This project received funding from the European Union&#8217;s Horizon 2020 research and innovation programme under grant agreement no. 686070 (DD-DeCaf) and 764591 (SynCrop), and from the research programme Building Blocks of Life with project number 737.016.005 by the Netherlands Organisation for Scientific Research (NWO). T.E.G. was supported by the Royal Society (grant UF160357) and BrisSynBio, a&#160;BBSRC/EPSRC Synthetic Biology Research Centre (grant BB/L01386X/1). We thank Zi Di and Jeffrey van Wijk for their contribution to the yeast spotting experiments for creating the yeast pixel art.&#160;

<ol>
	<li>Knott, G. J., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas+guides+the+future+of+genetic+engineering.">CRISPR-Cas guides the future of genetic engineering.</a> Science. 361 (6405), 866-869 (2018).</li><li>DiCarlo, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+in+Saccharomyces+cerevisiae+using+CRISPR-Cas+systems.">Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems.</a> Nucleic Acids Research. 41 (7), 4336-4343 (2013).</li><li>Gilbert, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+modular+RNA-guided+regulation+of+transcription+in+eukaryotes.">CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes.</a> Cell. 154 (2), 442-451 (2013).</li><li>Lian, J., HamediRad, M., Hu, S., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+metabolic+engineering+using+an+orthogonal+tri-functional+CRISPR+system.">Combinatorial metabolic engineering using an orthogonal tri-functional CRISPR system.</a> Nature Communications. 8 (1), 1688 (2017).</li><li>Li, Z. -. H., Liu, M., Lyu, X. -. M., Wang, F. -. Q., Wei, D. -. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cpf1+facilitated+large+fragment+deletion+in+Saccharomyces+cerevisiae.">CRISPR/Cpf1 facilitated large fragment deletion in Saccharomyces cerevisiae.</a> Journal of Basic Microbiology. 58 (12), 1100-1104 (2018).</li><li>Shao, Y., Lu, N., Qin, Z., Xue, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+facilitated+multiple-chromosome+fusion+in+Saccharomyces+cerevisiae.">CRISPR-Cas9 facilitated multiple-chromosome fusion in Saccharomyces cerevisiae.</a> ACS Synthetic Biology. 7 (11), 2706-2708 (2018).</li><li>Brouns, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+CRISPR+RNAs+guide+antiviral+defense+in+prokaryotes.">Small CRISPR RNAs guide antiviral defense in prokaryotes.</a> Science. 321 (5891), 960-964 (2008).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Abudayyeh, O. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C2c2+is+a+single-component+programmable+RNA-guided+RNA-targeting+CRISPR+effector.">C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector.</a> Science. 353 (6299), (2016).</li><li>Makarova, K. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+updated+evolutionary+classification+of+CRISPR-Cas+systems.">An updated evolutionary classification of CRISPR-Cas systems.</a> Nature Reviews Microbiology. 13 (11), 722-736 (2015).</li><li>Mohanraju, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+evolutionary+roots+and+mechanistic+variations+of+the+CRISPR-Cas+systems.">Diverse evolutionary roots and mechanistic variations of the CRISPR-Cas systems.</a> Science. 353 (6299), (2016).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Fonfara, I., Richter, H., Bratovi&#269;, M., Le Rhun, A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR-associated+DNA-cleaving+enzyme+Cpf1+also+processes+precursor+CRISPR+RNA.">The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA.</a> Nature. 532 (7600), 517-521 (2016).</li><li>Lian, J., HamediRad, M., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advancing+metabolic+engineering+of+Saccharomyces+cerevisiae.+using+the+CRISPR/Cas+System.">Advancing metabolic engineering of Saccharomyces cerevisiae. using the CRISPR/Cas System.</a> Biotechnology Journal. 13 (9), 1700601 (2018).</li><li>Ferreira, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+CRISPR/Cas9+genome+editing+and+gene+regulation+using+Csy4+in+Saccharomyces+cerevisiae.">Multiplexed CRISPR/Cas9 genome editing and gene regulation using Csy4 in Saccharomyces cerevisiae.</a> ACS Synthetic Biology. 7 (1), 10-15 (2018).</li><li>Swarts, D. C., Martin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas9+versus+Cas12a/Cpf1:+Structure&#8211;function+comparisons+and+implications+for+genome+editing.">Cas9 versus Cas12a/Cpf1: Structure&#8211;function comparisons and implications for genome editing.</a> Wiley Interdisciplinary Reviews: RNA. 9 (5), 1481 (2018).</li><li>Strohkendl, I., Saifuddin, F. A., Rybarski, J. R., Finkelstein, I. J., Russell, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetic+Basis+for+DNA+Target+Specificity+of+CRISPR-Cas12a.">Kinetic Basis for DNA Target Specificity of CRISPR-Cas12a.</a> Molecular Cell. 71 (5), 816-824 (2018).</li><li>Verwaal, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-level+production+of+beta-carotene+in+Saccharomyces+cerevisiae.+by+successive+transformation+with+carotenogenic+genes+from+Xanthophyllomyces+dendrorhous.">High-level production of beta-carotene in Saccharomyces cerevisiae. by successive transformation with carotenogenic genes from Xanthophyllomyces dendrorhous.</a> Applied and Environmental Microbiology. 73 (13), 4342-4350 (2007).</li><li>Verwaal, R., Buiting-Wiessenhaan, N., Dalhuijsen, S., Roubos, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cpf1+enables+fast+and+simple+genome+editing+of+Saccharomyces+cerevisiae.">CRISPR/Cpf1 enables fast and simple genome editing of Saccharomyces cerevisiae.</a> Yeast. 35 (2), 201-211 (2018).</li><li>Jakociunas, T., Jensen, M. K., Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+advances+engineering+of+microbial+cell+factories.">CRISPR/Cas9 advances engineering of microbial cell factories.</a> Metabolic Engineering. 34, 44-59 (2016).</li><li>Engler, C., Romy, K., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method+with+high+throughput+capability.">A one pot, one step, precision cloning method with high throughput capability.</a> PloS One. 3 (11), 3647 (2008).</li><li>Franklin, R. E., Gosling, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+configuration+in+sodium+thymonucleate.">Molecular configuration in sodium thymonucleate.</a> Nature. 171, 740-741 (1953).</li><li>Watson, J. D., Crick, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+structure+for+deoxyribose+nucleic+acid.">A structure for deoxyribose nucleic acid.</a> Nature. 171, 737-738 (1953).</li><li>Wilkins, M. H. F., Stokes, A. R., Wilson, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+structure+of+deoxypentose+nucleic+acids.">Molecular structure of deoxypentose nucleic acids.</a> Nature. 171, 738-740 (1953).</li><li>Young, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+algorithm-guided+design+of+massive+strain+libraries,+applied+to+itaconic+acid+production+in+yeast.">Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast.</a> Metabolic Engineering. 48, 33-43 (2018).</li><li>Roubos, J. A., Pel, H. J., Meijrink, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Cloning Method. , (2013).</li><li>Mandel, M., Higa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium-dependent+bacteriophage+DNA+infection.">Calcium-dependent bacteriophage DNA infection.</a> Journal of Molecular Biology. 53 (1), 159-162 (1970).</li><li>Van Dijken, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+interlaboratory+comparison+of+physiological+and+genetic+properties+of+four+Saccharomyces+cerevisiae+strains.">An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains.</a> Enzyme and Microbial Technology. 26 (9-10), 706-714 (2000).</li><li>Gietz, R. D., Schiestl, R. H., Willems, A. R., Woods, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+transformation+of+intact+yeast+cells+by+the+LiAc/SS-DNA/PEG+procedure.">Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure.</a> Yeast. 11 (4), 355-360 (1995).</li><li>Hill, J., Donald, K. A., Griffiths, D. E., Donald, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DMSO-enhanced+whole+cell+yeast+transformation.">DMSO-enhanced whole cell yeast transformation.</a> Acids Research. 19 (20), 5791 (1991).</li><li>Looke, M., Kristjuhan, K., Kristjuhan, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+genomic+DNA+from+yeasts+for+PCR-based+applications.">Extraction of genomic DNA from yeasts for PCR-based applications.</a> Biotechniques. 50 (5), 325-328 (2011).</li><li>Tak, Y. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+and+multiplex+gene+regulation+using+CRISPR-Cpf1-based+transcription+factors.">Inducible and multiplex gene regulation using CRISPR-Cpf1-based transcription factors.</a> Nature Methods. 14 (12), 1163-1166 (2017).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+gene+editing+by+CRISPR-Cpf1+using+a+single+crRNA+array.">Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array.</a> Nature biotechnology. 35 (1), 31-34 (2017).</li><li>Swiat, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FnCpf1:+a+novel+and+efficient+genome+editing+tool+for+Saccharomyces+cerevisiae.">FnCpf1: a novel and efficient genome editing tool for Saccharomyces cerevisiae.</a> Nucleic Acids Research. 45 (21), 12585-12598 (2017).</li><li>Li, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cpf1-Assisted+Multiplex+Genome+Editing+and+Transcriptional+Repression+in+Streptomyces.">CRISPR-Cpf1-Assisted Multiplex Genome Editing and Transcriptional Repression in Streptomyces.</a> Applied Environmental Microbiology. 84 (18), 00827-00918 (2018).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+gene+regulation+by+CRISPR-ddCpf1.">Multiplex gene regulation by CRISPR-ddCpf1.</a> Cell Discovery. 3, 17018 (2017).</li><li>Gietz, R. D., Schiestl, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Frozen+competent+yeast+cells+that+can+be+transformed+with+high+efficiency+using+the+LiAc/SS+carrier+DNA/PEG+method.">Frozen competent yeast cells that can be transformed with high efficiency using the LiAc/SS carrier DNA/PEG method.</a> Nature Protocols. 2 (1), 1-4 (2007).</li><li>Perez, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GuideScan+software+for+improved+single+and+paired+CRISPR+guide+RNA+design.">GuideScan software for improved single and paired CRISPR guide RNA design.</a> Nature Biotechnology. 35 (4), 347-349 (2017).</li><li>Cox, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+Biology+Open+Language+Visual+(SBOL+Visual)+Version+2.0.">Synthetic Biology Open Language Visual (SBOL Visual) Version 2.0.</a> Journal of Integrative Bioinformatics. 15 (1), 1613-4516 (2018).</li></ol>

The authors declare that there is a conflict of interest. The authors have filed IP related to presented methods.

The provided protocol describes multiplex genome editing of S. cerevisiae using Cas12a from Lachnospiraceae bacterium ND2006 in combination with a single crRNA array and donor DNA. Design of the single crRNA array and donor DNA is explained in detail. In contrast to the well-established CRISPR/Cas9 system, the CRISPR/Cas12a has the unique additional ability of processing multiple crRNAs expressed from a single crRNA array13,33. Due to this feature, simultaneous editing of multiple targets is easier to set up and can be achieved in a single transformation. This single crRNA array approach was demonstrated before by Zetsche et al.34 who simultaneously edited up to four genes in mammalian cells using AsCas12a, and by Swiat et al.35 who introduced four DNA fragments into a yeast genome using FnCas12a. To our knowledge, a higher number of simultaneous genomic modifications using a Cas12a system has not been reported and the maximal limit of targets per single array for Cas12a is yet to be determined. Further research utilizing single crRNA arrays in combination with Cas12a includes multiplex transcriptional regulation in a wide range of organisms33,36,37.
There are some critical steps in the presented protocol. Carefully design all DNA sequences that are involved in the Cas12a genome editing experiment, especially in case when novel DNA sequences are introduced. Determine the functionality of new spacer sequences part of a crRNA, for example by a singleplex genome editing experiment as described by Verwaal et al.19 before combining them into a single crRNA array. Follow the recommendations for the preparation of transformation buffer solutions used in the Cas12a editing experiment to achieve a good transformation efficiency of yeast.
There are some optional modifications of the technique. It is recommended to use 1 &#181;g of each donor DNA, linearized pRN1120 or single crRNA array expression cassette in the transformation, although the use of a lower DNA amount is also expected to result in a satisfactory transformation efficiency. Perform a test transformation to determine whether lower DNA amounts can be used. The transformation of S. cerevisiae might be performed using a different method than the one described in this protocol, for example the protocol described by Gietz et al. (2007)38. The guide RNA recipient plasmid pRN1120 is suitable for the expression of a single crRNA and single crRNA array of different Cas12a variants (e.g., from Acidaminococcus spp. BV3L6 or Francisella novicida U112) as well as for expression of sgRNA in combination with Cas919. The donor DNA does not need to be limited to carotenoid gene expression cassettes and flanking regions that target donor DNA to the described INT1, INT2 and INT3 sites in genomic DNA. Any DNA of interest can be introduced, in a multiplex manner, into genomic DNA of the host by the design principles described in this protocol, or alternatively donor DNA can be used to delete DNA from a host genome. The modular structure of single crRNA array facilitates easy adjustment of spacer and direct repeat sequences. Modification of spacer sequences allows for a change of the intended integration locus which can be designed by one of the tools for identification of a genomic target site, e.g. GuideScan software 1.039. Instead of using large flanking sequences that contain connectors sequences, 50-bp of the flanking region can be included in the donor DNA sequences by incorporating these 50-bp flanking region sequences in the primers used in the PCR. In this case, in total just three instead of nine donor DNA fragments are required for a successful multiplex genome editing experiment.
In summary, this protocol provides step-by-step directions to perform multiplex genome editing in S.&#160;cerevisiae using Cas12a in combination with a single crRNA array approach. The protocol was demonstrated by multiplex genome editing using 9 donor DNA fragments and single crRNA array coding for three gRNAs. We show high overall editing frequencies between 50% and 94% for the three strain designs reported here. Concluding, the unique feature of Cas12a is the ability to process a single crRNA array into individual crRNAs in a cell, which makes Cas12a an excellent tool to enable multiplex genome editing and develop transcriptional regulation modules targeting multiple expression cassettes in one go. In the end, three strains were obtained producing carotenoids at a different level and colors in shades between yellow and orange. With those strains and a wild-type strain, we showed how an acoustic liquid handler can be used straightforwardly to make yeast pixel art &#8211; this in honor of Rosalind Franklin who contributed to the discovery of the DNA structure 65 years ago by her famous photo 5123.

CRISPR/Cas enzymes have unquestionably revolutionized molecular biology and been widely adopted as tools for engineering genomes at a speed that was previously unfeasible1. The first modification of a&#160;Saccharomyces cerevisiae genome by the CRISPR/Cas9 genome editing system was reported by DiCarlo et al.2, demonstrating successful gene knock-out and making point mutations using externally introduced oligonucleotides. Further yeast CRISPR toolbox developments included: transcriptional regulation by fusion of catalytically inactive dead Cas9 (dCas9) with transcriptional effector domains to enable activation and silencing of transcription3, application for both genome editing and regulatory functions for metabolic pathway engineering by simultaneous activation, repression and deletion4, deletion of large fragments from the S. cerevisiae genome5, and multiple-chromosome fusions6.
CRISPR/Cas genome editing systems find their origin in adaptive immune systems of bacteria and archaea and these systems have been adapted by molecular biologists for genome editing. Their functionality is based on the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) DNA regions encoding RNA responsible for the recognition of the foreign DNA or RNA and the CRISPR associated genes (Cas) which encodes RNA-guided endonucleases1,7,8,9. Based on the recent genome analysis of CRISPR/Cas systems it was proposed to divide the CRISPR/Cas systems into two classes, five types and 16 subtypes10. The two classes are distinguished based on the organization of effector complexes involved in target cleavage. Typically, CRISPR/Cas systems with a multi-subunit organisation are categorized as class 1, whereas single subunit effector complexes belong to class 210,11. In this paper, we explore the class 2 type V Cas12a, formerly called Cpf110,12, which is an alternative to the class 2 type II Cas9. Although Cas9 is well-characterized and widely used in research, Cas12a offers additional features12. Firstly, Cas12a forms a&#160;complex with CRISPR RNA (crRNA) of 42 to 44 nucleotides without requiring an additional trans-activating CRISPR RNA (tracrRNA). Therefore, a shorter guide RNA can be utilized in genome editing with CRISPR/Cas12a systems compared to CRISPR/Cas9. Secondly, the unique endonuclease and endoribonuclease activity of Cas12a enables maturation of its pre-crRNA13. This RNase activity allows for the encoding of multiple crRNAs on a single CRISPR crRNA array, whereas Cas9 requires the separate expression of each so-called single-guide RNA&#160;(sgRNA) or alternatively for example expression of an additional endonuclease (e.g., Csy4) in combination with recognition motifs for Csy4 surrounding each sgRNA14,15. Thirdly, Cas12a target site recognition requires a protospacer adjacent motif (PAM) at the 5&#8217;&#160;end from the target and cleaves after the +18/+23 position from its PAM resulting in cleaved DNA with sticky ends, whereas Cas9 requires a PAM located on the 3&#8217; end from the target and cleaves after the -3 position creating blunt end cuts in the DNA12. Fourthly, the consensus nucleotide sequence of the PAM differs between Cas12a ((T)TTV) and Cas9 (NGG), which makes Cas12a a promising candidate for targeting T-rich promoter and terminator sequences16. Finally, a recent study reported greater target specificity for Cas12a than for the native Cas917.
We present a protocol for using the CRISPR/Cas12a system for genome editing of S. cerevisiae with a particular focus on the introduction of multiple DNA expression cassettes into independent genomic loci simultaneously (multiplex genome editing) using a single crRNA array. The key steps of the protocol are depicted in Figure 1. As a proof of concept, the CRISPR/Cas12a system was applied for introduction of three expression cassettes into the genome of S. cerevisiae which enable the production of &#946;-carotene18 as schematically shown in Figure 2. Production of &#946;-carotene affects the phenotype of S. cerevisiae: i.e., upon successful introduction of all three heterologous genes required for carotenoids biosynthesis, the white S. cerevisiae cells turn yellow or orange, depending on the expression strength of each gene&#8217;s promoter. Due to the simple visual read-out of this pathway, it has been introduced to develop advanced CRISPR-based systems and methods for genome editing19,20. In this work, expression cassettes encoding the carotenoid genes crtE, crtYB and crtI have been constructed using a Golden Gate cloning (GGC) approach21 with heterologous promoters and homologous terminators used to drive expression of the genes. The expression cassettes are surrounded by unique 50-base pairs (bp) sequences, called connectors, that allow for in vivo assembly with integration flank DNA sequences (flanking regions) with the same 50-bp sequences, and subsequent integration into the genomic DNA of yeast at the position determined by the flanking regions. By using different promoter strengths, strains with different levels of carotenoids production were obtained resulting in variation in color of the cells. These strains - inspired by the &#8220;Yeast Art Project&#8221;22 - were used in a spotting setup with an acoustic liquid handler to create a 4-color high-resolution &#8220;yeast photograph&#8221; of Rosalind Franklin. Franklin (1920-1958) was an English chemist and X-ray crystallographer well known for her contribution to the discovery of the DNA structure by Photo 5123,24,25.

<table><tbody><tr><td>&lt;strong&gt;Chemicals specific for the protocol&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>1 Kb Plus DNA Ladder</td><td>Thermo Fisher Scientific</td><td>10787018</td><td>Electrophoresis</td></tr><tr><td>Ampicillin sodium salt</td><td>Sigma Aldrich</td><td>A9518</td><td>Selection of E. coli transformants</td></tr><tr><td>BsaI-HF (20 U/&amp;micro;l)</td><td>New England BioLabs</td><td>R353L</td><td>Golden Gate Cloning</td></tr><tr><td>Cell Lysis Solution (from kit Puregene Yeast/Bact. Kit B)</td><td>QIAGEN</td><td>854016</td><td>Isolation of genomic DNA from S. cerevisiae</td></tr><tr><td>CutSmart Buffer</td><td>New England BioLabs</td><td>B7204S</td><td>Linearization of pRN1120</td></tr><tr><td>Deoxyribonucleic acid sodium salt from salmon testes</td><td>Sigma Aldrich</td><td>D1626</td><td>Transfromation of&lt;br/&gt; S. cerevisiae (carrier DNA)</td></tr><tr><td>dNTPs</td><td>Invitrogen</td><td>10297018</td><td>PCRs</td></tr><tr><td>EcoRI-HF</td><td>New England BioLabs</td><td>R3101S</td><td>Linearization of pRN1120</td></tr><tr><td>Ethanol absolute for analysis</td><td>Merck</td><td>100983</td><td>Isolation of genomic DNA from S. cerevisiae</td></tr><tr><td>Ethylenediamine-tetraacetic acid</td><td>Sigma Aldrich</td><td>ED</td><td>Transformation of&lt;br/&gt; S. cerevisiae</td></tr><tr><td>G418 disulfate salt</td><td>Sigma Aldrich</td><td>A1720</td><td>Selection of S. cerevisiae transformants</td></tr><tr><td>Histodenz</td><td>Sigma Aldrich</td><td>D2158&amp;nbsp;</td><td>Yeast pixel art</td></tr><tr><td>Isopropanol</td><td>Merck</td><td>100993</td><td>Isolation of genomic DNA from S. cerevisiae</td></tr><tr><td>Lithium acetate dihydrate</td><td>Sigma Aldrich</td><td>L6883</td><td>Transformation of&lt;br/&gt; S. cerevisiae</td></tr><tr><td>Nancy-520 DNA Gel Stain</td><td>Sigma Aldrich</td><td>1494</td><td>Electrophoresis</td></tr><tr><td>NEB10 competent E. coli cells</td><td>New England BioLabs</td><td>C3019H</td><td>Transformation of E. coli: dx.doi.org/10.17504/protocols.io.nkvdcw6</td></tr><tr><td>Nourseothricin</td><td>Jena Bioscience</td><td>AB102</td><td>Selection of S. cerevisiae transformants</td></tr><tr><td>Phusion buffer</td><td>New England BioLabs</td><td>M0530L</td><td>PCRs</td></tr><tr><td>Phusion High-Fidelity DNA Polymerase</td><td>New England BioLabs</td><td>M0530L</td><td>PCRs</td></tr><tr><td>Polyethylene glycol 4000</td><td>Merck</td><td>7490</td><td>Transformation of&lt;br/&gt; S. cerevisiae</td></tr><tr><td>Protein Precipitation Solution (10 M NH4AC) (from kit Puregene Yeast/Bact. Kit B)</td><td>QIAGEN</td><td>854016</td><td>Isolation of genomic DNA from S. cerevisiae</td></tr><tr><td>Purple loading dye</td><td>New England BioLabs</td><td>B7024S</td><td>Electrophoresis</td></tr><tr><td>QIAprep Spin Miniprep Kit</td><td>QIAGEN</td><td>27106</td><td>Purification of plasmids</td></tr><tr><td>RNase coctail enzyme mix</td><td>Thermo Fisher Scientific</td><td>AM2286</td><td>Isolation of genomic DNA from S. cerevisiae</td></tr><tr><td>T4 DNA ligase buffer</td><td>Invitrogen</td><td>46300-018</td><td>Golden Gate Cloning</td></tr><tr><td>T4 DNA Ligase (1 U/&amp;micro;l)</td><td>Invitrogen</td><td>1705218</td><td>Golden Gate Cloning</td></tr><tr><td>UltraPure Agarose</td><td>Invitrogen</td><td>16500500</td><td>Electrophoresis</td></tr><tr><td>Wizard SV Gel and PCR Clean-Up System Kit</td><td>Promega</td><td>A9282</td><td>Purification of PCR products and linearized pRN1120</td></tr><tr><td>Xhol</td><td>New England BioLabs</td><td>R0146S</td><td>Linearization of pRN1120</td></tr><tr><td>Zymolyase 50 mg/ml (5 units/&amp;micro;L)</td><td>Zymo Research</td><td>E1006</td><td>Isolation of genomic DNA from S. cerevisiae (yeast lysis enzyme)</td></tr><tr><td>Zymolyase storage buffer</td><td>Zymo Research</td><td>E1004-B</td><td>Isolation of genomic DNA from S. cerevisiae (necessary for the preparation of yeast lysis enzyme)</td></tr><tr><td>&lt;strong&gt;Chemicals of general use&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>2*Peptone-Yeast extract (PY) agar</td><td></td><td></td><td>Plate growth of E. coli</td></tr><tr><td>2*PY medium</td><td></td><td></td><td>Cultivation of E. coli</td></tr><tr><td>Demineralized water</td><td></td><td></td><td>Transformation of&lt;br/&gt; S. cerevisiae</td></tr><tr><td>ELFO buffer</td><td></td><td></td><td>Electrophoresis</td></tr><tr><td>MQ</td><td></td><td></td><td>Multiple steps</td></tr><tr><td>Physiological salt solution</td><td></td><td></td><td>Transformation of&lt;br/&gt; S. cerevisiae</td></tr><tr><td>TE buffer</td><td></td><td></td><td>Storage of DNA, transformation of S. cerevisiae</td></tr><tr><td>Yeast extract-peptone-dextrose (YEPD; 2% glucose) medium</td><td></td><td></td><td>Cultivation of S. cerevisiae</td></tr><tr><td>YEPD (2% glucose) agar</td><td></td><td></td><td>Plate growth of&lt;br/&gt; S. cerevisiae</td></tr><tr><td>&lt;strong&gt;Consumables&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Eppendorf tubes</td><td></td><td></td><td></td></tr><tr><td>Falcon tubes (50 mL)</td><td></td><td></td><td></td></tr><tr><td>Microplate 96 wells</td><td></td><td></td><td></td></tr><tr><td>Petri dishes</td><td></td><td></td><td></td></tr><tr><td>Pipette tips 0.5 - 10 &amp;micro;L</td><td></td><td></td><td></td></tr><tr><td>Pipette tips 10 - 200 &amp;micro;L</td><td></td><td></td><td></td></tr><tr><td>Pipette tips 100 - 1000 &amp;micro;L</td><td></td><td></td><td></td></tr><tr><td>Shake flasks (500 mL)</td><td></td><td></td><td></td></tr><tr><td>Sterile filters</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Centrifuge (Falcon tubes)</td><td></td><td></td><td></td></tr><tr><td>Echo 525 acoustic liquid handler</td><td></td><td></td><td></td></tr><tr><td>Incubator</td><td></td><td></td><td></td></tr><tr><td>NanoDrop</td><td></td><td></td><td></td></tr><tr><td>Set for eletrophoresis</td><td></td><td></td><td></td></tr><tr><td>Spectrophotometer</td><td></td><td></td><td></td></tr><tr><td>Table centrifuge (Eppendorfs tubes)</td><td></td><td></td><td></td></tr><tr><td>Thermocycler</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmids&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pCSN067</td><td>Addgene</td><td>ID 101748</td><td>https://www.addgene.org/</td></tr><tr><td>pRN1120</td><td>Addgene</td><td>ID 101750</td><td>https://www.addgene.org/</td></tr><tr><td>&lt;strong&gt;Strains&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;em&gt;S. cerevisiae&lt;/em&gt; strain&lt;br/&gt; CEN.PK113-7D</td><td>EUROSCARF collection</td><td></td><td>http://www.euroscarf.de</td></tr></tbody></table>

crispr/cas12a multiplex genome editing of saccharomyces cerevisiae and the creation of yeast pixel art

High efficiency, ease of use and versatility of the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system has facilitated advanced genetic modification of Saccharomyces cerevisiae, a model organism and workhorse in industrial biotechnology. CRISPR-associated protein 12a (Cas12a), an RNA-guided endonuclease with features distinguishable from Cas9 is applied in this work, further extending the molecular toolbox for genome editing purposes. A benefit of the CRISPR/Cas12a system is that it can be used in multiplex genome editing with multiple guide RNAs expressed from a single transcriptional unit (single CRISPR RNA (crRNA) array). We present a protocol for multiplex integration of multiple heterologous genes into independent loci of the S. cerevisiae genome using the CRISPR/Cas12a system with multiple crRNAs expressed from a single crRNA array construct. The proposed method exploits the ability of S. cerevisiae to perform in vivo recombination of DNA fragments to assemble the single crRNA array into a plasmid that can be used for transformant selection, as well as the assembly of donor DNA sequences that integrate into the genome at intended positions. Cas12a is pre-expressed constitutively, facilitating cleavage of the S.&#160;cerevisiae genome at the intended positions upon expression of the single crRNA array. The protocol includes the design and construction of a single crRNA array and donor DNA expression cassettes, and exploits an integration approach making use of unique 50-bp DNA connectors sequences and separate integration flank DNA sequences, which simplifies experimental design through standardization and modularization and extends the range of applications. Finally, we demonstrate a straightforward technique for creating yeast pixel art with an acoustic liquid handler using differently colored carotenoid producing yeast strains that were constructed.

The protocol for multiplex genome editing using CRISRP/Cas12a was demonstrated by constructing three carotenoid producing S. cerevisiae strains expressing the crtE, crtYB and crtI genes using heterologous promoters of high, medium and low strength: strain 1, 2 and, 3 respectively (Supplementary Table 3). Construction of these strains required generation of three donor DNA expression cassettes and six flanking regions per strain for targeting to three different loci in genomic DNA (shown in Figure 2B). As described herein, promoter, open reading frame, terminator and two contiguous 50-bp connectors sequences were assembled into an expression cassette via a Golden Gate Cloning reaction and the assembly was verified by PCR (Figure 3A). The single crRNA array was ordered as a synthetic DNA fragment and was amplified by PCR (Figure 3B). The recipient plasmid for the single crRNA array (plasmid pRN1120) was linearized with EcoRI-HF and XhoI and linearization was confirmed by electrophoresis (Figure 3C). The design and nucleotide sequences of the introduced donor DNA expression cassettes and flanking regions are shown in Supplementary Table 3 and Supplementary Table 4. The sequence of single crRNA array expression cassettes is provided in Supplementary Table 1. Functionality of the spacers included in the single crRNA array was tested beforehand by singleplex genome editing with individual crRNAs19.
The efficiency of genome editing using Cas12a was firstly evaluated based on the number of colored colonies obtained after transformation (Table 1, Figure 4). The editing efficiency of the three constructed strains varied from 50% to 94%. Notably, introduction of expression cassettes used to generate strain 1 displayed the lowest editing efficiency, possibly caused by the nature of the donor DNA (i.e., these expression cassettes encode crtE, crtYB and crtI from three high strength promoters). Secondly, correct integration of the three donor DNA expression cassettes at the intended loci on the genomic DNA was confirmed by PCR (Figure 5). Primers were designed in such a way that PCR products were obtained when correct integration of donor DNA at the intended locus occurred. For each transformation experiment, eight colonies were picked from the transformation plate and tested (note that only three are presented in Figure 5). In general, out of 8 colonies tested per donor DNA, correct integration of the crtE donor DNA at the INT1 locus, crtYB at the INT2 locus and crtI at the INT3 locus was confirmed in &#62;90% of the transformants. These results demonstrate the CRISPR/Cas12a system in combination with a single crRNA array enables efficient multiplex editing of the S. cerevisiae genome at multiple loci simultaneously.
Additionally, we demonstrate the creation of &#8220;yeast pixel art&#8221; using the three carotenoid producing strains that were constructed together with a non-colored wild-type strain. Starting from a black and white picture of Rosalind Franklin (Figure 6A), a 4-color picture (Figure 6B) and spotting list was created which was then used to spot the four different yeast strains on an agar microplate using an acoustic liquid handler, resulting in a high-resolution &#8220;yeast painting&#8221; of Rosalind Franklin (Figure 6C,D,E).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59350/59350fig1v5.jpg" /> 
Figure 1: Workflow of the protocol for CRISPR/Cas12a multiplex genome editing in S. cerevisiae. The workflow includes crucial steps of the presented method. For details see the Protocol. <a href="https://www.jove.com/files/ftp_upload/59350/59350fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59350/59350fig2.jpg" /> 
Figure 2: Scheme of CRISPR/Cas12a multiplex genome editing using a single crRNA array. (A) The single crRNA array is composed of three crRNAs units in their mature form, a 20-bp direct repeat specific for LbCas12a (grey squares) with a 23-bp guide sequence (colored diamonds). Expression of the crRNA array is enabled by the SNR52 promoter and SUP4 terminator. Transformation of S. cerevisiae with a linearized pRN1120 and the single crRNA array expression cassette containing homology with pRN1120 (diagonal stripes) allows for in vivo recombination into a circular plasmid in cells pre-expressing LbCas12a. The single crRNA array is subsequently processed by Cas12a. (B) Cas12a is directed to the intended INT1, INT2 and INT3 genomic target sites and creates double stranded breaks. In the transformation mixture, donor DNA consisting of flanking regions and the carotenoid gene expression cassette were included. Donor DNA assemblies were targeted to one stretch of DNA in genomic DNA around the INT1 (crtE), INT2 (crtYB) and INT3 (crtI) loci by in vivo recombination due to the presence of 50-bp homologous connectors sequences, indicated as 5, A, B, C, D or E. P1&#8211;P3, different promoters; T1&#8211;T3, different terminators. This figure has been modified from Verwaal et al. 201819. Genetic constructs shown using Synthetic Biology Open Language (SBOL) Visual symbols40. <a href="https://www.jove.com/files/ftp_upload/59350/59350fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59350/59350fig3.jpg" /> 
Figure 3: PCR verifying the genome editing experiments. (A) Verification of Golden Gate Cloning reactions of assembled donor DNA cassettes. Obtained results are in agreement with expected lengths. (B) PCR of the single crRNA array. (C) Linearization of plasmid pRN1120. <a href="https://www.jove.com/files/ftp_upload/59350/59350fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59350/59350fig4.jpg" /> 
Figure 4: Plates of S. cerevisiae transformations using the multiplex genome editing approach. (A) Strain&#160;1 expressing crtE, crtYB and crtI from three strong promoters (dark orange colonies). (B) Strain 2 expressing crtE, crtYB and crtI from three medium strength promoters (orange colonies). (C) Strain 3 expressing crtE, crtYB and crtI from three low strength promoters (yellow colonies). <a href="https://www.jove.com/files/ftp_upload/59350/59350fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/59350/59350fig5.jpg" /> 
Figure 5: PCR verifying integration of the donor DNA expression cassettes at the intended loci within the genomic DNA. (A) Verification of three colonies of the strain 1. (B) Verification of three colonies of the strain 2. (C) Verification of three colonies of the strain 3. <a href="https://www.jove.com/files/ftp_upload/59350/59350fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/59350/59350fig6.jpg" /> 
Figure 6: Yeast pixel art of Rosalind Franklin. (A) Black and white RGB photo of 220 &#215; 280 pixels of Rosalind Franklin that was used as a template. (B) Computer conversion of the black and white photo of Rosalind Franklin into a 4-color 64 &#215; 96 pixel list. (C) Photo of yeast pixel art with 64 &#215; 96 yeast colonies with a zoomed-in section. (D)&#160;Photo of an acoustic liquid handler with two full grown plates. (E) Photo of a&#160;full grown microplate with 64 &#215; 96 yeast colonies. <a href="https://www.jove.com/files/ftp_upload/59350/59350fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td></td>
			<td>Strain 1</td>
			<td>Strain 2</td>
			<td>Strain 3</td>
		</tr>
		<tr>
			<td>Colored colonies</td>
			<td>16</td>
			<td>279</td>
			<td>220</td>
		</tr>
		<tr>
			<td>White colonies</td>
			<td>16</td>
			<td>18</td>
			<td>18</td>
		</tr>
		<tr>
			<td>Total colonies</td>
			<td>32</td>
			<td>297</td>
			<td>238</td>
		</tr>
		<tr>
			<td>Efficiency</td>
			<td>50%</td>
			<td>94%</td>
			<td>92%</td>
		</tr>
	</tbody>
</table>
Table 1: Editing efficiency of the multiplex genome editing approach.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>crRNA array sequencea,b,c,d,e,f</td>
		</tr>
		<tr>
			<td>CATGTTTGACAGCTTATCATCGATAATCCGGAGCTAGCATGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGTCTTTGAAAA 
			GATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACTTGATGTTTTCTTTCGAGTATATACAAGG 
			TGATTACATGTACGTTTGAAGTACAACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCA 
			TTTTTTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAGTGAAAGTTGGTGCGC 
			ATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCAATTTCTACTAAGTGTAGAT 
			CTGGTGGGAGAGAAAGCTTATGAAATTTCTACTAAGTGTAGATGTGCCGTAC 
			GCCGGAGCCGACGGAATTTCTACTAAGTGTAGATTGCCCCTCTTATACGATTATATTTT 
			TTTTTGTTTTTTATGTCTGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGG 
			GTTAATTCCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTG</td>
		</tr>
		<tr>
			<td>a. Homology to pRN1120 (bold). 
			b. SNR52 promoter (italics). 
			c. Genomic target sequences (underlined). 
			d. Guide direct repeats specific for LbCas12a (italics, bold). 
			e. SUP4 terminator (italics). 
			f. Homology to pRN1120 (bold).</td>
		</tr>
	</tbody>
</table>
Supplementary Table 1: Single crRNA array for LbCas12a containing homology with plasmid pRN1120.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Sequencea</td>
			<td>Descriptionb</td>
			<td>Used in point</td>
		</tr>
		<tr>
			<td>KC-101</td>
			<td>CATGTTTGACAGCTTATCATC</td>
			<td>FW primer for amplification of single crRNA array</td>
			<td>2.1.4</td>
		</tr>
		<tr>
			<td>KC-102</td>
			<td>CACACAGGAAACAGCTATGAC</td>
			<td>RV primer for amplification of single crRNA array</td>
			<td>2.1.4</td>
		</tr>
		<tr>
			<td>KC-103</td>
			<td>AAGCGACTTCCAATCGCTTTGC</td>
			<td>FW primer for amplification of donor DNA with connector 5</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-104</td>
			<td>AAAGCAAAGGAAGGAGAGAAC</td>
			<td>RV primer for amplification of donor DNA with connector A</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-105</td>
			<td>CGGATCGATGTACACAACCG</td>
			<td>FW primer for amplification of donor DNA with connector B</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-106</td>
			<td>CAACAGGAGGCGGATGGATATAC</td>
			<td>RV primer for amplification of donor DNA with connector C</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-107</td>
			<td>AACGTTGTCCAGGTTTGTATCC</td>
			<td>FW primer for amplification of donor DNA with connector D</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-108</td>
			<td>AGGTACAACAAGCACGACCG</td>
			<td>RV primer for amplification of donor DNA with connector E</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-109</td>
			<td>CACTATAGCAATCTGGCTATATG</td>
			<td>FW primer for amplification of INT1 5&#39; with connector 5</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-110</td>
			<td>AAACGCCTGTGGGTGTGGTAC 
			TGGATATGCAAAGCGATTGGAA 
			GTCGCTTGACTCCTCTGCCGTC 
			ATTCC</td>
			<td>RV primer for amplification of INT1 5&#39; with connector 5</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-111</td>
			<td>TTGCCCATCGAACGTACAAG 
			TACTCCTCTGTTCTCTCCTTCCTT 
			TGCTTTAAGCGTTGAAGTTTCCTC 
			TTTG</td>
			<td>FW primer for amplification of INT1 3&#39; with connector A</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-112</td>
			<td>TGTCAACTGGAGAGCTATCG</td>
			<td>RV primer for amplification of INT1 3&#39; with connector A</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-113</td>
			<td>AGAAGATTTCTCTTCAATCTC</td>
			<td>FW primer for amplification of INT2 5&#39; with connector B</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-114</td>
			<td>TGCTAAGATTTGTGTTCGTT 
			TGGGTGCAGTCGGTTGTGTACAT 
			CGATCCGCCCTTATCAAGGATACC 
			TGGTTG</td>
			<td>RV primer for amplification of INT2 5&#39; with connector B</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-115</td>
			<td>ACGCTTTCCGGCATCTTCCA 
			GACCACAGTATATCCATCCGCCT 
			CCTGTTGGGCGATTACACAAGCG 
			GTGG</td>
			<td>FW primer for amplification of INT2 3&#39; with connector C</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-116</td>
			<td>TCTCCTCTTCGATGACCGGG</td>
			<td>RV primer for amplification of INT2 3&#39; with connector C</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-117</td>
			<td>GGTCGTTTTTGTGCAGCATATTG</td>
			<td>FW primer for amplification of INT3 5&#39; with connector D</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-118</td>
			<td>GCGGAATATTGGCGGAACGG 
			ACACACGTGGATACAAACCTG 
			GACAACGTTTTCCAAGGAGGTG 
			AAGAACG</td>
			<td>RV primer for amplification of INT3 5&#39; with connector D</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-119</td>
			<td>AAATAACCACAAACATCCTT 
			CCCATATGCTCGGTCGTGCTTGTT 
			GTACCTGATGGGACGTCAGCACT 
			GTAC</td>
			<td>FW primer for amplification of INT3 3&#39; with connector E</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-120</td>
			<td>GAGCTTACTCTATATATTCATTC</td>
			<td>RV primer for amplification of INT3 3&#39; with connector E</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-121</td>
			<td>GTTACTAAACTGGAACTGTCCG</td>
			<td>FW primer for verification of integration of con5-crtE-conA to INT1 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-122</td>
			<td>CACTGCTAACTACGTTTACTTC</td>
			<td>FW primer for verification of integration of con5-crtE-conA to INT1 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-123</td>
			<td>CACTGGAACTTGAGCTTGAG</td>
			<td>FW primer for verification of integration of conB-crtYB-conC to INT2 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-124</td>
			<td>GTCTCCAGCTGAATTGGTCC</td>
			<td>FW primer for verification of integration of conB-crtYB-conC to INT2 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-125</td>
			<td>CTCTCATGAAGCAGTCAAGTC</td>
			<td>FW primer for verification of integration of conD-crtI-conE to INT3 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-126</td>
			<td>GATCGGTCAATTAGGTGAAG</td>
			<td>FW primer for verification of integration of conD-crtI-conE to INT3 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-127</td>
			<td>CCTTGTCCAAGTAGGTGTCC</td>
			<td>RV primer for verification of integration of con5-crtE-conA to INT1 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-128</td>
			<td>GCTGTCATGATCTGTGATAAC</td>
			<td>RV primer for verification of integration of con5-crtE-conA to INT1 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-129</td>
			<td>CTGGCAATGTTGACCAATTGC</td>
			<td>RV primer for verification of integration of conB-crtYB-conC to INT2 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-130</td>
			<td>CCAACGTGCCTTAAAGTCTG</td>
			<td>RV primer for verification of integration of conB-crtYB-conC to INT2 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-131</td>
			<td>CCTTACCTTCTGGAGCAGCAG</td>
			<td>RV primer for verification of integration of conD-crtI-conE to INT3 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-132</td>
			<td>CTGGTTACTTCCCTAAGACTG</td>
			<td>RV primer for verification of integration of conD-crtI-conE to INT3 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td></td>
			<td>a. Bold sequences denote connector sequences. 
			b. Forward and reverse primers are designated as FW and RV, respectively.</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>
Supplementary Table 2: Primer sequences.
<img alt="Supplementary Table 3" src="/files/ftp_upload/59350/59350suptable3.jpg" /> 
Supplementary Table 3: Design of constructed strains.
<img alt="Supplementary Table 4" src="/files/ftp_upload/59350/59350suptable4.jpg" /> 
Supplementary Table 4: Sequences of donor DNA expression cassettes and flaking regions. <a href="https://www.jove.com/files/ftp_upload/59350/Suppl_Table_4.docx" target="_blank">Please click here to download this file.</a>

Watch this Scientific Journal Video about CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art at JoVE.com

CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art

The CRISPR/Cas12a system in combination with a single crRNA array enables efficient multiplex editing of the S.&#160;cerevisiae genome at multiple loci simultaneously. This is demonstrated by constructing carotenoid producing yeast strains which are subsequently used to create yeast pixel art.

CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art

High efficiency, ease of use and versatility of the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) ...

crisprcas12a-multiplex-genome-editing-saccharomyces-cerevisiae

Research

JoVE Journal

Bioengineering

17.0K Views.  DSM Biotechnology Center. Dit protocol toont een nieuwe methode voor Multiplex Genome Editing van Saccharomyces cerevisiae door de invoering van meerdere expressie cassettes op verschillende loci in een enkele transformatie stap. Deze kloonvrije plasmideassemblagebenadering voor het uitdrukken van één crRNA-array, leidt tot een snel, efficiënt en flexibel genoombewerkingsprotocol. We zullen wilde gistcellen ontwerpen, om carotenoïden te produceren door vrije heterologe genen op vrije genomische loci te introducere...

Video: CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art

Establishment of Genome-edited Human Pluripotent Stem Cell Lines: From Targeting to Isolation

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human development and investigate the pathophysiology of disease. By employing site-specific nucleases (SSNs) for genome editing, the rapid derivation of new hPSC lines harboring specific genetic alterations in an otherwise isogenic setting becomes possible. Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 are the most commonly used SSNs. All of these nucleases function by introducing a double stranded DNA break at a specified site, thereby promoting precise gene editing at a genomic locus. SSN-meditated genome editing exploits two of the cell&#39;s endogenous DNA repair mechanisms, non-homologous end joining (NHEJ) and homology directed repair (HDR), to either introduce insertion/deletion mutations or alter the genome using a homologous repair template at the site of the double stranded break. Electroporation of hPSCs is an efficient means of transfecting SSNs and repair templates that incorporate transgenes such as fluorescent reporters and antibiotic resistance cassettes. After electroporation, it is possible to isolate only those hPSCs that incorporated the repair construct by selecting for antibiotic resistance. Mechanically separating hPSC colonies and confirming proper integration at the target site through genotyping allows for the isolation of correctly targeted and genetically homogeneous cell lines. The validity of this protocol is demonstrated here by using all three SSN platforms to incorporate EGFP and a puromycin resistance construct into the AAVS1 safe harbor locus in human pluripotent&#160;stem cells.

Genome editing of human pluripotent stem cells (hPSCs) can be done quickly and efficiently. Presented here is a robust experimental procedure to genetically engineer hPSCs as exemplified by editing the AAVS1 safe harbor locus to express EGFP and introduce antibiotic resistance.

Genome-editing of human pluripotent stem cells (hPSCs) provides a genetically controlled and clinically relevant platform from which to understand human ...

Developmental Biology

Enhanced Genome Editing with Cas9 Ribonucleoprotein in Diverse Cells and Organisms

Site-specific eukaryotic genome editing with CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems has quickly become a commonplace amongst researchers pursuing a wide variety of biological questions. Users most often employ the Cas9 protein derived from Streptococcus pyogenes in a complex with an easily reprogrammed guide RNA (gRNA). These components are introduced into cells, and through a base pairing with a complementary region of the double-stranded DNA (dsDNA) genome, the enzyme cleaves both strands to generate a double-strand break (DSB). Subsequent repair leads to either random insertion or deletion events (indels) or the incorporation of experimenter-provided DNA at the site of the break.
The use of a purified single-guide RNA and Cas9 protein, preassembled to form an RNP and delivered directly to cells, is a potent approach for achieving highly efficient gene editing. RNP editing particularly enhances the rate of gene insertion, an outcome that is often challenging to achieve. Compared to the delivery via a plasmid, the shorter persistence of the Cas9 RNP within the cell leads to fewer off-target events. 
Despite its advantages, many casual users of CRISPR gene editing are less familiar with this technique. To lower the barrier to entry, we outline detailed protocols for implementing the RNP strategy in a range of contexts, highlighting its distinct benefits and diverse applications. We cover editing in two types of primary human cells, T cells and hematopoietic stem/progenitor cells (HSPCs). We also show how Cas9 RNP editing enables the facile genetic manipulation of entire organisms, including the classic model roundworm Caenorhabditis elegans and the more recently introduced model crustacean, Parhyale hawaiensis.

Utilizing a preassembled Cas9 ribonucleoprotein complex (RNP) is a powerful method for precise, efficient genome editing. Here, we highlight its utility across a broad range of cells and organisms, including primary human cells and both classic and emerging model organisms.

Site-specific eukaryotic genome editing with CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems has ...

Genetics

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been co-opted as a powerful tool for precise eukaryotic genome engineering. Here, we present a rapid and simple method using chimeric single guide RNAs (sgRNA) and CRISPR-Cas9 Ribonucleoproteins (RNPs) for the efficient and precise generation of genomic point mutations in C. elegans. We describe a pipeline for sgRNA target selection, homology-directed repair (HDR) template design, CRISPR-Cas9-RNP complexing and delivery, and a genotyping strategy that enables the robust and rapid identification of correctly edited animals. Our approach not only permits the facile generation and identification of desired genomic point mutant animals, but also facilitates the detection of other complex indel alleles in approximately 4 - 5 days with high efficiency and a reduced screening workload.

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

Here, we present a method to engineer the genome of C. elegans using CRISPR-Cas9 ribonucleoproteins and homology dependent repair templates.

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been ...

CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans

This method describes the efficient CRISPR mediated genome editing of the diploid human fungal pathogen Candida albicans. CRISPR-mediated genome editing in C. albicans requires Cas9, guide RNA, and repair template. A plasmid expressing a yeast codon optimized Cas9 (CaCas9) has been generated. Guide sequences directly upstream from a PAM site (NGG) are cloned into the Cas9 expression vector. A repair template is then made by primer extension in vitro. Cotransformation of the repair template and vector into C. albicans leads to genome editing. Depending on the repair template used, the investigator can introduce nucleotide changes, insertions, or deletions. As C. albicans is a diploid, mutations are made in both alleles of a gene, provided that the A and B alleles do not harbor SNPs that interfere with guide targeting or repair template incorporation. Multimember gene families can be edited in parallel if suitable conserved sequences exist in all family members. The C. albicans CRISPR system described is flanked by FRT sites and encodes flippase. Upon induction of flippase, the antibiotic marker (CaCas9) and guide RNA are removed from the genome. This allows the investigator to perform subsequent edits to the genome. C. albicans CRISPR is a powerful fungal genetic engineering tool, and minor alterations to the described protocols permit the modification of other fungal species including C. glabrata, N. castellii, and S. cerevisiae.

CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans

Efficient genome engineering of Candida albicans is critical to understanding the pathogenesis and development of therapeutics. Here, we described a protocol to quickly and accurately edit the C. albicans genome using CRISPR. The protocol allows investigators to introduce a wide variety of genetic modifications including point mutations, insertions, and deletions.

This method describes the efficient CRISPR mediated genome editing of the diploid human fungal pathogen Candida albicans. CRISPR-mediated genome editing ...

CRISPR-Cas9-Mediated Genome Editing in the Filamentous Ascomycete Huntiella omanensis

The CRISPR-Cas9 genome editing system is a molecular tool that can be used to introduce precise changes into the genomes of model and non-model species alike. This technology can be used for a variety of genome editing approaches, from gene knockouts and knockins to more specific changes like the introduction of a few nucleotides at a targeted location. Genome editing can be used for a multitude of applications, including the partial functional characterization of genes, the production of transgenic organisms and the development of diagnostic tools. Compared to previously available gene editing strategies, the CRISPR-Cas9 system has been shown to be easy to establish in new species and boasts high efficiency and specificity. The primary reason for this is that the editing tool uses an RNA molecule to target the gene or sequence of interest, making target molecule design straightforward, given that standard base pairing rules can be exploited. Similar to other genome editing systems, CRISPR-Cas9-based methods also require efficient and effective transformation protocols as well as access to good quality sequence data for the design of the targeting RNA and DNA molecules. Since the introduction of this system in 2013, it has been used to genetically engineer a variety of model species, including Saccharomyces cerevisiae, Arabidopsis thaliana, Drosophila melanogaster and Mus musculus. Subsequently, researchers working on non-model species have taken advantage of the system and used it for the study of genes involved in processes as diverse as secondary metabolism in fungi, nematode growth and disease resistance in plants, among many others. This protocol detailed below describes the use of the CRISPR-Cas9 genome editing protocol for the truncation of a gene involved in the sexual cycle of Huntiella omanensis, a filamentous ascomycete fungus belonging to the Ceratocystidaceae family.

CRISPR-Cas9-Mediated Genome Editing in the Filamentous Ascomycete Huntiella omanensis

The CRISPR-Cas9 genome editing system is an easy-to-use genome editor that has been used in model and non-model species. Here we present a protein-based version of this system that was used to introduce a premature stop codon into a mating gene of a non-model filamentous ascomycete fungus.

The CRISPR-Cas9 genome editing system is a molecular tool that can be used to introduce precise changes into the genomes of model and non-model species ...

CRISPR/Cas9 Editing of the C. elegans rbm-3.2 Gene using the dpy-10 Co-CRISPR Screening Marker and Assembled Ribonucleoprotein Complexes.

The bacterial Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Streptococcus pyogenes CRISPR-associated protein (Cas) system has been harnessed by researchers to study important biologically relevant problems. The unparalleled power of the CRISPR/Cas genome editing method allows researchers to precisely edit any locus of their choosing, thereby facilitating an increased understanding of gene function. Several methods for editing the C. elegans genome by CRISPR/Cas9 have been described previously. Here, we discuss and demonstrate a method which utilizes in vitro assembled ribonucleoprotein complexes and the dpy-10 co-CRISPR marker for screening. Specifically, in this article, we go through the step-by-step process of introducing premature stop codons into the C. elegans rbm-3.2 gene by homology-directed repair using this method of CRISPR/Cas9 editing. This relatively simple editing method can be used to study the function of any gene of interest and allows for the generation of homozygous-edited C. elegans by CRISPR/Cas9 editing&#160;in less than two weeks.

CRISPR/Cas9 Editing of the C. elegans rbm-3.2 Gene using the dpy-10 Co-CRISPR Screening Marker and Assembled Ribonucleoprotein Complexes.

The goal of this protocol is to enable seamless CRISPR/Cas9 editing of the C. elegans genome using assembled ribonucleoprotein complexes and the dpy-10 co-CRISPR marker for screening. This protocol can be used to make a variety of genetic modifications in C. elegans including insertions, deletions, gene replacements and codon substitutions.

The bacterial Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Streptococcus pyogenes CRISPR-associated protein (Cas) system has been ...

Design and Implementation of an Automated Illuminating, Culturing, and Sampling System for Microbial Optogenetic Applications

Optogenetic systems utilize genetically-encoded proteins that change conformation in response to specific wavelengths of light to alter cellular processes. There is a need for culturing and measuring systems that incorporate programmed illumination and stimulation of optogenetic systems. We present a protocol for building and using a continuous culturing apparatus to illuminate microbial cells with programmed doses of light, and automatically acquire and analyze images of cells in the effluent. The operation of this apparatus as a chemostat allows the growth rate and the cellular environment to be tightly controlled. The effluent of the continuous cell culture is regularly sampled and the cells are imaged by multi-channel microscopy. The culturing, sampling, imaging, and image analysis are fully automated so that dynamic responses in the fluorescence intensity and cellular morphology of cells sampled from the culture effluent are measured over multiple days without user input. We demonstrate the utility of this culturing apparatus by dynamically inducing protein production in a strain of Saccharomyces cerevisiae engineered with an optogenetic system that activates transcription.

We designed a continuous culturing apparatus for use with optogenetic systems to illuminate cultures of microbes and regularly image cells in the effluent with an inverted microscope. The culturing, sampling, imaging, and image analysis are fully automated so that dynamic responses to illumination can be measured over several days.

Optogenetic systems utilize genetically-encoded proteins that change conformation in response to specific wavelengths of light to alter cellular ...

Rapid Assembly of Multi-Gene Constructs using Modular Golden Gate Cloning

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that cut outside of their recognition sites and create a short overhang. This modular cloning (MoClo) system uses a hierarchical workflow in which different DNA parts, such as promoters, coding sequences (CDS), and terminators, are first cloned into an entry vector. Multiple entry vectors then assemble into transcription units. Several transcription units then connect into a multi-gene plasmid. The Golden Gate cloning strategy is of tremendous advantage because it allows scar-less, directional, and modular assembly in a one-pot reaction. The hierarchical workflow typically enables the facile cloning of a large variety of multi-gene constructs with no need for sequencing beyond entry vectors. The use of fluorescent protein dropouts enables easy visual screening. This work provides a detailed, step-by-step protocol for assembling multi-gene plasmids using the yeast modular cloning (MoClo) kit. We show optimal and suboptimal results of multi-gene plasmid assembly and provide a guide for screening for colonies. This cloning strategy is highly applicable for yeast metabolic engineering and other situations in which multi-gene plasmid cloning is required.

The goal of this protocol is to provide a detailed, step-by-step guide for assembling multi-gene constructs using the modular cloning system based on Golden Gate cloning. It also gives recommendations on critical steps to ensure optimal assembly based on our experiences.

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Biology

Gene Digital Circuits Based on CRISPR-Cas Systems and Anti-CRISPR Proteins

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the CRISPR-Cas systems and their natural inhibitors-the anti-CRISPR proteins (Acrs)-provides a new tool to design and implement in vivo gene digital circuits. Here, we describe a protocol that follows the idea of the "Design-Build-Test-Learn" biological engineering cycle and makes use of dCas9/dCas12a together with their corresponding Acrs to establish small transcriptional networks, some of which behave like Boolean gates, in Saccharomyces cerevisiae. These results point out the properties of dCas9/dCas12a as transcription factors. In particular, to achieve maximal activation of gene expression, dSpCas9 needs to interact with an engineered scaffold RNA that collects multiple copies of the VP64 activation domain (AD). In contrast, dCas12a shall be fused, at the C terminus, with the strong VP64-p65-Rta (VPR) AD. Furthermore, the activity of both Cas proteins is not enhanced by increasing the amount of sgRNA/crRNA in the cell. This article also explains how to build Boolean gates based on the CRISPR-dCas-Acr interaction. The AcrIIA4 fused hormone-binding domain of the human estrogen receptor is the core of a NOT gate responsive to &#946;-estradiol, whereas AcrVAs synthesized by the inducible GAL1 promoter permits to mimic both YES and NOT gates with galactose as an input. In the latter circuits, AcrVA5, together with dLbCas12a, showed the best logic behavior.

CRISPR-Cas systems and anti-CRISPR proteins were integrated into the scheme of Boolean gates in Saccharomyces cerevisiae. The new small logic circuits showed good performance and deepened the understanding of both dCas9/dCas12a-based transcription factors and the properties of anti-CRISPR proteins.

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the ...

CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art

Samenvatting

Meer video's verkennen