이 작품 Guozhou Xu에 대 한 노스 캐롤라이나 주립 대학에서 새로운 교수 시작 자금에 의해 지원 되었다.

참고: 분 비 식물 단백질 표정 및 결정 화에 대 한 수정 된 식 벡터와 곤충 셀/잠재 시스템 사용 됩니다.
1. 식물 단백질 분 비 식 GP67 신호 펩 티 드와 잠재 식 벡터의 수정
<ol><li>5' BglII 절단 사이트13, GP67 분 비 신호 순서, 노트, BamHI, EcoRI, StuI, 사리, SpeI, XbaI, PstI, 및 XhoI (그림 1A)의 다중 복제 사이트를 포함 하는 DNA 파편을 음성 합성. 참고: BglII와 BamHI 소화 이후 같은 접착제 끝 귀착되 었 다 DNA, 선형화 벡터 단련된 결 찰 순서에 BglII 및 BamHI 사이트 여 쪼갤은 시퀀스를 변경 될 것입니다 하는 동안 소화 DNA 단편에 선 수 있습니다. BglII 또는 BamHI14.</li>
	<li>BglII와 XhoI, DNA의 다이제스트 4 µ g 그리고 BamHI 및 XhoI14는 식 벡터 DNA의 4 µ g. Dna 농도 반응 버퍼 (50mm 칼륨 아세테이트, 20 mM 트리 아세테이트, 10 m m 마그네슘 아세테이트, 및 100 µ g/mL BSA, pH 7.9 25 ° C에서) x 1에 각 제한 효소의 10 단위를 혼합 하 고 37 ° C 4 h에서 혼합물을 품 어.<ol>
<li>삭제 DNA 파편 및 선형화 벡터 DNA는 DNA 젤 추출 키트15정화.</li>
	</ol>
</li>
	<li>400 선형화 벡터 DNA의 믹스 100 ng ng 소화 DNA의 x T4 DNA 리가 반응 버퍼 (50 mM Tris HCl, 10 m m MgCl2, 1 ATP, 그리고 10 mM DTT, pH 7.5 25 ° C에서)와 T4 DNA의 5 대 1을 포함 하는 10 µ L 결 찰 반응 혼합물에서 조각 리가입니다. 16 h 16 ° C에서 반응 혼합물을 품 어.</li>
	<li>100 µ L DH5α 유능한 세포 표준 변환 프로토콜을 다음의 결 찰 혼합물의 5 µ L를 변환 하 고 암 피 실린-파운드 한 접시16에 결과 식민지를 선택 합니다. 5-10 식민지를 선택 하 고 220 rpm 및 16 h 떨고 인큐베이터에서 37 ° C에서 100 µ g/mL 암 피 실린 포함 된 파운드 매체의 2 mL에 각 식민지를 성장.</li>
	<li>DNA miniprep 키트17 각 플라스 미드 DNA를 추출 하 고 AGTATTTTACTGTTTTCGTAACAG 뇌관 DNA 연속 클론을 확인.</li>
	<li>PCR 증폭 A. thaliana TDR 유전자 조각 인코딩 잔류물 구성 합성 TDR 유전자에서 30-642 (뇌관을 앞으로: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, 반전 뇌관: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). 0.5 m m dNTP 믹스, 0.2 µ M 뇌관, 템플릿 DNA의 0.1 µ g, 0.4 m m MgCl2및 DNA 중 합 효소의 1 반응 단위를 포함 하는 DNA 중 합 효소 반응 버퍼에 30 사이클에 대 한 DNA를 증폭.<ol>
<li>95 ° c 30에 대 한 초기 변성 PCR 주기 단계에 대 한 설정 들, 그리고 다음 30 주기 변성 95 ° C에서 30 s, 30 s 및 1 분에 72 ° C에서 5 분 동안 72 ° C에서 최종 확장 확장에 대 한 55 ° C에 어 닐 링.</li>
	</ol>
</li>
	<li>PCR 파편 및 노트와 BamHI 제한 endonuclease 효소 수정된 벡터 다이제스트. 선형화 벡터와 유전자 단편 선 400 선형화 벡터 DNA의 믹스 100 ng ng 소화 DNA의 조각 T4 DNA 리가 반응 버퍼 및 T4 DNA 리가의 5 단위를 포함 하는 10 µ L 결 찰 반응 혼합물에서. 16 h 16 ° C에서 반응 혼합물을 품 어.</li>
	<li>100 µ L DH5α 유능한 세포 표준 변환 프로토콜을 다음의 결 찰 혼합물의 5 µ L를 변환 하 고 암 피 실린-파운드 한 접시16에 결과 식민지를 선택 합니다. DNA 시퀀싱에 의해 정확한 복제를 확인 합니다.</li>
</ol>2. 식물 단백질 분 비 식 곤충 Hemolin 신호 펩 티 드와 잠재 식 벡터의 수정
<ol><li>5' BglII 절단 사이트13, 곤충 hemolin 분 비 신호 순서, 노트, BamHI, EcoRI, StuI, 사리, SpeI, XbaI, PstI, 및 XhoI (그림 1B)의 다중 복제 사이트를 포함 하는 DNA 파편을 음성 합성.</li>
	<li>BglII와 XhoI, DNA의 다이제스트 4 µ g 그리고 BamHI 및 XhoI14는 식 벡터 DNA의 4 µ g. Dna 농도 반응 버퍼 (50mm 칼륨 아세테이트, 20 mM 트리 아세테이트, 10 m m 마그네슘 아세테이트, 및 100 µ g/mL BSA, pH 7.9 25 ° C에서) x 1에 각 제한 효소의 10 단위를 혼합 하 고 37 ° C 4 h에서 혼합물을 품 어.<ol>
<li>삭제 DNA 파편 및 선형화 벡터 DNA는 DNA 젤 추출 키트15정화.</li>
	</ol>
</li>
	<li>400 선형화 벡터 DNA의 믹스 100 ng ng 소화 DNA의 x T4 DNA 리가 반응 버퍼 (50 mM Tris HCl, 10 m m MgCl2, 1 ATP, 그리고 10 mM DTT, pH 7.5 25 ° C에서)와 T4 DNA의 5 대 1을 포함 하는 10 µ L 결 찰 반응 혼합물에서 조각 리가입니다. 16 h 16 ° C에서 반응 혼합물을 품 어.</li>
	<li>100 µ L DH5α 유능한 세포의 결 찰 혼합물의 5 µ L를 변환 하 고 암 피 실린-파운드 한 접시에 식민지를 선택 합니다. 5-10 식민지를 선택 하 고 포함 하는 100 µ g/mL 암 피 실린 220 rpm 및 16 h 떨고 인큐베이터에서 37 ° C에서의 2 mL 파운드 매체에 각 식민지를 성장.</li>
	<li>DNA miniprep 키트17 플라스 미드 DNA를 추출 하 고 AGTATTTTACTGTTTTCGTAACAG 뇌관 DNA 연속 클론을 확인 합니다.</li>
	<li>PCR 증폭를 A. thaliana 꽃가루 수용 체 키 니 아 제 3 (PRK3) 유전자 조각 잔류물 20-237 합성 PRK3 유전자 구성에서 인코딩 (뇌관을 앞으로: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, 반전 뇌관: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC)입니다. 0.5 m m dNTP 믹스, 0.2 µ M 뇌관, 템플릿 DNA의 0.1 µ g, 0.4 m m MgCl2및 DNA 중 합 효소의 1 반응 단위를 포함 하는 DNA 중 합 효소 반응 버퍼에 30 사이클에 대 한 DNA를 증폭.<ol>
<li>초기 변성 95 ° C 30에 대 한 설정에 대 한 PCR 주기 단계 s, 그리고 다음 30 주기 변성 95 ° C에서 30 s, 30 s 및 30에 대 한 72 ° C에서 확장 하는 55 ° C에서 어 닐 링 각 주기 및 5 분 동안 72 ° C에서 마지막 확장 내에서 s.</li>
	</ol>
</li>
	<li>PCR 파편 및 노트와 BamHI 제한 endonuclease 효소 수정된 벡터 다이제스트. 선형화 벡터와 유전자 단편 선 400 선형화 벡터 DNA의 믹스 100 ng ng 소화 DNA의 조각 T4 DNA 리가 반응 버퍼 및 T4 DNA 리가의 5 단위를 포함 하는 10 µ L 결 찰 반응 혼합물에서. 16 h 16 ° C에서 반응 혼합물을 품 어.</li>
	<li>100 µ L DH5α 유능한 세포 표준 변환 프로토콜을 다음의 결 찰 혼합물의 5 µ L를 변환 하 고 암 피 실린-파운드 한 접시16에 결과 식민지를 선택 합니다. DNA 시퀀싱에 의해 정확한 복제를 확인 합니다.</li>
</ol>3. 생산 및 잠재의 증폭 재조합 형 단백질 표정 카세트를 품고 생성
<ol><li>DH10Bac 유능한 세포 잠재 식 시스템1의 프로토콜을 다음의 40 µ L 변환 구문 플라스 미드의 사용 100 ng. 48 h에 대 한 37 ° C에서 변환 접시를 품 어.</li>
	<li>각 변환 플레이트에서 두 개의 백색 식민지를, 각 식민지 파운드 매체 50 µ g/mL 대, 7 µ g/mL gentamicin, 그리고 10 µ g/mL 항생물질의 2 mL에 접종. 추출 하 고 bacmid DNA 확인 잠재 식 시스템1 의 프로토콜을 따릅니다. Aliquot 20 µ L 각와 함께 두 개의 튜브에서 각 DNA-20 ° c.에 튜브를 저장 참고: 다음 단계는 무 균 작업이 필요합니다.</li>
	<li>27 ° C에서 10% 태아 둔감 한 혈 청 (FBS)와 100 µ g/mL (또는 100 I.U./mL) 문화 미디어 스 페니실린 항생제에 Sf9 세포의 단층 6 잘 플레이트 합류 점 80% 성장. 합류의 조직 문화 접시에 덮여 영역 비율에 따라 백분율을 예상 하고있다.</li>
	<li>2 살 균 1.5 mL 원심 분리기 튜브에 다음과 같은 솔루션을 준비 합니다.<ol>
<li>1 관: 각 transfection에 대 한 항생제 없이 unsupplemented Sf9 세포 배양 매체의 100 µ L로 bacmid DNA의 20 µ L 희석. 튜브의 측면을 터치 하 여 희석을 부드럽게 혼합.</li>
		<li>2 관: 각 transfection에 대 한 항생제 없이 unsupplemented Sf9 세포 배양 매체의 100 µ L로 지질 transfection 시 약의 8 µ L를 희석. 6 x를 위아래로 pipetting으로 희석을 철저 하 게 혼합.</li>
	</ol>
</li>
	<li>두 솔루션을 결합, 3 x를 위아래로 천천히 pipetting으로 그들을 부드럽게 혼합 하 고 실 온에서 20-40 분 동안 그들을 품 어.</li>
	<li>각 잘 Sf9 단층의 세포 항생제 없이 unsupplemented Sf9 세포 배양 매체의 3 mL 2 x 세척. 각 transfection 지질-DNA 혼합물을 포함 하는 각 관에 항생제 없이 unsupplemented Sf9 세포 배양 매체의 0.8 mL를 추가 합니다. 3 x를 위아래로 천천히 pipetting으로 튜브의 내용의 부드럽게 혼합. Transfection 혼합 샘플을 오버레이 및 격판덮개에서 세척 미디어 발음.</li>
	<li>Transfection 혼합물의 추가 후에 품 어 27 ° c.에 5 h transfected 플레이트 10 %FBS 100 µ g/mL (100 I.U./mL) 포함 된 완전 한 Sf9 세포 배양 매체 transfection 미디어 바꿉니다 항생제 페니실린 스. 4 d 27 ° C에서 transfected 접시를 품 어.</li>
	<li>수확 하 고 재조합 잠재 증폭.<ol>
<li>외피의 4 d 후 살 균 15 mL 원뿔 튜브에 감염 된 접시의 상쾌한을 수집 합니다. 1010 x g 세포 파편을 제거 하 5 분에 상쾌한 스핀. 펠 릿을 삭제 하 고 깨끗 한 튜브에 상쾌한 가만히 따르다 4 ° C에서 최대 1 년 동안 그것을 저장. 참고: 이것은 P0 바이러스입니다. 그것은 시간이 더 긴 기간 aliquoted 및-80 ° C에서 저장 될 수 있습니다.</li>
		<li>각 재조합 바이러스를 증폭, 80% 합류 150 mm 접시에 Sf9 세포의 단층 성장. 접시에서 미디어를 발음 접시에 세포 부착에 P0 바이러스의 2 개 mL를 추가 하 고 품 어 27 ° C 배양 기에서 1 시간에 대 한 접시. 셀으로 매체를 혼합 판 매 15 분 바위.<ol>
<li>10 %FBS 100 µ g/mL (100 I.U./mL)를 포함 하는 완전 한 그레이스의 미디어의 25 mL를 추가 항생제 페니실린 스. P1 통행 바이러스를 27 ° C 인큐베이터에서 3 d 격판덮개를 품 어.</li>
		</ol>
</li>
		<li>살 균 50 mL 원뿔 튜브에 세포 파편을 제거 하 5 분에 대 한 1010 x g 에서 스핀 감염 된 접시의 상쾌한을 수집 합니다. 깨끗 한 튜브에 상쾌한 가만히 따르다 고 최대 1 년 동안 4 ° C에서 그것을 저장 합니다. 참고: P1 바이러스 수 있습니다 aliquoted-80 ° C에서 저장 시간이 더 긴 기간에 대 한.</li>
		<li>P1에서 P2 통행 바이러스를 증폭, 90% 합류를 150 mm 접시에 Sf9 세포의 단층을 성장 하 고, 접시의 미디어를 발음 하 고, 접시, P1 바이러스의 2 개 mL를 추가 한 27 ° C 배양 기에서 1 시간을 위해 그것을 품 어.</li>
		<li>3.8.2 및 3.8.3 바이러스의 P2 및 P3 구절을 단계를 반복 합니다. 2 개월 이상 P3 바이러스를 저장 하지 마십시오.</li>
	</ol>
</li>
</ol>4. 단백질 식, NiNTA, 및 결정 화 정화
<ol><li>27 ° C 배양 기 통에 100 rpm에서 2 x 106 의 밀도 100 µ g/mL (100 I.U./mL) 문화 미디어 페니실린 스 항생제에 Hi5 곤충 세포의 1 L 문화. 570 x g 5 분에 셀 아래로 회전 시키십시오, 가만히 따르다는 상쾌한, 갓 생산된 P3 바이러스의 20 mL에 셀 resuspend 그리고 1 헤 부드럽게 흔들어 각 15 분 x 1 셀 resuspend 스핀 병에 대 한 실내 온도에서 보관.</li>
	<li>와 100 µ g/mL (100 I.U./mL) 문화 미디어 스 페니실린 항생제의 1 l 셀을 전송 하 고 72 h. 스핀 1,010 x g 5 분에 셀 아래에 27 ° C 배양 기 통에 100 rpm에서 셀 문화는 상쾌한을 수집 합니다.</li>
	<li>사용 pH 지시자 0.1 M HCl 또는 0.1 M NaOH 추가 하 여 상쾌한 8.0의 pH를 조정 하 고 최종 농도, pH 8.0, 100 mM NaCl, 20 mM Tris 버퍼 및 5mm 이미에 바인딩 버퍼를 추가를 제거 합니다. 표현된 그의 태그 재조합 단백질의 예상된 수익률에 따라 NiNTA 수 지 (10-40 mL)의 일정 금액을 추가 합니다.<ol>
<li>수 지 1 h. 워시 4 ° C에서 낮은 속도와 자기 파문에 솔루션을 혼합 하 고 표준 NiNTA 정화 프로토콜18다음 바인딩된 단백질을 elute.</li>
	</ol>
</li>
	<li>이온 교환 정제 단백질 주제와 젤 여과 착 색 인쇄기, 뿐만 아니라 다른 단백질 정화 방법, 균질 샘플을 얻을. 참고: TDR ectodomain, 20 mM Tris, pH 8, 100 mM NaCl 젤 여과 버퍼로 사용 했다. PRK3 ectodomain, 20 m m 두번째-트리 스에 대 한 pH 6, 100 mM NaCl 선호 젤 여과 버퍼로 사용 되었다.</li>
</ol>

<ol>
	<li>Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+using+the+baculovirus-insect+cell+expression+system.">Protein production using the baculovirus-insect cell expression system.</a> Biotechnology Progress. 30, 1-18 (2014).</li><li>Khan, S., Ng, M. L., Tan, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+severe+acute+respiratory+syndrome+coronavirus+3a+protein+and+the+assembly+of+coronavirus-like+particles+in+the+baculovirus+expression+system.">Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system.</a> Methods in Molecular Biology. 379, 35-50 (2007).</li><li>Possee, R. D., King, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+Transfer+Vectors.">Baculovirus Transfer Vectors.</a> Methods in Molecular Biology. 1350, 51-71 (2016).</li><li>Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+establishment+of+two+cell+lines+from+the+insect+Spodoptera+frugiperda+(Lepidoptera;+Noctuidae).">The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae).</a> In Vitro. 13, 213-217 (1977).</li><li>Hink, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Established+insect+cell+line+from+the+cabbage+looper,+Trichoplusia+ni.">Established insect cell line from the cabbage looper, Trichoplusia ni.</a> Nature. 226, 466-467 (1970).</li><li>Davis, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+recombinant+protein+production+of+eight+insect+cell+lines.">Comparative recombinant protein production of eight insect cell lines.</a> In Vitro Cellular &amp; Development Biology - Animal. 29A, 388-390 (1993).</li><li>Wickham, T. J., Nemerow, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+growth+methods+and+recombinant+protein+production+in+BTI-Tn-5B1-4+insect+cells+using+the+baculovirus+expression+system.">Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.</a> Biotechnology Progress. 9, 25-30 (1993).</li><li>Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+expression+of+alkaline+phosphatase+as+a+reporter+gene+for+evaluation+of+production,+glycosylation+and+secretion.">Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion.</a> Nature Biotechnology. 10, 1148-1150 (1992).</li><li>Murphy, C. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+expression,+secretion,+and+large-scale+purification+of+recombinant+HIV-1+gp120+in+insect+cell+using+the+baculovirus+egt+and+p67+signal+peptides.">Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides.</a> Protein Expression and Purification. 4, 349-357 (1993).</li><li>Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemolin:+an+insect-immune+protein+belonging+to+the+immunoglobulin+superfamily.">Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily.</a> Science. 250, 1729-1732 (1990).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+CLE+peptide+perception+by+plant+receptors+implicated+from+structural+and+functional+analyses+of+TDIF-TDR+interactions.">Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions.</a> PLoS One. 12, e0175317 (2017).</li><li>Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Extracellular+Domain+of+Pollen+Receptor+Kinase+3+is+structurally+similar+to+the+SERK+family+of+co-receptors.">The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors.</a> Scientific Reports. 8, 2796 (2018).</li><li>Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Total+synthesis+of+a+gene.">Total synthesis of a gene.</a> Science. 203, 614-625 (1979).</li><li>Bahl, C. P., Marians, K. J., Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+for+inserting+specific+DNA+sequences+into+cloning+vehicles.">A general method for inserting specific DNA sequences into cloning vehicles.</a> Gene. 1, 81-92 (1976).</li><li>Xu, W., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Vaccine-Derived+Polioviruses,+Relevance+for+the+Global+Polio+Eradication+Initiative.">Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative.</a> Methods in Molecular Biology. 1387, 213-226 (2016).</li><li>Hanahan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+transformation+of+Escherichia+coli+with+plasmids.">Studies on transformation of Escherichia coli with plasmids.</a> Journal of Molecular Biology. 166, 557-580 (1983).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Reddy, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+the+alpha+subunit+of+the+epithelial+sodium+channel,+ENaC.">Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC.</a> Protein Expression and Purification. 117, 67-75 (2016).</li><li>Harris, T. J., Emtage, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+heterologous+genes+in+E.+coli.">Expression of heterologous genes in E. coli.</a> Microbiological Sciences. 3, 28-31 (1986).</li><li>Kaur, J., Kumar, A., Kaur, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimization+of+heterologous+protein+expression+in+E.+coli:+Roadblocks+and+reinforcements.">Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements.</a> International Journal of BIological Macromolecules. 106, 803-822 (2018).</li><li>Guo, Y., Yang, F., Tang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+of+Protein+Secretion+in+Yeast+and+Animal+Cells.">An Overview of Protein Secretion in Yeast and Animal Cells.</a> Methods in Molecular Biology. 1662, 1-17 (2017).</li><li>Blight, M. A., Chervaux, C., Holland, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+pathway+in+Escherichia+coli.">Protein secretion pathway in Escherichia coli.</a> Current Opinion in Biotechnology. 5, 468-474 (1994).</li><li>Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+protein+secretion+in+yeast:+strategies+and+impact+on+protein+production.">Engineering of protein secretion in yeast: strategies and impact on protein production.</a> Applied Microbiology and Biotechnology. 86, 403-417 (2010).</li><li>Wormald, M. R., Dwek, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycoproteins:+glycan+presentation+and+protein-fold+stability.">Glycoproteins: glycan presentation and protein-fold stability.</a> Structure. 7, R155-R160 (1999).</li><li>Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+and+History+of+Glyco-Engineering+in+Insect+Expression+Systems.">An Overview and History of Glyco-Engineering in Insect Expression Systems.</a> Methods in Molecular Biology. 1321, 131-152 (2015).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-ray+crystallographic+studies+of+the+extracellular+domain+of+the+first+plant+ATP+receptor,+DORN1,+and+the+orthologous+protein+from+Camelina+sativa.">X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa.</a> Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).</li><li>Aricescu, A. R., Owens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+recombinant+glycoproteins+in+mammalian+cells:+towards+an+integrative+approach+to+structural+biology.">Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.</a> Current Opinion in Structural Biology. 23, 345-356 (2013).</li><li>Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scale-up+of+hydrophobin-assisted+recombinant+protein+production+in+tobacco+BY-2+suspension+cells.">Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells.</a> Plant Biotechnology Journal. 12, 402-410 (2014).</li><li>Dohi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+virus-mediated+expression+of+a+foreign+protein+in+suspension-cultured+plant+cells.">Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells.</a> Archives of Virology. 151, 1075-1084 (2006).</li></ol>

저자는 공개 없다.

크기 및 생물 학적 시스템에 단백질의 수천의 안정성에 다양성을 감안할 때, 그것은 종종 경험적 연구에 대 한 실험실을 분리 표현 시스템을 결정 하는 특정 단백질의 표현에 대 한 선택. 대장균 식 시스템은 종종19최대 규모 박테리아, 문화 미디어, 그리고 상대적으로 완화의 저렴 한 비용의 짧은 라이프 사이클에 따른 단백질 표정에 대 한 첫 번째 선택. 그러나 60 kDa,, ?...

특히 x 선 결정학 연구에 대 한 생화학 및 생물 characterizations 위해 균질 재조합 단백질의 대량 생산의 수 연구 실험실을 위한 필수적입니다. 대장균, 효 모, 곤충 세포, 포유류 세포, 식물 세포, 등 그들의 사이에서 많은 확고 분리 식 시스템, 잠재 중재 곤충 세포 표현 시스템은 가장 중 일반적으로 구조적으로 접힌된 대형 재조합 진 핵 단백질의 단백질 결정 화1대량 생산 기법을 사용.
잠재 식 시스템의 식 벡터는 강한 polyhedrin 또는 재조합 세포내 단백질2,3의 높은 수익률을 생산 하는 P10 발기인을 포함 하도록 설계 되었습니다. 재조합 잠재 수 있도록, 관심사의 유전자 Autographa californica nucleopolyhedroviral 멀티 게놈의 polyhedrin (polh) 로커 스를 포함 하는 곤충 벡터에 복제 됩니다. 결과 구문 다음 시퀀스 및 올바른 열려있는 독서 프레임 (ORF) 확인. 올바른 구문 다음 transfection의 과정을 통해 호스트 곤충 세포에 도입 되었습니다. 관심사의 유전자는 상 동 재조합에 의해 바이러스 성 게놈에 삽입 됩니다. 이 이벤트는 재조합 생산 하는 후 복제 바이러스 입자1언약궤 재조합 형 바이러스 성 게놈의 생산에서 발생 합니다.
곤충 세포 표현 시스템에서 가장 일반적으로 사용 되는 Sf9 및 높은 5 (Hi5) 세포 이다. Sf9 세포는 Sf21, Spodoptera frugiperda의 번데기 난소 세포에서 파생 된의 클론 분리 되며 Hi5 세포 클론 분리는 부모의 Trichoplusia ni 난소 세포 선 테네시-3684,5에서 파생 된. Hi5 셀 일반적으로 재조합 단백질6의 더 높은 양을 생성을 선택 하는 동안 공동 transfections, 바이러스 증폭 및 상 패 분석 실험, Sf9 세포에 지휘 된다. Hi5 세포는 돌연변이 바이러스를 생산 하는 그들의 추세 때문에 세대 및 바이러스 progenies의 증폭에 적합 하지 않습니다 지적 가치가 있다. 전통적으로, 25-30 ° C의 온도 범위는 곤충 세포의 경작에 좋은 것으로 간주 됩니다. 그러나, 그것은 27-28 ° C 곤충 세포 성장과 감염7,8에 대 한 최적의 온도 보고 되었습니다.
강한 신호 순서 선행 하는 유전자의 소개 secreted 단백질의 높은 식이 필요 합니다. 신호 순서 효율적으로 단백질 분 비와 포스트 번역 상 수정 적절 한 접는 및 안정화3에 필요한에 대 한 바인딩과 그물에 번역 된 재조합 단백질을 안내 것입니다. 신호 펩 티 드 순서는 잠재 봉투 단백질 GP64/67, 꿀벌 melittin, 그리고 다른 사람, 같이 잠재 중재 식 시스템3분 비 재조합 형 단백질의 표정을 촉진 하기 위해 선택 되었습니다. GP67의 신호 펩 티 드의 도입 대상 유전자9의 내장 신호 펩 티 드를 사용 하 여 비교 secreted 재조합 단백질의 식 수율을 개선 하기 위해 표시 되었습니다. Hemolin는 거 대 한 실크 나 방 Hyalophora cecropia, 박테리아 감염10시 유도의 hemolymph 단백질 이다. 유도 식의 상대적으로 높은 수준으로 인해 유전자의 신호 펩 티 드 순서 잠재 곤충 세포 시스템에서 재조합 단백질의 분 비 식 중재에 사용할 수 있습니다.
A. thaliana Tracheary 요소 차별화 금지 요인 수용 체 (TDR)와 꽃가루 수용 체 키 니 아 제 3 (PRK3) 둘 다 단백질11,12의 식물 신 부유한 반복 같은 수용 체 키 니 아 제 (LRR-RLK) 가족에 속하는 . 구조와 공장 수용 체 단백질의, 뿐만 아니라 다른 식물 분 비 단백질의 구조 및 생 화 확 적인 특성 있을이 가족의 기능을 공부 하기 위하여 잠재 곤충 세포 표현 시스템 수정 되었습니다. 단백질의 품질 및 생산 수율을 향상 시킵니다. TDR 및 PRK3의 세포 외 도메인 성공적으로 두 개의 수정된 식 벡터를 사용 하 여 잠재 곤충 세포 표현 시스템에서 표현 되었습니다. TDR 및 PRK3 단백질의 extracellular 도메인 모두 화 시키는 되는. 이 문서는 GP67 또는 발기인 및 여러 복제 사이 hemolin 신호 순서를 통합 하 여 표현과 많은 양의 두 수정된 잠재 식 벡터와 재조합 분 비 식물 단백질의 정화를 보고 사이트입니다.

<table><tbody><tr><td>Incubator shaker</td><td>VWR</td><td>Model Excella E25</td><td>27 &lt;sup&gt;o&lt;/sup&gt;C</td></tr><tr><td>Incubator</td><td>VWR</td><td>Model 2005</td><td>27 &lt;sup&gt;o&lt;/sup&gt;C</td></tr><tr><td>Centrifuge</td><td>BECKMAN</td><td>Model J-6</td><td>with a swing bucket rotor</td></tr><tr><td>Herculase II Fusion DNA Polymerase</td><td>Agilent</td><td>600677-51</td><td>For PCR amplification of DNA</td></tr><tr><td>Thermal Cycler</td><td>BIO-RAD</td><td>Model C1000 Touch</td><td>For PCR amplification of DNA</td></tr><tr><td>Incubator shaker</td><td>New Brunswick Scientific</td><td>Model I 24</td><td>For growing baceria culture</td></tr><tr><td>Customer DNA synthesis</td><td>GENSCRIPT</td><td></td><td></td></tr><tr><td>BamHI (HF)</td><td>New England Biolabs</td><td>R3136S</td><td>Restriction Endonuclease</td></tr><tr><td>BglII</td><td>New England Biolabs</td><td>R0144S</td><td>Restriction Endonuclease</td></tr><tr><td>NotI (HF)</td><td>New England Biolabs</td><td>R3189S</td><td>Restriction Endonuclease</td></tr><tr><td>XhoI</td><td>New England Biolabs</td><td>R0146S</td><td>Restriction Endonuclease</td></tr><tr><td>T4 DNA ligase</td><td>New England Biolabs</td><td>M0202T</td><td>DNA ligation</td></tr><tr><td>QIAquick Gel Extraction Kit</td><td>Qiagen</td><td>28704</td><td>DNA purification from Agorase gel</td></tr><tr><td>QIAprep Spin Miniprep Kit</td><td>Qiagen</td><td>27104</td><td>Plasmid DNA purification from bacteria culture</td></tr><tr><td>Agarose</td><td>Thermo Fisher Scientific</td><td>15510-019</td><td>For DNA gel electropherosis</td></tr><tr><td>MAX Efficiency DH5&amp;alpha; competen cell</td><td>Invitrogen</td><td>18-258-012</td><td>For transformation of DNA ligation mixture</td></tr><tr><td>Lennox L LB Broth</td><td>Research Product International Corp.</td><td>L24066-5000.0</td><td>For making bacteria culture</td></tr><tr><td>Ampicillin sodium salt</td><td>Thermo Fisher Scientific</td><td>11593-019</td><td>Antibiotics</td></tr><tr><td>Kanamycin Sulfate</td><td>Thermo Fisher Scientific</td><td>15160-054</td><td>Antibiotics</td></tr><tr><td>Tetracycline</td><td>Thermo Fisher Scientific</td><td>64-75-5</td><td>Antibiotics</td></tr><tr><td>Gentamicin</td><td>Thermo Fisher Scientific</td><td>15710-064</td><td>Antibiotics</td></tr><tr><td>MAX Efficiency DH10Bac competent cells</td><td>Thermo Fisher Scientific</td><td>10361-012</td><td>For making bacmid DNA</td></tr><tr><td>S.O.C. Medium</td><td>Thermo Fisher Scientific</td><td>15544-034</td><td>For DNA transformation</td></tr><tr><td>CellFECTIN II Reagent</td><td>Thermo Fisher Scientific</td><td>10362-101</td><td>Insect cell transfection reagent</td></tr><tr><td>Bac-to-Bac Expression System</td><td>Thermo Fisher Scientific</td><td>10359-016</td><td>Baculovirus-insect cells expression kit</td></tr><tr><td>Bluo-gal</td><td>Thermo Fisher Scientific</td><td>15519-028</td><td>For isolation of recominant Bacmid DNA</td></tr><tr><td>IPTG</td><td>Thermo Fisher Scientific</td><td>15529-019</td><td>For isolation of recominant Bacmid DNA</td></tr><tr><td>pFastBac1</td><td>Thermo Fisher Scientific</td><td>10360014</td><td>Baculorirus expression vector</td></tr><tr><td>Sf9 cells</td><td>Thermo Fisher Scientific</td><td>11496015</td><td>Sf9 monolayer cells</td></tr><tr><td>Hi5 cells</td><td>Thermo Fisher Scientific</td><td>B85502</td><td>High Five insect cells</td></tr><tr><td>Grace&amp;rsquo;s insect medium, unsupplemented</td><td>Thermo Fisher Scientific</td><td>11595030</td><td>Sf9 cell transfection minimum medium</td></tr><tr><td>Grace&amp;rsquo;s insect medium, supplemented</td><td>Thermo Fisher Scientific</td><td>11605102</td><td>Sf9 monolayer cell culture complete medium</td></tr><tr><td>Sf-900 II SFM</td><td>Thermo Fisher Scientific</td><td>10902104</td><td>Sf9 suspension cell culture medium without FBS</td></tr><tr><td>Express Five SFM</td><td>Thermo Fisher Scientific</td><td>10486025</td><td>Hi5 cell culture medium</td></tr><tr><td>Penicillin-Streptomycin</td><td>Thermo Fisher Scientific</td><td>15140122</td><td>100 ml (10,000 I.U./ml)</td></tr><tr><td>L-Glutamine (200 mM)</td><td>Thermo Fisher Scientific</td><td>25030081</td><td>100 ml</td></tr><tr><td>FBS Certified</td><td>Thermo Fisher Scientific</td><td>16000-044</td><td>500 ml</td></tr><tr><td>6-well plates</td><td>Thermo Fisher Scientific</td><td>08-772-1B</td><td>Flat-bottom</td></tr><tr><td>150 mm plates</td><td>Thermo Fisher Scientific</td><td>353025</td><td>100/case</td></tr><tr><td>1.5 ml Microcentrifuge Tubes</td><td>USA Scientific</td><td>1415-2500</td><td>500 tubes/bag</td></tr><tr><td>15 ml conical screw cap centrifuge tubes</td><td>USA Scientific</td><td>1475-0511</td><td>25 tubes/bag</td></tr><tr><td>50 ml conical screw cap centrifuge tubes</td><td>USA Scientific</td><td>1500-1211</td><td>25 tubes/bag</td></tr><tr><td>Ni-NTA Superflow</td><td>Qiagen</td><td>30430</td><td>NiNTA resin</td></tr><tr><td>pH-indicator strips</td><td>EMD Millipore Corporation</td><td>1.09535.0001</td><td>pH 0 - 14</td></tr></tbody></table>

modifying baculovirus expression vectors to produce secreted plant proteins in insect cells

그것은 구조 및 생화학 연구 재조합 분 비 진 핵 단백질을 표현 하는 과학자에 대 한 도전이 되었습니다. 잠재 중재 곤충 세포 표현 시스템 일부 포스트 번역 상 수정 재조합 진 핵 세포 분 비 단백질을 표현 하는 데 사용 하는 시스템 중 하나입니다. 분 비 단백질 단백질 glycosylation, 이황화 결합 형성, 및 다른 포스트 번역 상 수정 분 비 경로 통해 라우팅할 필요가 있다. 를 개선 하기 위해 분 비 식물 단백질의 기존 곤충 세포 표현 잠재 식 벡터 중 하나는 GP67의 추가 또는 발기인 및 다중 복제 사이트 간에 hemolin 신호 펩 티 드 순서에 의해 수정 됩니다. 이 새롭게 설계 된 수정된 벡터 시스템은 성공적으로 애기 thaliana의 수용 성 재조합 분 비 식물 수용 체 단백질의 높은 수익률을 생산. 두 애기 TDR 및 PRK3 원형질 막 수용 체의 세포 외 도메인 표현된 식물 단백질의 x 선 결정학 연구 화 시키는 했다. 수정 된 벡터 시스템 뿐만 아니라 동물의 왕국에 있는 재조합 형 분 비 단백질의 표정을 위해 잠재적으로 이용 될 수 있는 향상 된 도구입니다.

그림 1에서 보듯이 두 수정된 pFastBac1 잠재 식 벡터는 GP67 또는 hemolin 신호 순서 대상 유전자의 본질적인 신호 순서를 대체 하는 secreted 단백질을 표현 하기 위해 사용 되었다. 바이러스 성 GP67와 곤충 hemolin 유전자 세포에 있는 높은 분 비 식 수준 입증 되었습니다. 융해 단백질이 두 신호 시퀀스 중 하나가 크게 분 비 식 수준 향상으로 예상 된다. 동일?...

Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

식물 단백질 곤충 세포에서 분 비 생산 잠재 식 벡터를 수정

여기, 선물이 곤충 세포 및 잠재 단백질 식 시스템 단백질 결정 화에 대 한 분 비 하는 식물 단백질의 대량 생산에 활용에 대 한 프로토콜. 잠재 식 벡터 GP67 또는 곤충 hemolin 신호 펩 티 드 식물 곤충 세포에서 단백질 분 비 식에 대 한 수정 되었습니다.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

modifying-baculovirus-expression-vectors-to-produce-secreted-plant

Research

JoVE Journal

Biochemistry

11.4K 조회수.  North Carolina State University. 여기, 선물이 곤충 세포 및 잠재 단백질 식 시스템 단백질 결정 화에 대 한 분 비 하는 식물 단백질의 대량 생산에 활용에 대 한 프로토콜. 잠재 식 벡터 GP67 또는 곤충 hemolin 신호 펩 티 드 식물 곤충 세포에서 단백질 분 비 식에 대 한 수정 되었습니다.

비디오: Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Transient Expression of Foreign Genes in Insect Cells (sf9) for Protein Functional Assay

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell culture system. This system was developed to express foreign genes under the control of the baculoviral promoter in transient expression plasmids. Furthermore, this system can be applied to a functional assay of either the baculovirus itself or foreign proteins. The most widely and commercially available transient gene expression system is developed based on the immediate-early gene (IE) promoter of Orgyia pseudotsugata multicapsid nucleopolyhedrovirus (OpMNPV). However, a low expression level of foreign genes in insect cells was observed. Therefore, a transient gene expression system was constructed for improving protein expression. In this system, recombinant plasmids were constructed to contain the target sequence under the control of the Drosophila heat shock 70 (Dhsp70) promoter. This protocol presents the application of this heat shock-based pDHsp/V5-His (V5 epitope with 6 histidine)/Spodoptera frugiperda cell (sf9 cell) system; this system is available not only for gene expression but also for evaluating the anti-apoptotic activity of candidate proteins in insect cells. Furthermore, this system can be either transfected with one recombinant plasmid or co-transfected two potentially functionally antagonistic recombinant plasmids in insect cells. The protocol demonstrates the efficiency of this system and provides a practical case of this technique.

Transient Expression of Foreign Genes in Insect Cells sf9 for Protein Functional Assay

This protocol describes a heat shock-induced protein expression system (pDHsp/V5-His/sf9 cell system), which can be used for either expressing foreign proteins or evaluating the anti-apoptotic activity of potential foreign proteins and their truncated amino acids in insect cells.

과도 식의 외국 유전자 단백질 기능 분석 결과 대 한 곤충 세포 (sf9)

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell ...

연구

유전학

Production and Purification of Baculovirus for Gene Therapy Application

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a promising vector for gene therapy application. Here, baculovirus is produced by transient transfection of the baculovirus plasmid DNA (bacmid) in an adherent culture of Sf9 cells. Baculovirus is subsequently expanded in Sf9 cells in a serum-free suspension culture until the desired volume is obtained. It is then purified from the culture supernatant using heparin affinity chromatography. Virus supernatant is loaded onto the heparin column which binds baculovirus particles in the supernatant due to the affinity of heparin for baculovirus envelop glycoprotein. The column is washed with a buffer to remove contaminants and baculovirus is eluted from the column with a high-salt buffer. The eluate is diluted to an isotonic salt concentration and baculovirus particles are further concentrated using ultracentrifugation. Using this method, baculovirus can be concentrated up to 500-fold with a 25% recovery of infectious particles. Although the protocol described here demonstrates the production and purification of the baculovirus from cultures up to 1 L, the method can be scaled-up in a closed-system suspension culture to produce a clinical-grade vector for gene therapy application.

In this protocol, baculovirus is produced by transient transfection of baculovirus plasmid into Sf9 cells and amplified in a serum-free suspension culture. The supernatant is purified by heparin affinity chromatography and further concentrated by ultracentrifugation. This protocol is useful for the production and purification of baculovirus for gene therapy application.

생산 및 유전자 치료 응용 프로그램에 대 한 잠재의 정화

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a ...

Expression and Purification of Mammalian Bestrophin Ion Channels

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- channel (CaCC) predominantly expressed in retinal pigment epithelium (RPE). The physiological and pathological significance of BEST1 is highlighted by the fact that over 200 distinct mutations in the BEST1 gene have been genetically linked to a spectrum of at least five retinal degenerative disorders, such as Best vitelliform macular dystrophy (Best disease). Therefore, understanding the biophysics of bestrophin channels at the single-molecule level holds tremendous significance. However, obtaining purified mammalian ion channels is often a challenging task. Here, we report a protocol for the expression of mammalian bestrophin proteins with the BacMam baculovirus gene transfer system and their purification by affinity and size-exclusion chromatography. The purified proteins have the potential to be utilized in subsequent functional and structural analyses, such as electrophysiological recording in lipid bilayers and crystallography. Importantly, this pipeline can be adapted to study the functions and structures of other ion channels.

The purification of ion channels is often challenging, but once achieved, it can potentially allow in vitro investigations of the functions and structures of the channels. Here, we describe the stepwise procedures for the expression and purification of mammalian bestrophin proteins, a family of Ca2+-activated Cl- channels.

표현과 포유류 Bestrophin 이온 채널의 정화

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- ...

생화학

Expression of Functional Recombinant Hemagglutinin and Neuraminidase Proteins from the Novel H7N9 Influenza Virus Using the Baculovirus Expression System

The baculovirus expression system is a powerful tool for expression of recombinant proteins. Here we use it to produce correctly folded and glycosylated versions of the influenza A virus surface glycoproteins - the hemagglutinin (HA) and the neuraminidase (NA). As an example, we chose the HA and NA proteins expressed by the novel H7N9 virus that recently emerged in China. However the protocol can be easily adapted for HA and NA proteins expressed by any other influenza A and B virus strains. Recombinant HA (rHA) and NA (rNA) proteins are important reagents for immunological assays such as ELISPOT and ELISA, and are also in wide use for vaccine standardization, antibody discovery, isolation and characterization. Furthermore, recombinant NA molecules can be used to screen for small molecule inhibitors and are useful for characterization of the enzymatic function of the NA, as well as its sensitivity to antivirals. Recombinant HA proteins are also being tested as experimental vaccines in animal models, and a vaccine based on recombinant HA was recently licensed by the FDA for use in humans. The method we describe here to produce these molecules is straight forward and can facilitate research in influenza laboratories, since it allows for production of large amounts of proteins fast and at a low cost. Although here we focus on influenza virus surface glycoproteins, this method can also be used to produce other viral and cellular surface proteins.

Here we describe a way to express correctly folded and functional influenza virus surface antigens derived from the novel Chinese H7N9 virus in insect cells. The technique can be adapted to express ectodomains of any viral or cellular surface proteins.

배큘로 바이러스 발현 시스템을 사용하여 소설 H7N9 인플루엔자 바이러스의 기능 재조합 적혈구 응집소와 뉴 라미니다 아제 단백질의 발현

The baculovirus expression system is a powerful tool for expression of  recombinant proteins. Here we use it to produce correctly folded and  glycosylated ...

면역학 및 감염병학

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

바쿨로바이러스 발현 벡터 시스템을 이용한 재조합 PRMT 단백질 생산

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

The MultiBac Protein Complex Production Platform at the EMBL

Proteomics research revealed the impressive complexity of eukaryotic proteomes in unprecedented detail. It is now a commonly accepted notion that proteins in cells mostly exist not as isolated entities but exert their biological activity in association with many other proteins, in humans ten or more, forming assembly lines in the cell for most if not all vital functions.1,2 Knowledge of the function and architecture of these multiprotein assemblies requires their provision in superior quality and sufficient quantity for detailed analysis. The paucity of many protein complexes in cells, in particular in eukaryotes, prohibits their extraction from native sources, and necessitates recombinant production. The baculovirus expression vector system (BEVS) has proven to be particularly useful for producing eukaryotic proteins, the activity of which often relies on post-translational processing that other commonly used expression systems often cannot support.3 BEVS use a recombinant baculovirus into which the gene of interest was inserted to infect insect cell cultures which in turn produce the protein of choice. MultiBac is a BEVS that has been particularly tailored for the production of eukaryotic protein complexes that contain many subunits.4 A vital prerequisite for efficient production of proteins and their complexes are robust protocols for all steps involved in an expression experiment that ideally can be implemented as standard operating procedures (SOPs) and followed also by non-specialist users with comparative ease. The MultiBac platform at the European Molecular Biology Laboratory (EMBL) uses SOPs for all steps involved in a multiprotein complex expression experiment, starting from insertion of the genes into an engineered baculoviral genome optimized for heterologous protein production properties to small-scale analysis of the protein specimens produced.5-8 The platform is installed in an open-access mode at EMBL Grenoble and has supported many scientists from academia and industry to accelerate protein complex research projects.

Protein complexes catalyze key cellular functions. Detailed functional and structural characterization of many essential complexes requires recombinant production. MultiBac is a baculovirus/insect cell system particularly tailored for expressing eukaryotic proteins and their complexes. MultiBac was implemented as an open-access platform, and standard operating procedures developed to maximize its utility.

EMBL에서 MultiBac 단백질 복잡한 생산 플랫폼

Proteomics  research revealed the impressive complexity of eukaryotic proteomes in  unprecedented detail. It is now a commonly accepted notion that ...

생물학

Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins

Mammalian cell culture is the major platform for commercial production of human vaccines and therapeutic proteins. However, it cannot meet the increasing worldwide demand for pharmaceuticals due to its limited scalability and high cost. Plants have shown to be one of the most promising alternative pharmaceutical production platforms that are robust, scalable, low-cost and safe. The recent development of virus-based vectors has allowed rapid and high-level transient expression of recombinant proteins in plants. To further optimize the utility of the transient expression system, we demonstrate a simple, efficient and scalable methodology to introduce target-gene containing Agrobacterium into plant tissue in this study. Our results indicate that agroinfiltration with both syringe and vacuum methods have resulted in the efficient introduction of Agrobacterium into leaves and robust production of two fluorescent proteins; GFP and DsRed. Furthermore, we demonstrate the unique advantages offered by both methods. Syringe infiltration is simple and does not need expensive equipment. It also allows the flexibility to either infiltrate the entire leave with one target gene, or to introduce genes of multiple targets on one leaf. Thus, it can be used for laboratory scale expression of recombinant proteins as well as for comparing different proteins or vectors for yield or expression kinetics. The simplicity of syringe infiltration also suggests its utility in high school and college education for the subject of biotechnology. In contrast, vacuum infiltration is more robust and can be scaled-up for commercial manufacture of pharmaceutical proteins. It also offers the advantage of being able to agroinfiltrate plant species that are not amenable for syringe infiltration such as lettuce and Arabidopsis. Overall, the combination of syringe and vacuum agroinfiltration provides researchers and educators a simple, efficient, and robust methodology for transient protein expression. It will greatly facilitate the development of pharmaceutical proteins and promote science education.

Plants offer a novel system for the production of pharmaceutical proteins on a commercial scale that is more scalable, cost-efficient and safe than current expression paradigms. In this study, we report a simple and convenient, yet scalable approach to introduce target-gene containing Agrobacterium tumefaciens into plants for protein transient expression.

재조합 단백질의 높은 수준의 과도 발현 식물의 효율적인 Agroinfiltration

Mammalian cell culture is the major platform for commercial production of human vaccines and therapeutic proteins. However, it cannot meet the increasing ...

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short period of time. However, this technology is only just beginning to be applied to large-scale production as many technological obstacles to scale up are now being overcome. Here, we demonstrate a simple and reproducible method for industrial-scale transient protein production based on vacuum infiltration of Nicotiana plants with Agrobacteria carrying launch vectors. Optimization of Agrobacterium cultivation in AB medium allows direct dilution of the bacterial culture in Milli-Q water, simplifying the infiltration process. Among three tested species of Nicotiana, N. excelsiana (N. benthamiana &#215; N. excelsior) was selected as the most promising host due to the ease of infiltration, high level of reporter protein production, and about two-fold higher biomass production under controlled environmental conditions. Induction of Agrobacterium harboring pBID4-GFP (Tobacco mosaic virus-based) using chemicals such as acetosyringone and monosaccharide had no effect on the protein production level. Infiltrating plant under 50 to 100 mbar for 30 or 60 sec resulted in about 95% infiltration of plant leaf tissues. Infiltration with Agrobacterium laboratory strain GV3101 showed the highest protein production compared to Agrobacteria laboratory strains LBA4404 and C58C1 and wild-type Agrobacteria strains at6, at10, at77 and A4. Co-expression of a viral RNA silencing suppressor, p23 or p19, in N. benthamiana resulted in earlier accumulation and increased production (15-25%) of target protein (influenza virus hemagglutinin).

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Transient protein production in Nicotiana plants based on vacuum infiltration with Agrobacteria carrying launch vectors (Tobacco mosaic virus-based) is a rapid and economic approach to produce vaccine antigens and therapeutic proteins. We simplified the procedure and improved target accumulation by optimizing conditions of bacteria cultivation, selecting host species, and co-introducing RNA silencing suppressors.

최적화 및 활용<em&gt; 아그로 박테 리움</em에서&gt; 매개 과도 단백질 생산<em&gt;는 담배</em

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short ...

Efficient Production and Purification of Recombinant Murine Kindlin-3 from Insect Cells for Biophysical Studies

Kindlins are essential coactivators, with talin, of the cell surface receptors&#160;integrins and also participate in integrin outside-in signalling, and the control of gene transcription in the cell nucleus. The kindlins are ~75 kDa multidomain proteins and bind to an NPxY motif and upstream T/S cluster of the integrin &#946;-subunit cytoplasmic tail. The hematopoietically-important kindlin isoform, kindlin-3, is critical for platelet aggregation during thrombus formation, leukocyte rolling in response to infection and inflammation and osteoclast podocyte formation in bone resorption. Kindlin-3&#39;s role in these processes has resulted in extensive cellular and physiological studies. However, there is a need for an efficient method of acquiring high quality milligram quantities of the protein for further studies. We have developed a protocol, here described, for the efficient expression and purification of recombinant murine kindlin-3 by use of a baculovirus-driven expression system in Sf9 cells yielding sufficient amounts of high purity full-length protein to allow its biophysical characterization. The same approach could be taken in the study of the other mammalian kindlin isoforms.

Kindlins are fundamental to cell adhesion through integrins but studies of them have been hampered by the difficulty encountered in expressing them recombinantly in bacterial hosts. We describe here methods for their efficient production in baculovirus-infected insect cells.

의 효율적인 생산 및 정제 재조합 쥐과 Kindlin-3 생물 물리학 연구 곤충 세포에서

Kindlins are essential coactivators, with talin, of the cell surface receptors&#160;integrins and also participate in integrin outside-in signalling, and ...

A Comparative Analysis of Recombinant Protein Expression in Different Biofactories: Bacteria, Insect Cells and Plant Systems

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the flexible, low-cost production of high-quality, bioactive products.
In this study, we compared the expression of a target human recombinant protein in traditional fermenter-based cell cultures (bacterial and insect) with plant-based expression systems, both transient and stable.
For each platform, we described the set-up, optimization and length of the production process, the final product quality and the yields and we evaluated provisional production costs, specific for the selected target recombinant protein.
Overall, our results indicate that bacteria are unsuitable for the production of the target protein due to its accumulation within insoluble inclusion bodies. On the other hand, plant-based systems are versatile platforms that allow the production of the selected protein at lower-costs than Baculovirus/insect cell system. In particular, stable transgenic lines displayed the highest-yield of the final product and transient expressing plants the fastest process development. However, not all recombinant proteins may benefit from plant-based systems but the best production platform should be determined empirically with a case-by-case approach, as described here.

In this study the expression of a target human recombinant protein in different production platforms was compared. We focused on traditional fermenter-based cultures and on plants, describing the set-up of each system and highlighting, on the basis of the reported results, the inherent limits and advantages for each platform.

박테리아, 곤충 세포 및 공장 시스템 : 재조합 단백질 다른 Biofactories에서 표현의 비교 분석

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the ...