-promoting medium that enhances the formation of chondrocyte-like cells expressing key markers of mature chondrocytes. Further aggregation in 96-well agarose-coated plates leads to the formation of three-dimensional spheroids, which are then cultured in custom mini-bioreactors designed to simulate a microenvironment that encourages extracellular matrix (ECM) deposition. By enabling scalable production of chondrocyte spheroids that mimic native cartilage characteristics, this approach offers a promising, reproducible solution for developing cell-based treatments for cartilage defects, providing broad utility for clinical and research applications in musculoskeletal regenerative medicine.

This study describes a method for producing chondrocytic spheroids by aggregating cells into spheroids under low-adhesion conditions using gravity, followed by culturing the resulting spheroids in mini-bioreactors.

Cartilage repair in chronic joint diseases demands advanced cell-based therapies to regenerate damaged tissues effectively. This protocol provides a ...

생체공학

hiPSC-Driving MSC의 표면 항원 및 증식 능력 특성화

Comparison of Two Representative Methods for Differentiation of Human Induced Pluripotent Stem Cells into Mesenchymal Stromal Cells

Mesenchymal stromal cells (MSCs) are adult pluripotent stem cells which have been widely used in regenerative medicine. As somatic tissue-derived MSCs are restricted by limited donation, quality variations, and biosafety, the past 10 years have seen a great rise in efforts to generate MSCs from human induced pluripotent stem cells (hiPSCs). Past and recent efforts in the differentiation of hiPSCs into MSCs have been centered around two culture methodologies: (1) the formation of embryoid bodies (EBs) and (2) the use of monolayer culture. This protocol describes these two representative methods in deriving MSC from hiPSCs. Each method presents its advantages and disadvantages, including time, cost, cell proliferation ability, the expression of MSC markers, and their capability of differentiation in vitro. This protocol demonstrates that both methods can derive mature and functional MSCs from hiPSCs. The monolayer method is characterized by lower cost, simpler operation, and easier osteogenic differentiation, while the EB method is characterized by lower time consumption.

저자 스포트라이트: iPSC 및 유전 질환 연구의 발전 

This protocol describes and compares two representative methods for differentiating hiPSCs into mesenchymal stromal cells (MSCs). The monolayer method is characterized by lower cost, simpler operation, and easier osteogenic differentiation. The embryoid bodies (EBs) method is characterized by lower time consumption.

인간 유도만능줄기세포(Human Induced Pluripotent Stem Cells)를 중간엽 기질세포(Mesenchymal Stromal Cell)로 분화하기 위한 두 가지 대표적인 방법의 비교

Mesenchymal stromal cells (MSCs) are adult pluripotent stem cells which have been widely used in regenerative medicine. As somatic tissue-derived MSCs are ...

말초 혈액 유래 인간 유래 다 능성 줄기 세포에서 연골 세포 분화

요약

더 많은 비디오 탐색

원심 중력에 의해 지방이 유래 줄기 세포의 연골 분화 유도

기본 및 확실 한 조 혈 창시자 인간 만능 줄기 세포에서의 감독

제대혈 유래 다 능성 줄기 세포로부터 연골 형성 펠렛 형성

코드 혈액 파생에서 3D 피부 Organoid의 생성 유도 만능 줄기 세포

인간 만능 줄기 세포로부터 혈구 내피 세포의 유도 분화

인간 유도 만능 줄기 세포에서 파골세포의 분화 및 특성화

유동 세포 계측법에 의한 고효율 심근에 인간 다 능성 줄기 세포의 분화 및 특성

Generating Spheroids from Various Chondrocytes using Low-Adhesive Conditions under Gravity and Homemade Mini-Bioreactors

인간 유도만능줄기세포(Human Induced Pluripotent Stem Cells)를 중간엽 기질세포(Mesenchymal Stromal Cell)로 분화하기 위한 두 가지 대표적인 방법의 비교

인간 유도만능줄기세포(Human Induced Pluripotent Stem Cells)를 중간엽 기질세포(Mesenchymal Stromal Cell)로 분화하기 위한 두 가지 대표적인 방법의 비교