Name: crystal structure of the n-terminal domain of ryanodine receptor from plutella xylostella
Uploaded: 2018-11-30T14:45:00.000+00:00
Duration: 11 min 31 s
Description: Watch this Scientific Journal Video about Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella at JoVE.com

Funding for this research was provided by: National Key Research and Development Program of China (2017YFD0201400, 2017YFD0201403), National Nature Science Foundation of China (31320103922, 31230061), and Project of National Basic Research (973) Program of China (2015CB856500, 2015CB856504). We are grateful to the staff on the beamline BL17U1 at Shanghai Synchrotron Radiation Facility (SSRF).

1. Gene Cloning, Protein Expression, and Purification
<ol>
	<li>PCR amplify DNA corresponding to protein of interest (residues 1-205 of DBM RyR, Genbank acc. no. AFW97408) and clone into pET-28a-HMT vector by Ligation-Independent Cloning (LIC)25. This vector contains a histidine tag, MBP tag and a TEV protease cleavage site at the N-terminus15.
	<ol>
		<li>Design LIC primers for amplification of target gene with LIC-compatible 5&#8217; extensions: 
		Forward LIC primer: 
		5&#8217; TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3&#8217; 
		Reverse LIC primer: 
		5&#8217; TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3&#8217;</li>
		<li>Combine the reaction components (50 &#956;L): 1 &#956;L of DNA templates (100 ng/&#956;L), 1 &#956;L of forward primer (10 &#956;M), 1 &#956;L of reverse primer (10 &#956;M), 0.5 &#956;L of DNA polymerase (NEB), 5 &#956;L of 10x reaction buffer, 1 &#956;L of dNTP (25 mM), 40.5 &#956;L of RNase free ddH2O.
		<ol>
			<li>Place the reaction mixture in a PCR machine and run the following program.</li>
			<li>Incubate at 95 &#176;C for 3 min, and then run 30 cycles of (95 &#176;C for 30 s, 58 &#176;C for 15 s, 72 &#176;C for 1 min). Incubate at 72 &#176;C for 5 min and then hold at 4 &#176;C.</li>
			<li>Run the entire reaction mix (50 &#956;L) on a 2% agarose gel and extract with a Gel Extraction Kit. Follow manufacturer&#8217;s protocol.</li>
		</ol>
		</li>
		<li>Ligation-Independent Cloning (LIC)
		<ol>
			<li>Perform SspI digestion (60 &#956;L): 20 &#956;L of vector&#160;DNA (50 ng/&#956;L), 6 &#956;L of 10x reaction buffer, 4 &#956;L of SspI, and 30 &#956;L of ddH2O. Incubate at 37 &#176;C for 3 h. Run the entire reaction mix on 1% agarose gel and extract with a Gel Extraction Kit. Follow manufacturer&#8217;s protocol.</li>
			<li>Perform T4 DNA Polymerase treatment of the vector and insert DNA. Combine the following: 5 &#956;L of vector or insert DNA (50 ng/&#956;L), 2 &#956;L of 10x T4 DNA Polymerase Buffer, 1 &#956;L of dGTP (25 mM) for vector or 1 &#956;L of dCTP (25 mM) for insert DNA, 1 &#956;L of DTT (100 mM), 0.4 &#956;L of T4 DNA Polymerase (LIC-qualified), and 9.6 &#956;L of ddH2O. Incubate reactions at room temperature for 40 min. Heat-inactivate enzyme at 75 &#176;C for 20 min. 
			Note: The LIC vector and insert DNA must be treated in separate reactions.</li>
			<li>Perform the LIC annealing reaction. Combine the following: 2 &#956;L of T4-treated insert DNA, 2 &#956;L of T4-treated LIC vector DNA. Incubate reaction at room temperature for 10 min.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Transform BL21 (DE3) E. coli cells with this recombinant plasmid.
	<ol>
		<li>Thaw competent cells (50 &#956;L in micro-centrifuge tube) on ice.</li>
		<li>Add approximately 1 &#956;L (50 ng) of plasmid into the tube. Mix the cells and DNA by gently flicking the tube 2&#8211;3 times. Place the tube on ice for 20 min.</li>
		<li>Heat shock at 42 &#176;C for 40 s. Place the tube on ice again for 2 min. Add 1 mL of room temperature LB media to the tube.</li>
		<li>Place the mixture tube in the 250 rpm shaker at 37 &#176;C for 45 min. Spread 150&#8211;200 &#181;L of the mixture onto the selection plates. Invert the plate and incubate overnight at 37 &#176;C.</li>
	</ol>
	</li>
	<li>Pick a single colony and culture the cells in 100 mL 2YT medium containing 50 &#181;g/mL kanamycin at 37 &#176;C overnight. Next morning, inoculate 1 L 2YT medium containing 50 &#181;g/mL kanamycin with 10 mL of overnight culture and incubate in 37 &#176;C shaker incubator at 250 rpm,&#160;until the OD600 reaches ~0.6. Thereafter induce the culture with IPTG to a final concentration of 0.4 mM and grow for another 5 h at 30 &#176;C.</li>
	<li>Harvest the cells by centrifugation at 8,000 x g for 10 min at 4 &#176;C, collect the cells and resuspend every 10 g cells in 40 mL lysis buffer (10 mM HEPES pH 7.4, 250 mM KCl, 10 mM &#946;-mercaptoethanol, 25 &#956;g/mL lysozyme, 25 &#956;g/mL DNase, 1 mM PMSF).
	<ol>
		<li>Disrupt it by sonication at 65% amplitude for 8 min with 1 s on and 1 s off. Remove the cell debris by centrifugation at 40,000 x g for 30 min at 4 &#176;C. Filter the supernatant by passing through 0.22 &#956;m filter and load it into the sample loop.</li>
	</ol>
	</li>
	<li>Purify the fusion protein, cleave the tag and re-purify the target protein.
	<ol>
		<li>Purify the fusion protein using Ni-NTA&#160;column (binding buffer: 10 mM HEPES pH 7.4, 250 mM KCl; elution buffer: 10 mM HEPES pH 7.4, 250 mM KCl, 500 mM imidazole) and purify by a purification system, with a linear gradient of 20&#8211;250 mM imidazole.</li>
		<li>Cleave the eluted target protein with TEV protease (1:50 ratio) overnight at 4 &#176;C.</li>
		<li>Purify the cleavage reaction mixture by using amylose resin column (binding buffer: 10 mM HEPES pH 7.4, 250 mM KCl; elution buffer: 10 mM HEPES pH 7.4, 250 mM KCl, 10 mM maltose) and Ni-NTA&#160;column to remove the tag and TEV protease. The target protein will be in the flow-through fraction of these two columns.</li>
		<li>Dialyze the sample&#160;against dialysis buffer (10 mM Tris-HCl pH 8.8, 50 mM KCl, 10 mM &#946;-mercaptoethanol to reduce the salt concentration. Purify the sample on a anion exchange&#160;column (binding buffer: 10 mM Tris-HCl pH 8.8, 10 mM &#946;-mercaptoethanol; elution buffer: 10 mM Tris-HCl pH 8.8, 1 M KCl, 10 mM &#946;-mercaptoethanol) by a linear gradient of 20&#8211;500 mM KCl in the elution buffer.</li>
		<li>As a final step in the purification process, concentrate the protein using centrifugal concentrator (10 kDa MWCO) and inject into a Superdex 200 26/600 gel-filtration column to check the homogeneity.</li>
	</ol>
	</li>
	<li>Examine the purity of the protein by running it on a 15% SDS PAGE. 
	NOTE: All columns are running on a protein purification system with a binding flow rate of 2 mL/min, and an elution flow rate of 4 mL/min except for gel-filtration at 1 mL/min.</li>
</ol>
2. Protein Preparation and Crystallization
<ol>
	<li>Concentrate the purified protein sample to 10 mg/mL using centrifugal concentrator (10 kDa MWCO) and buffer exchange to crystallization buffer before storing at -80 &#176;C.</li>
	<li>Perform crystallization screening (1:1 ratio, 200 nL of protein and 200 nL of reservoir buffer) by the sitting drop vapor diffusion method at 295 K with several crystallization kits using an automated liquid handling robotic system in a 96-well format. 
	NOTE: We used kits from Molecular Dimensions and Hampton research and the Gryphon automated liquid handling system.</li>
	<li>Seal the 96-well crystallization plate to prevent evaporation and enable the equilibration of the protein drop with the reservoir buffer. Then keep the plates in the crystal incubator at 18 &#176;C.</li>
	<li>Check the 96-well plates periodically using a light microscope to monitor crystal formation and growth.</li>
	<li>To differentiate protein crystals from salt crystals, use a protein dye. Add 1 &#181;L of dye to the target drop. Wait for about 1 h and observe under microscope. The protein crystals will turn blue.</li>
	<li>Use the positive crystallization conditions (1.5 M ammonium sulfate, 0.1 M Tris pH 8.0) to further optimize the crystals using hanging drop vapor-diffusion method in 24-well plates.
	<ol>
		<li>Optimize pH from 7.0 to 8.5 with 0.5 pH unit interval every step. Optimize concentration of ammonium sulfate from 1.2 M to 1.7 M with 0.1 M interval every step. (In our case the best condition producing large plate-shaped crystals was 0.1 M HEPES pH 7.0 and 1.6 M ammonium sulfate)</li>
	</ol>
	</li>
</ol>
3. Crystal Mounting, X-Ray Data Collection, and Structure Determination
<ol>
	<li>Mount crystals in a cryoloop and flash-cool in liquid nitrogen using reservoir solution containing 20% glycerol as cryo-protectant. Place the crystals in unipuck for storage and transportation.</li>
	<li>Pre-screen protein crystals using a Rigaku in-house X-ray diffractor. Choose the best ones with the highest resolutions for data collection at synchrotron facilities (our dataset was collected from&#160;BL17U1 at Shanghai Synchrotron Radiation Facility).
	<ol>
		<li>Use the beamline control software BluIce26 to mount and center the crystals by automatic or manual centering function. Perform test exposures to determine the data collection strategy, including starting angle, exposure time, detector distance, frame width and numbers.</li>
		<li>Collect dataset accordingly (we collected 180 frames with 1 s exposure time, 1&#176; frame width and the detector distance of 350 mm).</li>
	</ol>
	</li>
	<li>Index, integrate and scale the dataset using HKL2000 suite27. First carry out the peak search function to find the diffraction spots, and then index the spots and select the right space group. After peak integration, scale the dataset with the proper error model and save the output .sca file.</li>
	<li>Solve the phase problem by molecular replacement using Phaser28 in PHENIX29.
	<ol>
		<li>Calculate the possible copy number of protein molecules in the asymmetric unit by Xtriage30.</li>
		<li>Look for the proper structure templates with high sequence identity and structural similarity as the target protein using known structures from literature or the models generated by structure prediction server such as Phyre231 (we used rabbit RyR1 NTD as a search model, PDB ID 2XOA).</li>
		<li>Run Phaser using the diffraction data file, the template structure file and the protein sequence file to find the solution.</li>
	</ol>
	</li>
	<li>Perform AutoBuild32 in PHENIX29 to generate the initial model using the output file from Phaser and the sequence file from the target protein.</li>
	<li>Manually build the structure into the modified experimental electron density using Coot33 and refine using phenix.refine34 in iterative cycles.</li>
	<li>Validate the final model using the validation tools in&#160;PHENIX18.</li>
</ol>

<ol>
	<li>Giannini, G., Sorrentino, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+structure+and+tissue+distribution+of+ryanodine+receptors+calcium+channels.">Molecular structure and tissue distribution of ryanodine receptors calcium channels.</a> Medicinal Research Reviews. 15 (4), 313-323 (1995).</li><li>Takeshima, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+a+gene+for+a+ryanodine+receptor/calcium+release+channel+in+Drosophila+melanogaster.">Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster.</a> FEBS Letters. 337 (1), 81-87 (1994).</li><li>Sattelle, D. B., Cordova, D., Cheek, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insect+ryanodine+receptors:+molecular+targets+for+novel+pest+control+chemicals.">Insect ryanodine receptors: molecular targets for novel pest control chemicals.</a> Invertebrate Neuroscience. 8 (3), 107-119 (2008).</li><li>Steinbach, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Geographic+spread,+genetics+and+functional+characteristics+of+ryanodine+receptor+based+target-site+resistance+to+diamide+insecticides+in+diamondback+moth,+Plutella+xylostella.">Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella.</a> Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).</li><li>Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterisation+of+field-evolved+resistance+to+chlorantraniliprole+in+the+diamondback+moth,+Plutella+xylostella,+from+China.">Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China.</a> Pest Management Science. 69 (5), 661-665 (2013).</li><li>Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resistance+Selection+and+Characterization+of+Chlorantraniliprole+Resistance+in+Plutella+xylostella+(Lepidoptera:+Plutellidae).">Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae).</a> Journal of Economic Entomology. 108 (4), 1978-1985 (2015).</li><li>Guo, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+a+point+mutation+in+the+ryanodine+receptor+of+Plutella+xylostella+(L.)+associated+with+resistance+to+chlorantraniliprole.">Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole.</a> Pest Management Science. 70 (7), 1083-1089 (2014).</li><li>Troczka, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resistance+to+diamide+insecticides+in+diamondback+moth,+Plutella+xylostella+(Lepidoptera:+Plutellidae)+is+associated+with+a+mutation+in+the+membrane-spanning+domain+of+the+ryanodine+receptor.">Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor.</a> Insect Biochemistry and Molecular Biology. 42 (11), 873-880 (2012).</li><li>Roditakis, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ryanodine+receptor+point+mutations+confer+diamide+insecticide+resistance+in+tomato+leafminer,+Tuta+absoluta+(Lepidoptera:+Gelechiidae).">Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae).</a> Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).</li><li>Borko, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+the+human+RyR2+N-terminal+region+involved+in+cardiac+arrhythmias.">Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias.</a> Acta Crystallographica Section D. 70 (Pt 11), 2897-2912 (2014).</li><li>Sharma, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+determination+of+the+phosphorylation+domain+of+the+ryanodine+receptor.">Structural determination of the phosphorylation domain of the ryanodine receptor.</a> FEBS Journal. 279 (20), 3952-3964 (2012).</li><li>Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disease+mutations+in+the+ryanodine+receptor+N-terminal+region+couple+to+a+mobile+intersubunit+interface.">Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface.</a> Nature Communications. 4, 1506 (2013).</li><li>Lau, K., Van Petegem, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structures+of+wild+type+and+disease+mutant+forms+of+the+ryanodine+receptor+SPRY2+domain.">Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain.</a> Nature Communications. 5, 5397 (2014).</li><li>Amador, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+type+I+ryanodine+receptor+amino-terminal+beta-trefoil+domain+reveals+a+disease-associated+mutation+&amp;#34;hot+spot&amp;#34;+loop.">Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation &amp;#34;hot spot&amp;#34; loop.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (27), 11040-11044 (2009).</li><li>Lobo, P. A., Van Petegem, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structures+of+the+N-terminal+domains+of+cardiac+and+skeletal+muscle+ryanodine+receptors:+insights+into+disease+mutations.">Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations.</a> Structure. 17 (11), 1505-1514 (2009).</li><li>des Georges, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+Basis+for+Gating+and+Activation+of+RyR1.">Structural Basis for Gating and Activation of RyR1.</a> Cell. 167 (1), 145-157 (2016).</li><li>Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+and+conformational+switch+mechanism+of+the+ryanodine+receptor.">Architecture and conformational switch mechanism of the ryanodine receptor.</a> Nature. 517 (7532), 39-43 (2015).</li><li>Peng, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+the+gating+mechanism+of+the+type+2+ryanodine+receptor+RyR2.">Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2.</a> Science. 354 (6310), (2016).</li><li>Wei, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+Ca2+-activated+long-range+allosteric+channel+gating+of+RyR1.">Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1.</a> Cell Research. 26 (9), 977-994 (2016).</li><li>Yan, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+the+rabbit+ryanodine+receptor+RyR1+at+near-atomic+resolution.">Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution.</a> Nature. 517 (7532), 50-55 (2015).</li><li>Zalk, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+a+mammalian+ryanodine+receptor.">Structure of a mammalian ryanodine receptor.</a> Nature. 517 (7532), 44-49 (2015).</li><li>Furlong, M. J., Wright, D. J., Dosdall, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diamondback+moth+ecology+and+management:+problems,+progress,+and+prospects.">Diamondback moth ecology and management: problems, progress, and prospects.</a> Annual Review of Entomology. 58, 517-541 (2013).</li><li>Amador, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+type+I+ryanodine+receptor+amino-terminal+beta-trefoil+domain+reveals+a+disease-associated+mutation+&amp;#34;hot+spot&amp;#34;+loop.">Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation &amp;#34;hot spot&amp;#34; loop.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (27), 11040-11044 (2009).</li><li>Lobo, P. A., Van Petegem, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+Structures+of+the+N-Terminal+Domains+of+Cardiac+and+Skeletal+Muscle+Ryanodine+Receptors:+Insights+into+Disease+Mutations.">Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations.</a> Structure. 17 (11), 1505-1514 (2009).</li><li>Aslanidis, C., de Jong, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligation-independent+cloning+of+PCR+products+(LIC-PCR).">Ligation-independent cloning of PCR products (LIC-PCR).</a> Nucleic Acids Research. 18 (20), 6069-6074 (1990).</li><li>Stepanov, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JBluIce-EPICS+control+system+for+macromolecular+crystallography.">JBluIce-EPICS control system for macromolecular crystallography.</a> Acta Crystallographica Section D. 67 (3), 176-188 (2011).</li><li>Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HKL-3000:+the+integration+of+data+reduction+and+structure+solution--from+diffraction+images+to+an+initial+model+in+minutes.">HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes.</a> Acta Crystallographica Section D. 62 (Pt 8), 859-866 (2006).</li><li>McCoy, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phaser+crystallographic+software.">Phaser crystallographic software.</a> Journal of Applied Crystallography. 40 (Pt 4), 658-674 (2007).</li><li>Adams, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PHENIX:+a+comprehensive+Python-based+system+for+macromolecular+structure+solution.">PHENIX: a comprehensive Python-based system for macromolecular structure solution.</a> Acta Crystallographica Section D. 66 (Pt 2), 213-221 (2010).</li><li>Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xtriage+and+Fest:+Automatic+assessment+of+X-ray+data+and+substructure+structure+factor+estimation.">Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation.</a> CCP4 Newsletter. (43), 27-35 (2005).</li><li>Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Phyre2+web+portal+for+protein+modeling,+prediction+and+analysis.">The Phyre2 web portal for protein modeling, prediction and analysis.</a> Nature Protocols. 10 (6), 845-858 (2015).</li><li>Terwilliger, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+model+building,+structure+refinement+and+density+modification+with+the+PHENIX+AutoBuild+wizard.">Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard.</a> Acta Crystallographica Section D. 64 (Pt 1), 61-69 (2008).</li><li>Emsley, P., Cowtan, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coot:+model-building+tools+for+molecular+graphics.">Coot: model-building tools for molecular graphics.</a> Acta Crystallographica Section D. 60, 2126-2132 (2004).</li><li>Afonine, P. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+automated+crystallographic+structure+refinement+with+phenix.refine.">Towards automated crystallographic structure refinement with phenix.refine.</a> Acta Crystallographica Section D. 68 (Pt 4), 352-367 (2012).</li><li>Lin, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+ryanodine+receptor+N-terminal+domain+from+Plutella+xylostella+reveals+two+potential+species-specific+insecticide-targeting+sites.">Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites.</a> Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).</li><li>Qi, S., Casida, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+chlorantraniliprole+and+flubendiamide+insecticide+binding+sites+in+the+ryanodine+receptor.">Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor.</a> Pesticide Biochemistry and Physiology. 107 (3), 321-326 (2013).</li></ol>

The authors have nothing to disclose.

In this paper, we describe the procedure to recombinantly express, purify, crystallize and determine the structure of DBM RyR NTD. For crystallization, a crucial requirement is to obtain proteins with high solubility, purity and homogeneity. In our protocol, we chose to use pET-28a-HMT vector as it contains a hexahistidine tag and MBP tag, both of which could be utilized for purification to obtain a higher fold purity. Additionally, the MBP tag aids in the solubility of the target protein. We purified the protein by five...

Ryanodine receptors (RyRs) are specific ion channels, which mediate the permeation of Ca2+ ions across the sarcoplasmic reticulum (SR) membranes in muscle cells. Therefore, they play an important role in the excitation contraction coupling process. In its functional form, RyR assembles as a homo-tetramer with a molecular mass of &#62;2 MDa, with each subunit comprising of ~5000 amino acid residues. In mammals, there are three isoforms: RyR1- skeletal muscle type, RyR2- cardiac muscle type and RyR3- ubiquitously expressed in different tissues1.
In insects there is only one type of RyR, which is expressed in muscular and nervous tissue2. Insect RyR is more similar to mammalian RyR2 with a sequence identity of about 47%3. Diamide insecticides targeting RyR of Lepidoptera and Coleoptera have been developed and marketed by major companies like Bayer (flubendiamide), DuPont (chlorantraniliprole) and Syngenta (cyantraniliprole). Since its relatively recent launch, diamide insecticides have become one of the fastest growing class of insecticides. Currently, the sales of these three insecticides annually have crossed 2 billion U.S. dollars with a growth rate of more than 50% since 2009 (Agranova).
Recent studies have reported the development of resistance in insects after a few generations of usage of these insecticides4,5,6,7,8. The resistance mutations in the transmembrane domain of RyRs from the diamondback moth (DBM), Plutella xylostella (G4946E, I4790M) and the corresponding positions in tomato leafminer, Tuta absoluta (G4903E, I4746M) show that the region might be involved in diamide insecticide binding as this region is known to be critical for gating of the channel4,8,9. Despite extensive research in this area, the exact molecular mechanisms of diamide insecticides remain elusive. Moreover, it is unclear whether the resistance mutations affect the interactions with diamides directly or allosterically.
Earlier studies have reported the structure of several RyR domains from mammalian species and the structure of full-length mammalian RyR1 and RyR2 by x-ray crystallography and cryo-electron microscopy, respectively10,11,12,13,14,15,16,17,18,19,20,21. But so far, no structure of insect RyR has been reported, which prohibits us from understanding the molecular intricacies of the receptor function as well as the molecular mechanisms of insecticide action and development of insecticide resistance.
In this manuscript, we present a generalized protocol for the structural characterization of N-terminal &#946;-trefoil domain of ryanodine receptor from the diamondback moth, a destructive pest infecting cruciferous crops worldwide22. The construct was designed according to the published rabbit RyR1 NTD crystal structures23,24and the cryo-EM structural models16,17,18,19,20,21. This is the first high-resolution structure reported for insect RyR, which reveals the mechanism for channel gating and provides an important template for the development of species-specific insecticides using structure-based drug design. For structure elucidation, we employed x-ray crystallography, which is considered as the &#39;gold standard&#39; for protein structure determination at near atomic resolution. Although the crystallization process is unpredictable and labor intensive, this step-by-step protocol will help researchers to express, purify and characterize other domains of insect RyR or any other proteins in general.

<table><tbody><tr><td>pET-28a-HMT vector</td><td></td><td></td><td>This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; BL21 (DE3) strain</td><td>Novagen</td><td>69450-3CN</td><td></td></tr><tr><td>HisTrapHP column (5 mL)</td><td>GE Healthcare</td><td>45-000-325</td><td></td></tr><tr><td>Amylose resin column</td><td>New England Biolabs</td><td>E8021S</td><td></td></tr><tr><td>Q Sepharose high-performance column&amp;nbsp;</td><td>GE Healthcare</td><td>17-1154-01</td><td></td></tr><tr><td>Amicon concentrators (10 kDa MWCO)</td><td>Millipore</td><td>UFC901008</td><td></td></tr><tr><td>Superdex 200 26/600 gel-filtration column&amp;nbsp;</td><td>GE Healthcare</td><td>28-9893-36</td><td></td></tr><tr><td>Automated liquid handling robotic system&amp;nbsp;</td><td>Art Robbins Instruments</td><td>Gryphon</td><td></td></tr><tr><td>96 Well CrystalQuick</td><td>Greiner bio-one</td><td>82050-494</td><td></td></tr><tr><td>Uni-Puck</td><td>Molecular Dimensions</td><td>MD7-601</td><td></td></tr><tr><td>Mounted CryoLoop - 20 micron</td><td>Hampton Research</td><td>HR4-955</td><td></td></tr><tr><td>CryoWand</td><td>Molecular Dimensions</td><td>MD7-411</td><td></td></tr><tr><td>Puck dewar loading tool</td><td>Molecular Dimensions</td><td>MD7-607</td><td></td></tr><tr><td>Nano drop</td><td>Thermo Scientific</td><td>NanoDrop One</td><td></td></tr><tr><td>Crystal incubator</td><td>Molecular Dimensions</td><td>MD5-605</td><td></td></tr><tr><td>X-Ray diffractor</td><td>Rigaku</td><td>FRX</td><td></td></tr><tr><td>PCR machine</td><td>Eppendorf</td><td>Nexus GX2</td><td></td></tr><tr><td>Plasmid mini-prep kit</td><td>Qiagen</td><td>27104</td><td></td></tr><tr><td>Gel extraction kit</td><td>Qiagen</td><td>28704</td><td></td></tr><tr><td>SspI restriction endonuclease</td><td>NEB</td><td>R0132S</td><td></td></tr><tr><td>T4 DNA polymerase</td><td>Novagen</td><td>2868713</td><td></td></tr><tr><td>Kanamycin</td><td>Scientific Chemical</td><td>25389940</td><td></td></tr><tr><td>IPTG</td><td>Genview</td><td>367931</td><td></td></tr><tr><td>HEPES</td><td>Genview</td><td>7365459</td><td></td></tr><tr><td>&amp;beta;-mercaptoethanol</td><td>Genview</td><td>60242</td><td></td></tr><tr><td>Centrifuge</td><td>Thermo Scientific</td><td>Sorvall LYNX 6000&amp;nbsp;</td><td></td></tr><tr><td>Sonnicator</td><td>Scientz</td><td>II-D</td><td></td></tr><tr><td>Protein purification system</td><td>GE Healthcare</td><td>Akta Pure</td><td></td></tr><tr><td>Light microscope</td><td>Nikon</td><td>SMZ745</td><td></td></tr><tr><td>IzIt crystal dye</td><td>Hampton Research</td><td>HR4-710</td><td></td></tr><tr><td>Electrophoresis unit</td><td>Bio-Rad</td><td>1658005EDU</td><td></td></tr><tr><td>Shaker Incubator</td><td>Zhicheng</td><td>ZWYR-D2401</td><td></td></tr><tr><td>Index crystal screen</td><td>Hampton Research</td><td>HR2-144</td><td></td></tr><tr><td>Structure crystal screen</td><td>Molecular Dimensions</td><td>MD1-01</td><td></td></tr><tr><td>ProPlex crystal screen</td><td>Molecular Dimensions</td><td>MD1-38</td><td></td></tr><tr><td>PACT premier crystal screen</td><td>Molecular Dimensions</td><td>MD1-29</td><td></td></tr><tr><td>JCSG-plus crystal screen</td><td>Molecular Dimensions</td><td>MD1-37</td><td></td></tr></tbody></table>

crystal structure of the n-terminal domain of ryanodine receptor from plutella xylostella

Development of potent and efficient insecticides targeting insect ryanodine receptors (RyRs) has been of great interest in the area of agricultural pest control. To date, several diamide insecticides targeting pest RyRs have been commercialized, which generate annual revenue of 2 billion U.S. dollars. But comprehension of the mode of action of RyR-targeting insecticides is limited by the lack of structural information regarding insect RyR. This in turn restricts understanding of the development of insecticide resistance in pests. The diamondback moth (DBM) is a devastating pest destroying cruciferous crops worldwide, which has also been reported to show resistance to diamide insecticides. Therefore, it is of great practical importance to develop novel insecticides targeting the DBM RyR, especially targeting a region different from the traditional diamide binding site. Here, we present a protocol to structurally characterize the N-terminal domain of RyR from DBM. The x-ray crystal structure was solved by molecular replacement at a resolution of 2.84 &#197;, which shows a beta-trefoil folding motif and a flanking alpha helix. This protocol can be adapted for the expression, purification and structural characterization of other domains or proteins in general.

Purification
The N-terminal domain of DBM RyR was expressed as a fusion protein with a hexahistidine tag, a MBP tag&#160;and a TEV protease cleavage site. We followed a five-step purification strategy to obtain a highly pure protein, suitable for crystallization purpose. At first, the fusion protein was purified from the soluble fraction of cell lysate by Ni-NTA column (HisTrap HP). Next, the fusion protein was subjected to TEV pro...

Watch this Scientific Journal Video about Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella at JoVE.com

Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella

In this article, we describe the protocols of protein expression, purification, crystallization and structure determination of the N-terminal domain of&#160;ryanodine receptor from diamondback moth (Plutella xylostella).

Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella

Development of potent and efficient insecticides targeting insect ryanodine receptors (RyRs) has been of great interest in the area of agricultural pest ...

crystal-structure-n-terminal-domain-ryanodine-receptor-from-plutella

Research

JoVE Journal

Biochemistry

7.4K Views.  Tianjin University. Het oplossen van de structuur van de ryanodine receptor domein kan helpen met ons begrip van het moleculaire mechanisme van de eiwitfunctie, insecticide actie, en insecticide resistentie ontwikkeling. Deze maatregel impliceert het gebruik van röntgenkristallografie voor structuurillustratie, die wordt beschouwd als een gouden standaard voor de bepaling van de eiwitstructuur bij bijna-atoomresolutie. Deze hoge resolutie structuur van het insect ryanodine receptor domein onthult het mechanisme...

Video: Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella

Preparation and Delivery of Protein Microcrystals in Lipidic Cubic Phase for Serial Femtosecond Crystallography

Membrane proteins (MPs) are essential components of cellular membranes and primary drug targets. Rational drug design relies on precise structural information, typically obtained by crystallography; however MPs are difficult to crystallize. Recent progress in MP structural determination has benefited greatly from the development of lipidic cubic phase (LCP) crystallization methods, which typically yield well-diffracting, but often small crystals that suffer from radiation damage during traditional crystallographic data collection at synchrotron sources. The development of new-generation X-ray free-electron laser (XFEL) sources that produce extremely bright femtosecond pulses has enabled room temperature data collection from microcrystals with no or negligible radiation damage. Our recent efforts in combining LCP technology with serial femtosecond crystallography (LCP-SFX) have resulted in high-resolution structures of several human G protein-coupled receptors, which represent a notoriously difficult target for structure determination. In the LCP-SFX technique, LCP is recruited as a matrix for both growth and delivery of MP microcrystals to the intersection of the injector stream with an XFEL beam for crystallographic data collection. It has been demonstrated that LCP-SFX can substantially improve the diffraction resolution when only sub-10 &#181;m crystals are available, or when the use of smaller crystals at room temperature can overcome various problems associated with larger cryocooled crystals, such as accumulation of defects, high mosaicity and cryocooling artifacts. Future advancements in X-ray sources and detector technologies should make serial crystallography highly attractive and practicable for implementation not only at XFELs, but also at more accessible synchrotron beamlines. Here we present detailed visual protocols for the preparation, characterization and delivery of microcrystals in LCP for serial crystallography experiments. These protocols include methods for conducting crystallization experiments in syringes, detecting and characterizing the crystal samples, optimizing crystal density, loading microcrystal laden LCP into the injector device and delivering the sample to the beam for data collection.

We describe procedures for the preparation and delivery of membrane protein microcrystals in lipidic cubic phase for serial crystallography at X-ray free-electron lasers and synchrotron sources. These protocols can also be applied for incorporation and delivery of soluble protein microcrystals, leading to substantially reduced sample consumption compared to liquid injection.

Membrane proteins (MPs) are essential components of cellular membranes and primary drug targets. Rational drug design relies on precise structural ...

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a target for future development of inhibitors to decrease the virulence of the pathogen. To perform biophysical and structural characterization as well as inhibitor screening, large amounts of pure and active protein will be needed. We have developed a protocol for efficient production and purification of PPEP-1 by the use of E. coli as the expression host yielding sufficient amounts and purity of protein for crystallization and structure determination. Additionally, using microseeding, highly intergrown crystals of PPEP-1 can be grown to well-ordered crystals suitable for X-ray diffraction analysis. The methods could also be used to produce other recombinant proteins and to study the structures of other proteins producing intergrown crystals.

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Proline-proline endopeptidase-1 (PPEP-1) is a secreted metalloprotease and promising drug-target from the human pathogen Clostridium difficile. Here we describe all methods necessary for the production and structure determination of this protein.

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

From Constructs to Crystals &#8211; Towards Structure Determination of &#946;-barrel Outer Membrane Proteins

Membrane proteins serve important functions in cells such as nutrient transport, motility, signaling, survival and virulence, yet constitute only ~1% percent of known structures. There are two types of membrane proteins, &#945;-helical and &#946;-barrel. While &#945;-helical membrane proteins can be found in nearly all cellular membranes, &#946;-barrel membrane proteins can only be found in the outer membranes of mitochondria, chloroplasts, and Gram-negative bacteria. One common bottleneck in structural studies of membrane proteins in general is getting enough pure sample for analysis. In hopes of assisting those interested in solving the structure of their favorite &#946;-barrel outer membrane protein (OMP), general protocols are presented for the production of target &#946;-barrel OMPs at levels useful for structure determination by either X-ray crystallography and/or NMR spectroscopy. Here, we outline construct design for both native expression and for expression into inclusion bodies, purification using an affinity tag, and crystallization using detergent screening, bicelle, and lipidic cubic phase techniques. These protocols have been tested and found to work for most OMPs from Gram-negative bacteria; however, there are some targets, particularly for mitochondria and chloroplasts that may require other methods for expression and purification. As such, the methods here should be applicable for most projects that involve OMPs from Gram-negative bacteria, yet the expression levels and amount of purified sample will vary depending on the target OMP.

&#946;-barrel outer membrane proteins (OMPs) serve many functions within the outer membranes of Gram-negative bacteria, mitochondria, and chloroplasts. Here, we hope to alleviate a known bottleneck in structural studies by presenting protocols for the production of &#946;-barrel OMPs in sufficient quantities for structure determination by X-ray crystallography or NMR spectroscopy.

Membrane proteins serve important functions in cells such as nutrient transport, motility, signaling, survival and virulence, yet constitute only ~1% ...

Chemistry

Analysis of Tubular Membrane Networks in Cardiac Myocytes from Atria and Ventricles

In cardiac myocytes a complex network of membrane tubules - the transverse-axial tubule system (TATS) - controls deep intracellular signaling functions. While the outer surface membrane and associated TATS membrane components appear to be continuous, there are substantial differences in lipid and protein content. In ventricular myocytes (VMs), certain TATS components are highly abundant contributing to rectilinear tubule networks and regular branching 3D architectures. It is thought that peripheral TATS components propagate action potentials from the cell surface to thousands of remote intracellular sarcoendoplasmic reticulum (SER) membrane contact domains, thereby activating intracellular Ca2+ release units (CRUs). In contrast to VMs, the organization and functional role of TATS membranes in atrial myocytes (AMs) is significantly different and much less understood. Taken together, quantitative structural characterization of TATS membrane networks in healthy and diseased myocytes is an essential prerequisite towards better understanding of functional plasticity and pathophysiological reorganization. Here, we present a strategic combination of protocols for direct quantitative analysis of TATS membrane networks in living VMs and AMs. For this, we accompany primary cell isolations of mouse VMs and/or AMs with critical quality control steps and direct membrane staining protocols for fluorescence imaging of TATS membranes. Using an optimized workflow for confocal or superresolution TATS image processing, binarized and skeletonized data are generated for quantitative analysis of the TATS network and its components. Unlike previously published indirect regional aggregate image analysis strategies, our protocols enable direct characterization of specific components and derive complex physiological properties of TATS membrane networks in living myocytes with high throughput and open access software tools. In summary, the combined protocol strategy can be readily applied for quantitative TATS network studies during physiological myocyte adaptation or disease changes, comparison of different cardiac or skeletal muscle cell types, phenotyping of transgenic models, and pharmacological or therapeutic interventions.

In cardiac myocytes, tubular membrane structures form intracellular networks. We describe optimized protocols for i) isolation of myocytes from mouse heart including quality control, ii) live cell staining for state-of-the-art fluorescence microscopy, and iii) direct image analysis to quantify the component complexity and the plasticity of intracellular membrane networks.

In cardiac myocytes a complex network of membrane tubules - the transverse-axial tubule system (TATS) - controls deep intracellular signaling functions. ...

Bioengineering

Production, Crystallization, and Structure Determination of the IKK-binding Domain of NEMO

NEMO is a scaffolding protein which plays an essential role in the NF-&#954;B pathway by assembling the IKK-complex with the kinases IKK&#945; and IKK&#946;. Upon activation, the IKK complex phosphorylates the I&#954;B molecules leading to NF-&#954;B nuclear translocation and activation of target genes. Inhibition of the NEMO/IKK interaction is an attractive therapeutic paradigm for the modulation of NF-&#954;B pathway activity, making NEMO a target for inhibitors design and discovery. To facilitate the process of discovery and optimization of NEMO inhibitors, we engineered an improved construct of the IKK-binding domain of NEMO that would allow for structure determination of the protein in the apo form and while bound to small molecular weight inhibitors. Here, we present the strategy utilized for the design, expression and structural characterization of the IKK-binding domain of NEMO. The protein is expressed in E. coli cells, solubilized under denaturing conditions and purified through three chromatographic steps. We discuss the protocols for obtaining crystals for structure determination and describe data acquisition and analysis strategies. The protocols will find wide applicability to the structure determination of complexes of NEMO and small molecule inhibitors.

We describe protocols for the structure determination of the IKK-binding domain of NEMO by X-ray crystallography. The methods include protein expression, purification and characterization as well as strategies for successful crystal optimization and structure determination of the protein in its unbound form.

NEMO is a scaffolding protein which plays an essential role in the NF-&#954;B pathway by assembling the IKK-complex with the kinases IKK&#945; and ...

X-Ray Crystallography to Study the Oligomeric State Transition of the Thermotoga maritima M42 Aminopeptidase TmPep1050

The M42 aminopeptidases form functionally active complexes made of 12 subunits. Their assembly process appears to be regulated by their metal ion cofactors triggering a dimer-dodecamer transition. Upon metal ion binding, several structural modifications occur in the active site and at the interaction interface, shaping dimers to promote the self-assembly. To observe such modifications, stable oligomers must be isolated prior to structural study. Reported here is a method that allows the purification of stable dodecamers and dimers of TmPep1050, an M42 aminopeptidase of T. maritima, and their structure determination by X-ray crystallography. Dimers were prepared from dodecamers by removing metal ions with a chelating agent. Without their&#160;cofactor, dodecamers became less stable and were fully dissociated upon heating. The oligomeric structures were solved by the straightforward molecular replacement approach. To illustrate the methodology, the structure of a TmPep1050 variant, totally impaired in metal ion binding, is presented showing no further breakdown of dimers to monomers.

X-Ray Crystallography to Study the Oligomeric State Transition of the Thermotoga maritima M42 Aminopeptidase TmPep1050

This protocol has been developed to study the dimer-dodecamer transition of TmPep1050, an M42 aminopeptidase, at the structural level. It is a straightforward pipeline starting from protein purification to X-ray data processing. Crystallogenesis, data set indexation, and molecular replacement have been emphasized through a case of study, TmPep1050H60A H307A variant.

The M42 aminopeptidases form functionally active complexes made of 12 subunits. Their assembly process appears to be regulated by their metal ion ...

Modeling Small Molecule Ligands in CryoEM Maps of Macromolecules

Modeling Ligands into Maps Derived from Electron Cryomicroscopy

Deciphering the protein-ligand interactions in a macromolecular complex is crucial for understanding the molecular mechanism, underlying biological processes, and drug development. In recent years, cryogenic sample electron microscopy (cryoEM) has emerged as a powerful technique to determine the structures of macromolecules and to investigate the mode of ligand binding at near-atomic resolution. Identifying and modeling non-protein molecules in cryoEM maps is often challenging due to anisotropic resolution across the molecule of interest and inherent noise in the data. In this article, the readers are introduced to various software and methods currently used for ligand identification, model building, and refinement of atomic coordinates using selected macromolecules. One of the simplest ways to identify the presence of a ligand, as illustrated with the enolase enzyme, is to subtract the two maps obtained with and without the ligand. The extra density of the ligand is likely to stand out in the difference map even at a higher threshold. There are instances, as shown in the case of metabotropic Glutamate receptor mGlu5, when such simple difference maps cannot be generated. The recently introduced method of deriving the Fo-Fc omit map can serve as a tool for validating and demonstrating the presence of the ligand. Finally, using the well-studied &#946;-galactosidase as an example, the effect of resolution on modeling the ligands and solvent molecules in cryoEM maps is analyzed, and an outlook on how cryoEM can be used in drug discovery is presented.

Author Spotlight: Exploring Cellular Processes by Modeling Ligands in Cryo-EM Maps

This protocol introduces the tools available for modeling small-molecule ligands in cryoEM maps of macromolecules.

Deciphering the protein-ligand interactions in a macromolecular complex is crucial for understanding the molecular mechanism, underlying biological ...

Harvesting and Cryo-cooling Crystals of Membrane Proteins Grown in Lipidic Mesophases for Structure Determination by Macromolecular Crystallography

An important route to understanding how proteins function at a mechanistic level is to have the structure of the target protein available, ideally at atomic resolution. Presently, there is only one way to capture such information as applied to integral membrane proteins (Figure 1), and the complexes they form, and that method is macromolecular X-ray crystallography (MX). To do MX diffraction quality crystals are needed which, in the case of membrane proteins, do not form readily. A method for crystallizing membrane proteins that involves the use of lipidic mesophases, specifically the cubic and sponge phases1-5, has gained considerable attention of late due to the successes it has had in the G protein-coupled receptor field6-21 (<a href="http://www.mpdb.tcd.ie" target="_blank">www.mpdb.tcd.ie</a>). However, the method, henceforth referred to as the in meso or lipidic cubic phase method, comes with its own technical challenges. These arise, in part, due to the generally viscous and sticky nature of the lipidic mesophase in which the crystals, which are often micro-crystals, grow. Manipulating crystals becomes difficult as a result and particularly so during harvesting22,23. Problems arise too at the step that precedes harvesting which requires that the glass sandwich plates in which the crystals grow (Figure 2)24,25 are opened to expose the mesophase bolus, and the crystals therein, for harvesting, cryo-cooling and eventual X-ray diffraction data collection.
The cubic and sponge mesophase variants (Figure 3) from which crystals must be harvested have profoundly different rheologies4,26. The cubic phase is viscous and sticky akin to a thick toothpaste. By contrast, the sponge phase is more fluid with a distinct tendency to flow. Accordingly, different approaches for opening crystallization wells containing crystals growing in the cubic and the sponge phase are called for as indeed different methods are required for harvesting crystals from the two mesophase types. Protocols for doing just that have been refined and implemented in the Membrane Structural and Functional Biology (MS&amp;FB) Group, and are described in detail in this JoVE article (Figure 4). Examples are given of situations where crystals are successfully harvested and cryo-cooled. We also provide examples of cases where problems arise that lead to the irretrievable loss of crystals and describe how these problems can be avoided. In this article the Viewer is provided with step-by-step instructions for opening glass sandwich crystallization wells, for harvesting and for cryo-cooling crystals of membrane proteins growing in cubic and in sponge phases.

Herein is described procedures implemented in the Caffrey Membrane Structural and Functional Biology Group to harvest and cryo-cool membrane protein crystals grown in lipidic cubic and sponge phases for use in structure determination using macromolecular X-ray crystallography.

An important route to understanding how proteins function at a mechanistic level is to have the structure of the target protein available, ideally at ...

Biology

Do's and Don'ts of Cryo-electron Microscopy: A Primer on Sample Preparation and High Quality Data Collection for Macromolecular 3D Reconstruction

Cryo-electron microscopy (cryoEM) entails flash-freezing a thin layer of sample on a support, and then visualizing the sample in its frozen hydrated state by transmission electron microscopy (TEM). This can be achieved with very low quantity of protein and in the buffer of choice, without the use of any stain, which is very useful to determine structure-function correlations of macromolecules. When combined with single-particle image processing, the technique has found widespread usefulness for 3D structural determination of purified macromolecules. 
The protocol presented here explains how to perform cryoEM and examines the causes of most commonly encountered problems for rational troubleshooting; following all these steps should lead to acquisition of high quality cryoEM images. The technique requires access to the electron microscope instrument and to a vitrification device. Knowledge of the 3D reconstruction concepts and software is also needed for computerized image processing. Importantly, high quality results depend on finding the right purification conditions leading to a uniform population of structurally intact macromolecules. 
The ability of cryoEM to visualize macromolecules combined with the versatility of single particle image processing has proven very successful for structural determination of large proteins and macromolecular machines in their near-native state, identification of their multiple components by 3D difference mapping, and creation of pseudo-atomic structures by docking of x-ray structures. The relentless development of cryoEM instrumentation and image processing techniques for the last 30 years has resulted in the possibility to generate de novo 3D reconstructions at atomic resolution level.

This paper describes the cryo-electron microscopy methodology, which is used to obtain high quality microscopic images of macromolecules in their near-native state. The method yields images suitable for further computerized processing using the single particle approach, devised to generate the 3D reconstruction of a macromolecule.

Cryo-electron microscopy (cryoEM) entails flash-freezing a thin layer of sample on a support, and then visualizing the sample in its frozen hydrated state ...

Production of Human Norovirus Protruding Domains in E. coli for X-ray Crystallography

The norovirus capsid is composed of a single major structural protein, termed VP1. VP1 is subdivided into a shell (S) domain and a protruding (P) domain. The S domain forms a contiguous scaffold around the viral RNA, whereas the P domain forms viral spikes on the S domain and contains determinants for antigenicity and host-cell interactions. The P domain binds carbohydrate structures, i.e., histo-blood group antigens, which are thought to be important for norovirus infections. In this protocol, we describe a method for producing high quality norovirus P domains in high yields. These proteins can then be used for X-ray crystallography and ELISA in order to study antigenicity and host-cell interactions.
The P domain is firstly cloned into an expression vector and then expressed in bacteria. The protein is purified using three steps that involve immobilized metal-ion affinity chromatography and size exclusion chromatography. In principle, it is possible to clone, express, purify, and crystallize proteins in less than four weeks, which makes this protocol a rapid system for analyzing newly emerging norovirus strains.

Production of Human Norovirus Protruding Domains in E. coli for X-ray Crystallography

Here, we describe a method to express and purify high quality norovirus protruding (P) domains in E. coli for use in X-ray crystallography studies. This method can be applied to other calicivirus P domains, as well as non-structural proteins, i.e., viral protein genome-linked (VPg), protease, and RNA dependent RNA polymerase (RdRp).

The norovirus capsid is composed of a single major structural protein, termed VP1. VP1 is subdivided into a shell (S) domain and a protruding (P) domain. ...

Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video