JQW, XD, RCDD, 그리고 YY는 국립 연구소의 건강 R01 NS088353;에서 교부 금에 의해 지원 되었다 NIH 그랜트 1R21AR071583-01; Staman Ogilvie 기금-기념 헤르만 재단; UTHealth 뇌 이니셔티브와 CTSA UL1 TR000371; 그리고 텍사스 시스템 신경 과학 대학 Neurotechnology 연구소 (부여 #362469)에서 부여.

<ol>
	<li>Wu, J. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tcf7+is+an+important+regulator+of+the+switch+of+self-renewal+and+differentiation+in+a+multipotential+hematopoietic+cell+line.">Tcf7 is an important regulator of the switch of self-renewal and differentiation in a multipotential hematopoietic cell line.</a> PLoS Genet. 8 (3), e1002565 (2012).</li><li>Zuchero, J. B., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+and+extrinsic+control+of+oligodendrocyte+development.">Intrinsic and extrinsic control of oligodendrocyte development.</a> Curr Opin Neurobiol. 23 (6), 914-920 (2013).</li><li>Liu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+oligodendrocyte+differentiation+by+Olig2+and+Sox10:+evidence+for+reciprocal+interactions+and+dosage-dependent+mechanisms.">Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms.</a> Dev Biol. 302 (2), 683-693 (2007).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+Identification+of+Long+Non-coding+RNAs+in+Purified+Cell+Types+from+the+Brain+Reveals+Functional+LncRNA+in+OPC+Fate+Determination.">Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination.</a> PLoS Genet. 11 (12), e1005669 (2015).</li><li>Hilgenberg, L. G., Smith, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+dissociated+mouse+cortical+neuron+cultures.">Preparation of dissociated mouse cortical neuron cultures.</a> J Vis Exp. (10), e562 (2007).</li><li>Emery, B., Dugas, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+oligodendrocyte+lineage+cells+from+mouse+cortices+by+immunopanning.">Purification of oligodendrocyte lineage cells from mouse cortices by immunopanning.</a> Cold Spring Harb Protoc. 2013 (9), 854-868 (2013).</li><li>Cahoy, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptome+database+for+astrocytes,+neurons,+and+oligodendrocytes:+a+new+resource+for+understanding+brain+development+and+function.">A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function.</a> J Neurosci. 28 (1), 264-278 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> J Neurosci. 34 (36), 11929-11947 (2014).</li><li>Cheng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+protein+signaling+and+olig1/2+interact+to+regulate+the+differentiation+and+maturation+of+adult+oligodendrocyte+precursor+cells.">Bone morphogenetic protein signaling and olig1/2 interact to regulate the differentiation and maturation of adult oligodendrocyte precursor cells.</a> Stem Cells. 25 (12), 3204-3214 (2007).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+a+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: a flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Team, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+language+and+environment+for+statistical+computing.">A language and environment for statistical computing.</a> R Foundation for Statistical Computing. , (2015).</li><li>Kharchenko, P. V., Tolstorukov, M. Y., Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+analysis+of+ChIP-seq+experiments+for+DNA-binding+proteins.">Design and analysis of ChIP-seq experiments for DNA-binding proteins.</a> Nat Biotechnol. 26 (12), 1351-1359 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucleic Acids Res. 37 (Web Server issue), W202-W208 (2009).</li><li>Sims, D., Sudbery, I., Ilott, N. E., Heger, A., Ponting, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+depth+and+coverage:+key+considerations+in+genomic+analyses.">Sequencing depth and coverage: key considerations in genomic analyses.</a> Nat Rev Genet. 15 (2), 121-132 (2014).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Consortium, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Kheradpour, P., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+discovery+and+characterization+of+regulatory+motifs+in+ENCODE+TF+binding+experiments.">Systematic discovery and characterization of regulatory motifs in ENCODE TF binding experiments.</a> Nucleic Acids Res. 42 (5), 2976-2987 (2014).</li><li>Dugas, J. C., Tai, Y. C., Speed, T. P., Ngai, J., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+analysis+of+oligodendrocyte+differentiation.">Functional genomic analysis of oligodendrocyte differentiation.</a> J Neurosci. 26 (43), 10967-10983 (2006).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Raskatov, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+NF-kappaB-dependent+gene+transcription+using+programmable+DNA+minor+groove+binders.">Modulation of NF-kappaB-dependent gene transcription using programmable DNA minor groove binders.</a> Proc Natl Acad Sci U S A. 109 (4), 1023-1028 (2012).</li><li>Cheneby, J., Gheorghe, M., Artufel, M., Mathelier, A., Ballester, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ReMap+2018:+an+updated+atlas+of+regulatory+regions+from+an+integrative+analysis+of+DNA-binding+ChIP-seq+experiments.">ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments.</a> Nucleic Acids Res. , (2017).</li><li>Yevshin, I., Sharipov, R., Valeev, T., Kel, A., Kolpakov, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTRD:+a+database+of+transcription+factor+binding+sites+identified+by+ChIP-seq+experiments.">GTRD: a database of transcription factor binding sites identified by ChIP-seq experiments.</a> Nucleic Acids Res. 45 (D1), D61-D67 (2017).</li><li>Kulakovskiy, I. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HOCOMOCO:+a+comprehensive+collection+of+human+transcription+factor+binding+sites+models.">HOCOMOCO: a comprehensive collection of human transcription factor binding sites models.</a> Nucleic Acids Res. 41 (Database issue), D195-D202 (2013).</li><li>Jain, D., Baldi, S., Zabel, A., Straub, T., Becker, P. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+promoters+give+rise+to+false+positive+'Phantom+Peaks'+in+ChIP-seq+experiments.">Active promoters give rise to false positive 'Phantom Peaks' in ChIP-seq experiments.</a> Nucleic Acids Res. 43 (14), 6959-6968 (2015).</li><li>Gerstein, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+human+regulatory+network+derived+from+ENCODE+data.">Architecture of the human regulatory network derived from ENCODE data.</a> Nature. 489 (7414), 91-100 (2012).</li></ol>

저자 들은 아무 경쟁 금융 관심사 선언 합니다.

포유류 유전자 조절 네트워크는 매우 복잡 합니다. 칩 seq 게놈 넓은 단백질 DNA 상호 작용을 조사 하는 강력한 방법입니다. 이 프로토콜 Olig2 칩 seq (반응 당 20 천 셀 낮은) 마우스 두뇌에서 순화 OPCs의 낮은 수를 사용 하 여 수행 하는 방법을 포함 합니다. 이 프로토콜에 대 한 첫 번째 주요 단계에서 PDGFRα 항 체와 immunopanning에 의해 마우스 두뇌 OPCs의 정화 이다. PDGFRα 코팅 접시 OPCs의 긍정적인 선택 O...

단백질 (또는 복잡 한 단백질)을 공부 하는 것이 중요 하다 DNA 바인딩 및 후 성적인 부호 다양 한 생물학 과정에서 포함 된 transcriptional 규제 네트워크 구축. 특히, 게놈 dna 녹음 방송 요인의 바인딩 유전자 규칙, 세포 분화와 조직 개발에 중요 한 역할을 재생할 수 있습니다. 공부는 transcriptional 규칙 및 epigenetic 메커니즘에 대 한 강력한 도구 chromatin immunoprecipitation (칩)입니다. 차세대 시퀀싱 기술에 있는 급속 한 전진 때문 칩 (칩 seq) 연속 높 처리량 DNA와 결합 하 여 단백질-DNA 바인딩 및 epigenetic 마크1의 분석에 사용 됩니다. 그러나, 표준 칩 seq 프로토콜 셀 수는 고립 된 1 차 셀 등 희귀 세포 인구 제한 때이 기술의 응용 프로그램 어려운 반응 당 약 20 백만 셀을 필요 합니다.
Oligodendrocyte 계보 세포 oligodendrocyte 선구자 세포 (OPCs)와 oligodendrocytes를 포함 하 여 두뇌를 통해 널리 배포 하 고 개발 및 뇌의 기능에 필수적인. 선구자 세포의 유형으로 OPCs 자체 갱신와 차별화 할 수 있다. OPCs는 창시자 oligodendrocytes에 대 한 역할 뿐만 아니라 또한 뇌 세포2의 다른 종류와 통신 함으로써 신경 신호의 전파에 중요 한 역할. 이전 연구는 oligodendrocyte 개발 Olig2와 Sox103,4같은 계보 특정 녹음 방송 요인에 의해 통제 된다 제안 했다. 이 녹음 방송 요인 oligodendrocyte 사양과 차별화 하는 동안 그들의 표정에 영향을 몇 가지 중요 한 유전자의 발기인 또는 증강 인자 영역에 바인딩할 발견 됐다. 그러나, DNA 바인딩 단백질 (또는 복잡 한 단백질) 심하게 정화 기본 OPCs 셀의 매우 제한 된 수의 식별 하는 도전입니다.
이 프로토콜 Olig2 순화 마우스 OPCs 칩 seq 기술을 사용 하 여 게놈 넓은 규모에 의해 게놈 DNA immunoprecipitated를 체계적으로 조사 하는 방법을 설명 합니다. 마우스 두뇌에서 OPCs 심하게 immunopanning에 의해 정화 되었고 확산 체 외없이 칩 실험에 사용. 제한 된 수의 OPCs immunopanning에 의해 얻어질 수 있다 그리고 표준 칩 seq 실험에 대 한 충분 하지 않습니다. 여기, 낮은 셀 칩 seq 프로토콜은 낮은 녹음 방송 요인에 대 한 칩 반응 당 20 천 셀으로 설명 되어 있습니다. 간단히, 교차 연결 된 셀 lysed 되었고 sonicated 쥡니다 장치는 chromatin를 전단 하 여. 깎인된 chromatin Olig2 바인딩된 항 체 게놈 DNA를 침전 하는 코팅 구슬 Olig2 항 체와 단백질 incubated 했다. 단백질 A 코팅 구슬 및 역방향 cross-linking에서 차입, 후 genomic DNA Olig2 항 체에 의해 시 켰 던 페 놀-클로 프롬 적 출에 의해 순화 되었다. 결과 제품 계량은 T-미행을 복종, 뇌관 어 닐 링 템플릿 전환 및 확장, 어댑터 및 증폭, 라이브러리 크기 선택 및 정화의 추가 칩 seq 도서관 건축을 위한 단계.
시퀀싱, 후 샘플 Olig2 전사 인자 항 체와 준비와 컨트롤 샘플에서 원시 읽기의 품질 분석 했다. 낮은 품질의 기본적인 쌍 어댑터 포함 된 읽기 조각 손질 했다. 다음, 트림 읽기 마우스 참조 게놈에 정렬 했다. 컨트롤 샘플에 비해 칩 읽기 봉우리로 검색을 위한 농축 크게 했다 게놈 영역입니다. 중요 한 봉우리, 대표 하는 잠재적인 전사 인자 바인딩 사이트 필터링 되었고 게놈 브라우저에 시각.
특히,이 프로토콜에서 설명 하는 방법은 모든 셀 종류 제한 된 숫자의 다른 녹음 방송 요인의 칩 seq에 광범위 하 게 사용할 수 있습니다.

<table><tbody><tr><td>&lt;strong&gt;Reagent/ Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Banderiaea simplicifolia lectin 1</td><td>Vector Laboratories</td><td># L-1100</td><td></td></tr><tr><td>Rat anti-PDGFRa antibody</td><td>BD Bioscience</td><td># 558774</td><td></td></tr><tr><td>Neural tissue dissociation Kit (P)</td><td>MACS Miltenyi Biotec</td><td># 130-092-628</td><td></td></tr><tr><td>Accutase</td><td>STEMCELL technologies</td><td># 07920</td><td></td></tr><tr><td>TRIzol</td><td>Thermo Fisher</td><td># 15596026</td><td></td></tr><tr><td>Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody</td><td>Millipore</td><td># AB5320</td><td></td></tr><tr><td>Bioruptor Pico sonication device</td><td>Diagenode</td><td># B01060001</td><td></td></tr><tr><td>True MicroChIP kit</td><td>Diagenode</td><td># C01010130</td><td></td></tr><tr><td>Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v)</td><td>Thermo Fisher</td><td># 15593031</td><td></td></tr><tr><td>NucleoSpin Gel and PCR Clean-Up kit</td><td>MACHEREY-NAGEL</td><td># 740609</td><td></td></tr><tr><td>Quant-iT PicoGreen dsDNA Assay Kit</td><td>Thermo Fisher</td><td># P11496</td><td></td></tr><tr><td>DNA SMART ChIP-Seq kit</td><td>Clontech Laboratories</td><td># 634865</td><td></td></tr><tr><td>Agencourt AMPure XP</td><td>Beckman Voulter</td><td># A63880</td><td></td></tr><tr><td>GlycoBlue</td><td>Thermo Fisher</td><td># AM9516</td><td></td></tr><tr><td>pico-green</td><td>Thermo Fisher</td><td># P11496</td><td></td></tr><tr><td>D-PBS</td><td>Thermo Fisher</td><td># 14190-144</td><td></td></tr><tr><td>SYBR Green master mix</td><td>Bio-Rad Laboratories</td><td># 1725124</td><td></td></tr><tr><td>DMEM/F12</td><td>Fisher Scientific</td><td># 11-320-033</td><td></td></tr><tr><td>Penicillin-Streptomycin (P/S)</td><td>Fisher Scientific</td><td># 15140122</td><td></td></tr><tr><td>N-2 Supplement</td><td>Fisher Scientific</td><td># 17502048</td><td></td></tr><tr><td>B-27 Supplement</td><td>Fisher Scientific</td><td># 17504044</td><td></td></tr><tr><td>insulin</td><td>Sigma</td><td># I6634</td><td>Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 &amp;mu;l of 1 N HCl.</td></tr><tr><td>Bovine Serum Albumin, suitable for cell culture (BSA)</td><td>Sigma</td><td># A4161</td><td>Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4</td></tr><tr><td>Fibroblast Growth Factor basic Protein, Human recombinant (bFGF)</td><td>EMD Millipore</td><td># GF003</td><td></td></tr><tr><td>HUMAN PDGF-AA</td><td>VWR</td><td># 102061-188</td><td></td></tr><tr><td>poly-D-lysine</td><td>VWR</td><td># IC15017510</td><td>Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using.</td></tr><tr><td>Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm</td><td>VWR</td><td># 25373-100</td><td></td></tr><tr><td>Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm</td><td>VWR</td><td># 25373-187</td><td></td></tr><tr><td>HBSS, 10X, no Calcium, no Magnesium, no Phenol Red</td><td>Fisher Scientific</td><td># 14185-052</td><td></td></tr><tr><td>Trypan Blue</td><td>Stemcell Technologies</td><td># 07050</td><td></td></tr><tr><td>protease inhibitor cocktail</td><td>Sigma</td><td># 11697498001</td><td></td></tr><tr><td>&lt;strong&gt;Software&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>FastQC</td><td>[10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td><td></td><td>Obtaining quality control metrics of raw and trimmed reads</td></tr><tr><td>Trimmomatic 0.33</td><td>[11] http://www.usadellab.org/cms/?page=trimmomatic</td><td></td><td>Trimming and filtering raw reads</td></tr><tr><td>GENCODE mm10</td><td>ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz</td><td></td><td>Mouse reference genome</td></tr><tr><td>Bowtie2 2.2.4</td><td>[12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml</td><td></td><td>Aligning reads to a reference genome</td></tr><tr><td>SAMTools 1.5</td><td>[13] http://samtools.sourceforge.net/</td><td></td><td>Converting SAM file into BAM format</td></tr><tr><td>HOMER 4.9.1</td><td>[14] http://homer.ucsd.edu/homer/</td><td></td><td>Creating a tag directory and annotating enriched genomic regions with gene symbols</td></tr><tr><td>R 3.2.2</td><td>[15] https://www.R-project.org/</td><td></td><td>Programming scripts and running functions</td></tr><tr><td>SPP 1.13</td><td>[16] https://github.com/hms-dbmi/spp</td><td></td><td>Creating a strand cross-correlation plot</td></tr><tr><td>MACS2 2.2.4</td><td>[17] https://github.com/taoliu/MACS</td><td></td><td>Finding regions of ChIP enrichment over control</td></tr><tr><td>BEDTools 2.25</td><td>[18] http://bedtools.readthedocs.io/en/latest/</td><td></td><td>Genome arithmetics</td></tr><tr><td>bedGraphToBigWig</td><td>http://hgdownload.cse.ucsc.edu/admin/exe/</td><td></td><td>Converting bedGraph file into bigwig</td></tr><tr><td>IGV browser 2.3.58</td><td>[19] http://software.broadinstitute.org/software/igv/</td><td></td><td>Visualization and browsing of significant ChIP-seq peaks</td></tr><tr><td>Microsoft Excel</td><td></td><td></td><td>Spreasheet program</td></tr><tr><td>ENCODE&#039;s blacklist</td><td>https://sites.google.com/site/anshulkundaje/projects/blacklists</td><td></td><td>Filtering peaks</td></tr><tr><td>mm10.chrom.sizes</td><td>http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes.</td><td></td><td>Converting bedGraph file into bigwig</td></tr><tr><td>ENCODE&#039;s motif database</td><td>[25] http://compbio.mit.edu/encode-motifs/</td><td></td><td>Comprehensive motif database required for motif enrichment</td></tr><tr><td>MEME-ChIP</td><td>[20] http://meme-suite.org/index.html</td><td></td><td>Motif enrichment analysis and motif discovery</td></tr><tr><td>&lt;strong&gt;Primer names used for qPCR&lt;/strong&gt;</td><td></td><td></td><td>&lt;strong&gt;Primer sequences used for qPCR&lt;/strong&gt;</td></tr><tr><td>Mbp-F:</td><td></td><td></td><td>CTATAAATCGGCTCACAAGG</td></tr><tr><td>Mbp-R:</td><td></td><td></td><td>AGGCGGTTATATTAAGAAGC</td></tr><tr><td>Iba1-F:</td><td></td><td></td><td>ACTGCCAGCCTAAGACAACC</td></tr><tr><td>Iba1-R:</td><td></td><td></td><td>GCTTTTCCTCCCTGCAAATCC</td></tr><tr><td>Mog-F:</td><td></td><td></td><td>GGCTTCTTGGAGGAAGGGAC</td></tr><tr><td>Mog-R:</td><td></td><td></td><td>TGAATTGTCCTGCATAGCTGC</td></tr><tr><td>GAPDH-F</td><td></td><td></td><td>ATGACATCAAGAAGGTGGTG</td></tr><tr><td>GAPDH-R</td><td></td><td></td><td>CATACCAGGAAATGAGCTTG</td></tr><tr><td>Tuj1-F</td><td></td><td></td><td>TTTTCGTCTCTAGCCGCGTG</td></tr><tr><td>Tuj1-R</td><td></td><td></td><td>GATGACCTCCCAGAACTTGGC</td></tr><tr><td>PDGFR&amp;alpha;-F</td><td></td><td></td><td>AGAGTTACACGTTTGAGCTGTC</td></tr><tr><td>PDGFR&amp;alpha;-R</td><td></td><td></td><td>GTCCCTCCACGGTACTCCT</td></tr></tbody></table>

identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis

포유류 세포에서 유전자 전사 genomic dna transcriptional 요인의 상호 작용에 의해 세포 유형 특정 방식으로 통제 된다. 계보 특정 녹음 방송 요인은 셀 사양 및 분화 개발 과정에 필수적인 역할을 간주 됩니다. 높은 처리량 DNA 연속 (칩 seq)와 결합 하는 칩은 genomic dna 녹음 방송 요인 (또는 그것의 관련 된 복잡 한)의 게놈 넓은 바인딩 사이트를 분석 하 널리 이용 된다. 그러나, 많은 세포는 하나의 표준 칩 반응, 어려운 고립 된 1 차 셀 또는 희귀 세포 인구 제한 수를 공부 하는 필요 합니다. Oligodendrocyte 계보 관련 전사의 규제 메커니즘을 이해 하기 위해서는 요소 Olig2 심하게 순화 마우스 OPCs Olig2 (또는 Olig2 복잡 한)의 게놈 넓은 바인딩 사이트 식별 칩 seq를 사용 하 여 상세한 방법에에서 표시 됩니다. 프로토콜 혈소판 파생 된 성장 인자 수용 체 알파 (PDGFRα)를 정화 하는 방법을 설명 하는 첫째, 긍정적인 OPCs 마우스 두뇌에서. 다음, Olig2 항 체 칩을 중재 하 고 도서관 건설 수행 됩니다. 마지막 부분 bioinformatic 소프트웨어 및 Olig2 칩 seq 분석에 사용 되는 절차에 설명 합니다. 요약 하자면,이 종이 심하게 정화 뇌 OPCs transcriptional 요소 Olig2의 게놈 넓은 바인딩 분석 하는 방법을 보고 합니다.

낮은 셀 칩 seq 수행한 고 bioinformatic 분석 심하게 정화 뇌 OPCs genomic dna Olig2 transcriptional 요소의 잠재적인 상호 작용을 조사 했다. 그림 1 실험 및 데이터 분석 절차의 일반적인 워크플로 보여 줍니다. 이 프로토콜에서 출생 후 쥐 두뇌 했다 단일 세포 현 탁 액에 해리 했다. 조직 분리 후 immunopanning PDGFRα 항 체를 사용 하 여 OPCs 정화 수행 되었다. <strong cla...

Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÎ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFR&#945;+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

여기에 우리가 현재 낮은 셀 chromatin immunoprecipitation (칩)를 수행 하 여 분석 하는 게놈 넓은의 바인딩을 oligodendrocyte 녹음 방송 요인 2 (Olig2) 심하게 정화 뇌 oligodendrocyte 선구자 세포 (OPCs) 하도록 설계 된 프로토콜 도서관 준비, 높은 처리량 시퀀싱 및 bioinformatic 데이터 분석.

PDGFRα + 셀 낮은 셀 Chromatin Immunoprecipitation 시퀀싱 분석에 의해 정화에 녹음 방송 요인 Olig2 게놈 바인딩 사이트를 심하게 식별

In mammalian cells, gene transcription is regulated in a cell type specific manner by the interactions of transcriptional factors with genomic DNA. ...

identifying-transcription-factor-olig2-genomic-binding-sites-acutely

Education

Research

JoVE Core

JoVE Journal

Molecular Biology

Biology

Neuroscience

Genetics

Unit 1

DNA Structure and Function

Gene Expression

SCIENTISTS IN ACTION

9.2K 조회수.  University of Texas Health Science Center. 여기에 우리가 현재 낮은 셀 chromatin immunoprecipitation (칩)를 수행 하 여 분석 하는 게놈 넓은의 바인딩을 oligodendrocyte 녹음 방송 요인 2 (Olig2) 심하게 정화 뇌 oligodendrocyte 선구자 세포 (OPCs) 하도록 설계 된 프로토콜 도서관 준비, 높은 처리량 시퀀싱 및 bioinformatic 데이터 분석.

비디오: Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRα+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

바인딩, 전사, 번역, 및 회전율 세포 활성화 중 글로벌 이벤트를 표시 하는 녹음 방송 요인의 실시간 분석

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

연구

유전학

Preparation of Rat Oligodendrocyte Progenitor Cultures and Quantification of Oligodendrogenesis Using Dual-infrared Fluorescence Scanning

Efficient oligodendrogenesis is the therapeutic goal of a number of areas of research including spinal cord injury, neonatal hypoxia, and demyelinating diseases such as multiple sclerosis and transverse myelitis. Myelination is required to not only facilitate rapid impulse propagation within the central nervous system, but also to provide trophic support to underlying axons. Oligodendrocyte progenitor cells (OPCs) can be studied in vitro to help identify factors that may promote or inhibit oligodendrocyte differentiation. To date, many of the methods available to evaluate this process have either required large numbers of cells, thus limiting the number of conditions that can be investigated at any one time, or labor-intensive methods of quantification. Herein, we describe a protocol for the isolation of large numbers of highly pure OPCs together with a fast and reliable method to determine oligodendrogenesis from multiple conditions simultaneously. OPCs are isolated from P5-P7 neonatal rat cortices and grown in vitro for three days prior to differentiation. Four days after differentiation, oligodendrogenesis is evaluated using a dual-infrared fluorescence-scanning assay to determine expression of the myelin protein.

Oligodendrocytes are the myelinating cells of the central nervous system. This protocol describes a method for the isolation and culture of their precursors, oligodendrocyte progenitor cells, from rat cortices, as well as a fast and reliable quantitative method to evaluate oligodendrogenesis in vitro in response to experimental factors.

쥐 희소 돌기 아교 세포 전구 문화의 준비 및 Oligodendrogenesis의 정량화 이중 적외선 형광 스캔을 사용하여

Efficient oligodendrogenesis is the therapeutic goal of a number of areas of research including spinal cord injury, neonatal hypoxia, and demyelinating ...

발생학

A Chromatin Immunoprecipitation Assay to Identify Novel NFAT2 Target Genes in Chronic Lymphocytic Leukemia

Chronic lymphocytic leukemia (CLL) is characterized by the expansion of malignant B cell clones and represents the most common leukemia in western countries. The majority of CLL patients show an indolent course of the disease as well as an anergic phenotype of their leukemia cells, referring to a B cell receptor unresponsive to external stimulation. We have recently shown that the transcription factor NFAT2 is a crucial regulator of anergy in CLL. A major challenge in the analysis of the role of a transcription factor in different diseases is the identification of its specific target genes. This is of&#160;great significance for the elucidation of pathogenetic mechanisms and potential therapeutic interventions. Chromatin immunoprecipitation (ChIP) is a classic technique to demonstrate protein-DNA interactions and can, therefore, be used to identify direct target genes of transcription factors in mammalian cells. Here, ChIP was used to identify LCK as a direct target gene of NFAT2 in human CLL cells. DNA and associated proteins are crosslinked using formaldehyde and subsequently sheared by sonication into DNA fragments of approximately 200-500 base pairs (bp). Cross-linked DNA fragments associated with NFAT2 are then selectively immunoprecipitated from cell debris using an &#945;NFAT2 antibody. After purification, associated DNA fragments are detected via quantitative real-time PCR (qRT-PCR). DNA sequences with evident enrichment represent regions of the genome which are targeted by NFAT2 in vivo. Appropriate shearing of the DNA and the selection of the required antibody are particularly crucial for the successful application of this method. This protocol is ideal for the demonstration of direct interactions of NFAT2 with target genes. Its major limitation is the difficulty to employ ChIP in large-scale assays analyzing the target genes of multiple transcription factors in intact organisms.

Chronic lymphocytic leukemia (CLL) is the most common leukemia in the western world. NFAT transcription factors are important regulators of development and activation in numerous cell types. Here, we present a protocol for the use of chromatin immunoprecipitation (ChIP) in human CLL cells to identify novel target genes of NFAT2.

만성 림프모구 백혈병에서 소설 NFAT2 대상 유전자를 식별 하는 Chromatin Immunoprecipitation 분석 결과

Chronic lymphocytic leukemia (CLL) is characterized by the expansion of malignant B cell clones and represents the most common leukemia in western ...

암 연구학

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing (ChIP-seq)

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription factors, histone modifications, and other DNA-associated proteins. ChIP-seq data can also be used to find differential binding of transcription factors in different environmental conditions or cell types. Initially, ChIP was performed through hybridization on a microarray (ChIP-chip); however, ChIP-seq has become the preferred method through technological advancements, decreasing financial barriers to sequencing, and massive amounts of high-quality data output. Techniques of performing ChIP-seq with bacterial biofilms, a major source of persistent and chronic infections, are described in this protocol. ChIP-seq is performed on Salmonella enterica serovar Typhimurium biofilm and planktonic cells, targeting the master biofilm regulator, CsgD, to determine differential binding in the two cell types. Here, we demonstrate the appropriate amount of biofilm to harvest, normalizing to a planktonic control sample, homogenizing biofilm for cross-linker access, and performing routine ChIP-seq steps to obtain high quality sequencing results.

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing ChIP-seq

Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) is a method used to establish interactions between transcription factors and the genomic sequences they control. This protocol outlines techniques for performing ChIP-seq with bacterial biofilms, using Salmonella enterica serovar Typhimurium bacterial biofilm as an example.

크로마틴 면역침전 및 고처리량 시퀀싱(ChIP-seq)을 이용한 살모넬라 바이오필름의 CsgD 규제 목표 발견

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription ...

Cell Surface Receptor Identification Using Genome-Scale CRISPR/Cas9 Genetic Screens

Intercellular communication mediated by direct interactions between membrane-embedded cell surface receptors is crucial for the normal development and functioning of multicellular organisms. Detecting these interactions remains technically challenging, however. This manuscript describes a systematic genome-scale CRISPR/Cas9 knockout genetic screening approach that reveals cellular pathways required for specific cell surface recognition events. This assay utilizes recombinant proteins produced in a mammalian protein expression system as avid binding probes to identify interaction partners in a cell-based genetic screen. This method can be used to identify the genes necessary for cell surface interactions detected by recombinant binding probes corresponding to the ectodomains of membrane-embedded receptors. Importantly, given the genome-scale nature of this approach, it also has the advantage of not only identifying the direct receptor but also the cellular components that are required for the presentation of the receptor at the cell surface, thereby providing valuable insights into the biology of the receptor.

This manuscript describes a genome-scale cell-based screening approach to identify extracellular receptor-ligand interactions.

게놈 규모 CRISPR/Cas9 유전 스크린을 이용한 세포 표면 수용체 식별

Intercellular communication mediated by direct interactions between membrane-embedded cell surface receptors is crucial for the normal development and ...

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

이소형 특정 유전자 목표를 식별 칩을 사용하여 게놈 차원의 분석

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

생물학

Chromatin Isolation by RNA Purification (ChIRP)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental gene expression 1,2,3,4,5,6,7. The recent discovery of thousands of lncRNAs in association with specific chromatin modification complexes, such as Polycomb Repressive Complex 2 (PRC2) that mediates histone H3 lysine 27 trimethylation (H3K27me3), suggests broad roles for numerous lncRNAs in managing chromatin states in a gene-specific fashion 8,9. While some lncRNAs are thought to work in cis on neighboring genes, other lncRNAs work in trans to regulate distantly located genes. For instance, Drosophila lncRNAs roX1 and roX2 bind numerous regions on the X chromosome of male cells, and are critical for dosage compensation 10,11. However, the exact locations of their binding sites are not known at high resolution. Similarly, human lncRNA HOTAIR can affect PRC2 occupancy on hundreds of genes genome-wide 3,12,13, but how specificity is achieved is unclear. LncRNAs can also serve as modular scaffolds to recruit the assembly of multiple protein complexes. The classic trans-acting RNA scaffold is the TERC RNA that serves as the template and scaffold for the telomerase complex 14; HOTAIR can also serve as a scaffold for PRC2 and a H3K4 demethylase complex 13.
Prior studies mapping RNA occupancy at chromatin have revealed substantial insights 15,16, but only at a single gene locus at a time. The occupancy sites of most lncRNAs are not known, and the roles of lncRNAs in chromatin regulation have been mostly inferred from the indirect effects of lncRNA perturbation. Just as chromatin immunoprecipitation followed by microarray or deep sequencing (ChIP-chip or ChIP-seq, respectively) has greatly improved our understanding of protein-DNA interactions on a genomic scale, here we illustrate a recently published strategy to map long RNA occupancy genome-wide at high resolution 17. This method, Chromatin Isolation by RNA Purification (ChIRP) (Figure 1), is based on affinity capture of target lncRNA:chromatin complex by tiling antisense-oligos, which then generates a map of genomic binding sites at a resolution of several hundred bases with high sensitivity and low background. ChIRP is applicable to many lncRNAs because the design of affinity-probes is straightforward given the RNA sequence and requires no knowledge of the RNA's structure or functional domains.

Chromatin Isolation by RNA Purification ChIRP

ChIRP is a novel and rapid technique to map genomic binding sites of long noncoding RNAs (lncRNAs). The method takes advantage of the specificity of anti-sense tiling oligonucleotides to allow the enumeration of lncRNA-bound genomic sites.

RNA 정제에 의한 염색질 절연 (처프)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

높은 처리량 시퀀싱을위한 고품질 염색질 면역 침전의 DNA 템플릿의 생성 (칩 SEQ)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

A Semiautomated ChIP-Seq Procedure for Large-scale Epigenetic Studies

Chromatin immunoprecipitation followed by sequencing (ChIP-Seq) is a powerful and widely used approach to profile chromatin DNA associated with specific histone modifications, such as H3K27ac, to help identify cis-regulatory DNA elements. The manual process to complete a ChIP-Seq is labor intensive, technically challenging, and often requires large-cell numbers (&#62;100,000 cells). The method described here helps to overcome those challenges. A complete semiautomated, microscaled H3K27ac ChIP-Seq procedure including cell fixation, chromatin shearing, immunoprecipitation, and sequencing library preparation, for batch of 48 samples for cell number inputs less than 100,000 cells is described in detail. The semiautonomous platform reduces technical variability, improves signal-to-noise ratios, and drastically reduces labor. The system can thereby reduce costs by allowing for reduced reaction volumes, limiting the number of expensive reagents such as enzymes, magnetic beads, antibodies, and hands-on time required. These improvements to the ChIP-Seq method suit perfectly for large-scale epigenetic studies of clinical samples with limited cell numbers in a highly reproducible manner.

This paper describes a semiautomated, microscaled ChIP-Seq protocol of DNA regions associated with a specific histone modification (H3K27ac) using a ChIP liquid-handler platform, followed by library preparation using tagmentation. The procedure includes control assessment for quality and quantity purposes and can be adopted to other histone modifications or transcription factors.

대규모 후생유전학 연구를 위한 반자동 ChIP-Seq 절차

Chromatin immunoprecipitation followed by sequencing (ChIP-Seq) is a powerful and widely used approach to profile chromatin DNA associated with specific ...

Chromatin Immunoprecipitation to Identify Target Protein Binding Sites on Genomic DNA

Source: Dong, X., et.al., <a href="https://app.jove.com/v/57547">Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFR&#945;+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis.</a>&#160;J. Vis. Exp.&#160;(2018)
In this video, we demonstrate the chromatin immunoprecipitation technique to identify protein binding sites on specific regions of the genomic DNA of oligodendrocyte precursor cells via the selective immunoprecipitation of protein-bound chromatin fragments. This method helps to study the interaction of several regulatory proteins, including transcription factors involved in gene regulation.

게놈 DNA의 표적 단백질 결합 부위를 확인하기 위한 크로마틴 면역침전(chromatin immunoprecipitation)

Source: Dong, X., et.al., Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFR&#945;+ Cells by Low-cell Chromatin ...