This project received funding from the European Union&#8217;s Horizon 2020 research and innovation programme under grant agreement no. 686070 (DD-DeCaf) and 764591 (SynCrop), and from the research programme Building Blocks of Life with project number 737.016.005 by the Netherlands Organisation for Scientific Research (NWO). T.E.G. was supported by the Royal Society (grant UF160357) and BrisSynBio, a&#160;BBSRC/EPSRC Synthetic Biology Research Centre (grant BB/L01386X/1). We thank Zi Di and Jeffrey van Wijk for their contribution to the yeast spotting experiments for creating the yeast pixel art.&#160;

<ol>
	<li>Knott, G. J., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas+guides+the+future+of+genetic+engineering.">CRISPR-Cas guides the future of genetic engineering.</a> Science. 361 (6405), 866-869 (2018).</li><li>DiCarlo, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+in+Saccharomyces+cerevisiae+using+CRISPR-Cas+systems.">Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems.</a> Nucleic Acids Research. 41 (7), 4336-4343 (2013).</li><li>Gilbert, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-mediated+modular+RNA-guided+regulation+of+transcription+in+eukaryotes.">CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes.</a> Cell. 154 (2), 442-451 (2013).</li><li>Lian, J., HamediRad, M., Hu, S., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+metabolic+engineering+using+an+orthogonal+tri-functional+CRISPR+system.">Combinatorial metabolic engineering using an orthogonal tri-functional CRISPR system.</a> Nature Communications. 8 (1), 1688 (2017).</li><li>Li, Z. -. H., Liu, M., Lyu, X. -. M., Wang, F. -. Q., Wei, D. -. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cpf1+facilitated+large+fragment+deletion+in+Saccharomyces+cerevisiae.">CRISPR/Cpf1 facilitated large fragment deletion in Saccharomyces cerevisiae.</a> Journal of Basic Microbiology. 58 (12), 1100-1104 (2018).</li><li>Shao, Y., Lu, N., Qin, Z., Xue, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+facilitated+multiple-chromosome+fusion+in+Saccharomyces+cerevisiae.">CRISPR-Cas9 facilitated multiple-chromosome fusion in Saccharomyces cerevisiae.</a> ACS Synthetic Biology. 7 (11), 2706-2708 (2018).</li><li>Brouns, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+CRISPR+RNAs+guide+antiviral+defense+in+prokaryotes.">Small CRISPR RNAs guide antiviral defense in prokaryotes.</a> Science. 321 (5891), 960-964 (2008).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Abudayyeh, O. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C2c2+is+a+single-component+programmable+RNA-guided+RNA-targeting+CRISPR+effector.">C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector.</a> Science. 353 (6299), (2016).</li><li>Makarova, K. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+updated+evolutionary+classification+of+CRISPR-Cas+systems.">An updated evolutionary classification of CRISPR-Cas systems.</a> Nature Reviews Microbiology. 13 (11), 722-736 (2015).</li><li>Mohanraju, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+evolutionary+roots+and+mechanistic+variations+of+the+CRISPR-Cas+systems.">Diverse evolutionary roots and mechanistic variations of the CRISPR-Cas systems.</a> Science. 353 (6299), (2016).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Fonfara, I., Richter, H., Bratovi&#269;, M., Le Rhun, A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR-associated+DNA-cleaving+enzyme+Cpf1+also+processes+precursor+CRISPR+RNA.">The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA.</a> Nature. 532 (7600), 517-521 (2016).</li><li>Lian, J., HamediRad, M., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advancing+metabolic+engineering+of+Saccharomyces+cerevisiae.+using+the+CRISPR/Cas+System.">Advancing metabolic engineering of Saccharomyces cerevisiae. using the CRISPR/Cas System.</a> Biotechnology Journal. 13 (9), 1700601 (2018).</li><li>Ferreira, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+CRISPR/Cas9+genome+editing+and+gene+regulation+using+Csy4+in+Saccharomyces+cerevisiae.">Multiplexed CRISPR/Cas9 genome editing and gene regulation using Csy4 in Saccharomyces cerevisiae.</a> ACS Synthetic Biology. 7 (1), 10-15 (2018).</li><li>Swarts, D. C., Martin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cas9+versus+Cas12a/Cpf1:+Structure&#8211;function+comparisons+and+implications+for+genome+editing.">Cas9 versus Cas12a/Cpf1: Structure&#8211;function comparisons and implications for genome editing.</a> Wiley Interdisciplinary Reviews: RNA. 9 (5), 1481 (2018).</li><li>Strohkendl, I., Saifuddin, F. A., Rybarski, J. R., Finkelstein, I. J., Russell, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetic+Basis+for+DNA+Target+Specificity+of+CRISPR-Cas12a.">Kinetic Basis for DNA Target Specificity of CRISPR-Cas12a.</a> Molecular Cell. 71 (5), 816-824 (2018).</li><li>Verwaal, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-level+production+of+beta-carotene+in+Saccharomyces+cerevisiae.+by+successive+transformation+with+carotenogenic+genes+from+Xanthophyllomyces+dendrorhous.">High-level production of beta-carotene in Saccharomyces cerevisiae. by successive transformation with carotenogenic genes from Xanthophyllomyces dendrorhous.</a> Applied and Environmental Microbiology. 73 (13), 4342-4350 (2007).</li><li>Verwaal, R., Buiting-Wiessenhaan, N., Dalhuijsen, S., Roubos, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cpf1+enables+fast+and+simple+genome+editing+of+Saccharomyces+cerevisiae.">CRISPR/Cpf1 enables fast and simple genome editing of Saccharomyces cerevisiae.</a> Yeast. 35 (2), 201-211 (2018).</li><li>Jakociunas, T., Jensen, M. K., Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+advances+engineering+of+microbial+cell+factories.">CRISPR/Cas9 advances engineering of microbial cell factories.</a> Metabolic Engineering. 34, 44-59 (2016).</li><li>Engler, C., Romy, K., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method+with+high+throughput+capability.">A one pot, one step, precision cloning method with high throughput capability.</a> PloS One. 3 (11), 3647 (2008).</li><li>Franklin, R. E., Gosling, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+configuration+in+sodium+thymonucleate.">Molecular configuration in sodium thymonucleate.</a> Nature. 171, 740-741 (1953).</li><li>Watson, J. D., Crick, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+structure+for+deoxyribose+nucleic+acid.">A structure for deoxyribose nucleic acid.</a> Nature. 171, 737-738 (1953).</li><li>Wilkins, M. H. F., Stokes, A. R., Wilson, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+structure+of+deoxypentose+nucleic+acids.">Molecular structure of deoxypentose nucleic acids.</a> Nature. 171, 738-740 (1953).</li><li>Young, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+algorithm-guided+design+of+massive+strain+libraries,+applied+to+itaconic+acid+production+in+yeast.">Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast.</a> Metabolic Engineering. 48, 33-43 (2018).</li><li>Roubos, J. A., Pel, H. J., Meijrink, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Cloning Method. , (2013).</li><li>Mandel, M., Higa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium-dependent+bacteriophage+DNA+infection.">Calcium-dependent bacteriophage DNA infection.</a> Journal of Molecular Biology. 53 (1), 159-162 (1970).</li><li>Van Dijken, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+interlaboratory+comparison+of+physiological+and+genetic+properties+of+four+Saccharomyces+cerevisiae+strains.">An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains.</a> Enzyme and Microbial Technology. 26 (9-10), 706-714 (2000).</li><li>Gietz, R. D., Schiestl, R. H., Willems, A. R., Woods, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+transformation+of+intact+yeast+cells+by+the+LiAc/SS-DNA/PEG+procedure.">Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure.</a> Yeast. 11 (4), 355-360 (1995).</li><li>Hill, J., Donald, K. A., Griffiths, D. E., Donald, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DMSO-enhanced+whole+cell+yeast+transformation.">DMSO-enhanced whole cell yeast transformation.</a> Acids Research. 19 (20), 5791 (1991).</li><li>Looke, M., Kristjuhan, K., Kristjuhan, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+genomic+DNA+from+yeasts+for+PCR-based+applications.">Extraction of genomic DNA from yeasts for PCR-based applications.</a> Biotechniques. 50 (5), 325-328 (2011).</li><li>Tak, Y. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+and+multiplex+gene+regulation+using+CRISPR-Cpf1-based+transcription+factors.">Inducible and multiplex gene regulation using CRISPR-Cpf1-based transcription factors.</a> Nature Methods. 14 (12), 1163-1166 (2017).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+gene+editing+by+CRISPR-Cpf1+using+a+single+crRNA+array.">Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array.</a> Nature biotechnology. 35 (1), 31-34 (2017).</li><li>Swiat, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FnCpf1:+a+novel+and+efficient+genome+editing+tool+for+Saccharomyces+cerevisiae.">FnCpf1: a novel and efficient genome editing tool for Saccharomyces cerevisiae.</a> Nucleic Acids Research. 45 (21), 12585-12598 (2017).</li><li>Li, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cpf1-Assisted+Multiplex+Genome+Editing+and+Transcriptional+Repression+in+Streptomyces.">CRISPR-Cpf1-Assisted Multiplex Genome Editing and Transcriptional Repression in Streptomyces.</a> Applied Environmental Microbiology. 84 (18), 00827-00918 (2018).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+gene+regulation+by+CRISPR-ddCpf1.">Multiplex gene regulation by CRISPR-ddCpf1.</a> Cell Discovery. 3, 17018 (2017).</li><li>Gietz, R. D., Schiestl, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Frozen+competent+yeast+cells+that+can+be+transformed+with+high+efficiency+using+the+LiAc/SS+carrier+DNA/PEG+method.">Frozen competent yeast cells that can be transformed with high efficiency using the LiAc/SS carrier DNA/PEG method.</a> Nature Protocols. 2 (1), 1-4 (2007).</li><li>Perez, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GuideScan+software+for+improved+single+and+paired+CRISPR+guide+RNA+design.">GuideScan software for improved single and paired CRISPR guide RNA design.</a> Nature Biotechnology. 35 (4), 347-349 (2017).</li><li>Cox, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+Biology+Open+Language+Visual+(SBOL+Visual)+Version+2.0.">Synthetic Biology Open Language Visual (SBOL Visual) Version 2.0.</a> Journal of Integrative Bioinformatics. 15 (1), 1613-4516 (2018).</li></ol>

The authors declare that there is a conflict of interest. The authors have filed IP related to presented methods.

The provided protocol describes multiplex genome editing of S. cerevisiae using Cas12a from Lachnospiraceae bacterium ND2006 in combination with a single crRNA array and donor DNA. Design of the single crRNA array and donor DNA is explained in detail. In contrast to the well-established CRISPR/Cas9 system, the CRISPR/Cas12a has the unique additional ability of processing multiple crRNAs expressed from a single crRNA array13,33. Due to this feature, simultaneous editing of multiple targets is easier to set up and can be achieved in a single transformation. This single crRNA array approach was demonstrated before by Zetsche et al.34 who simultaneously edited up to four genes in mammalian cells using AsCas12a, and by Swiat et al.35 who introduced four DNA fragments into a yeast genome using FnCas12a. To our knowledge, a higher number of simultaneous genomic modifications using a Cas12a system has not been reported and the maximal limit of targets per single array for Cas12a is yet to be determined. Further research utilizing single crRNA arrays in combination with Cas12a includes multiplex transcriptional regulation in a wide range of organisms33,36,37.
There are some critical steps in the presented protocol. Carefully design all DNA sequences that are involved in the Cas12a genome editing experiment, especially in case when novel DNA sequences are introduced. Determine the functionality of new spacer sequences part of a crRNA, for example by a singleplex genome editing experiment as described by Verwaal et al.19 before combining them into a single crRNA array. Follow the recommendations for the preparation of transformation buffer solutions used in the Cas12a editing experiment to achieve a good transformation efficiency of yeast.
There are some optional modifications of the technique. It is recommended to use 1 &#181;g of each donor DNA, linearized pRN1120 or single crRNA array expression cassette in the transformation, although the use of a lower DNA amount is also expected to result in a satisfactory transformation efficiency. Perform a test transformation to determine whether lower DNA amounts can be used. The transformation of S. cerevisiae might be performed using a different method than the one described in this protocol, for example the protocol described by Gietz et al. (2007)38. The guide RNA recipient plasmid pRN1120 is suitable for the expression of a single crRNA and single crRNA array of different Cas12a variants (e.g., from Acidaminococcus spp. BV3L6 or Francisella novicida U112) as well as for expression of sgRNA in combination with Cas919. The donor DNA does not need to be limited to carotenoid gene expression cassettes and flanking regions that target donor DNA to the described INT1, INT2 and INT3 sites in genomic DNA. Any DNA of interest can be introduced, in a multiplex manner, into genomic DNA of the host by the design principles described in this protocol, or alternatively donor DNA can be used to delete DNA from a host genome. The modular structure of single crRNA array facilitates easy adjustment of spacer and direct repeat sequences. Modification of spacer sequences allows for a change of the intended integration locus which can be designed by one of the tools for identification of a genomic target site, e.g. GuideScan software 1.039. Instead of using large flanking sequences that contain connectors sequences, 50-bp of the flanking region can be included in the donor DNA sequences by incorporating these 50-bp flanking region sequences in the primers used in the PCR. In this case, in total just three instead of nine donor DNA fragments are required for a successful multiplex genome editing experiment.
In summary, this protocol provides step-by-step directions to perform multiplex genome editing in S.&#160;cerevisiae using Cas12a in combination with a single crRNA array approach. The protocol was demonstrated by multiplex genome editing using 9 donor DNA fragments and single crRNA array coding for three gRNAs. We show high overall editing frequencies between 50% and 94% for the three strain designs reported here. Concluding, the unique feature of Cas12a is the ability to process a single crRNA array into individual crRNAs in a cell, which makes Cas12a an excellent tool to enable multiplex genome editing and develop transcriptional regulation modules targeting multiple expression cassettes in one go. In the end, three strains were obtained producing carotenoids at a different level and colors in shades between yellow and orange. With those strains and a wild-type strain, we showed how an acoustic liquid handler can be used straightforwardly to make yeast pixel art &#8211; this in honor of Rosalind Franklin who contributed to the discovery of the DNA structure 65 years ago by her famous photo 5123.

CRISPR/Cas enzymes have unquestionably revolutionized molecular biology and been widely adopted as tools for engineering genomes at a speed that was previously unfeasible1. The first modification of a&#160;Saccharomyces cerevisiae genome by the CRISPR/Cas9 genome editing system was reported by DiCarlo et al.2, demonstrating successful gene knock-out and making point mutations using externally introduced oligonucleotides. Further yeast CRISPR toolbox developments included: transcriptional regulation by fusion of catalytically inactive dead Cas9 (dCas9) with transcriptional effector domains to enable activation and silencing of transcription3, application for both genome editing and regulatory functions for metabolic pathway engineering by simultaneous activation, repression and deletion4, deletion of large fragments from the S. cerevisiae genome5, and multiple-chromosome fusions6.
CRISPR/Cas genome editing systems find their origin in adaptive immune systems of bacteria and archaea and these systems have been adapted by molecular biologists for genome editing. Their functionality is based on the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) DNA regions encoding RNA responsible for the recognition of the foreign DNA or RNA and the CRISPR associated genes (Cas) which encodes RNA-guided endonucleases1,7,8,9. Based on the recent genome analysis of CRISPR/Cas systems it was proposed to divide the CRISPR/Cas systems into two classes, five types and 16 subtypes10. The two classes are distinguished based on the organization of effector complexes involved in target cleavage. Typically, CRISPR/Cas systems with a multi-subunit organisation are categorized as class 1, whereas single subunit effector complexes belong to class 210,11. In this paper, we explore the class 2 type V Cas12a, formerly called Cpf110,12, which is an alternative to the class 2 type II Cas9. Although Cas9 is well-characterized and widely used in research, Cas12a offers additional features12. Firstly, Cas12a forms a&#160;complex with CRISPR RNA (crRNA) of 42 to 44 nucleotides without requiring an additional trans-activating CRISPR RNA (tracrRNA). Therefore, a shorter guide RNA can be utilized in genome editing with CRISPR/Cas12a systems compared to CRISPR/Cas9. Secondly, the unique endonuclease and endoribonuclease activity of Cas12a enables maturation of its pre-crRNA13. This RNase activity allows for the encoding of multiple crRNAs on a single CRISPR crRNA array, whereas Cas9 requires the separate expression of each so-called single-guide RNA&#160;(sgRNA) or alternatively for example expression of an additional endonuclease (e.g., Csy4) in combination with recognition motifs for Csy4 surrounding each sgRNA14,15. Thirdly, Cas12a target site recognition requires a protospacer adjacent motif (PAM) at the 5&#8217;&#160;end from the target and cleaves after the +18/+23 position from its PAM resulting in cleaved DNA with sticky ends, whereas Cas9 requires a PAM located on the 3&#8217; end from the target and cleaves after the -3 position creating blunt end cuts in the DNA12. Fourthly, the consensus nucleotide sequence of the PAM differs between Cas12a ((T)TTV) and Cas9 (NGG), which makes Cas12a a promising candidate for targeting T-rich promoter and terminator sequences16. Finally, a recent study reported greater target specificity for Cas12a than for the native Cas917.
We present a protocol for using the CRISPR/Cas12a system for genome editing of S. cerevisiae with a particular focus on the introduction of multiple DNA expression cassettes into independent genomic loci simultaneously (multiplex genome editing) using a single crRNA array. The key steps of the protocol are depicted in Figure 1. As a proof of concept, the CRISPR/Cas12a system was applied for introduction of three expression cassettes into the genome of S. cerevisiae which enable the production of &#946;-carotene18 as schematically shown in Figure 2. Production of &#946;-carotene affects the phenotype of S. cerevisiae: i.e., upon successful introduction of all three heterologous genes required for carotenoids biosynthesis, the white S. cerevisiae cells turn yellow or orange, depending on the expression strength of each gene&#8217;s promoter. Due to the simple visual read-out of this pathway, it has been introduced to develop advanced CRISPR-based systems and methods for genome editing19,20. In this work, expression cassettes encoding the carotenoid genes crtE, crtYB and crtI have been constructed using a Golden Gate cloning (GGC) approach21 with heterologous promoters and homologous terminators used to drive expression of the genes. The expression cassettes are surrounded by unique 50-base pairs (bp) sequences, called connectors, that allow for in vivo assembly with integration flank DNA sequences (flanking regions) with the same 50-bp sequences, and subsequent integration into the genomic DNA of yeast at the position determined by the flanking regions. By using different promoter strengths, strains with different levels of carotenoids production were obtained resulting in variation in color of the cells. These strains - inspired by the &#8220;Yeast Art Project&#8221;22 - were used in a spotting setup with an acoustic liquid handler to create a 4-color high-resolution &#8220;yeast photograph&#8221; of Rosalind Franklin. Franklin (1920-1958) was an English chemist and X-ray crystallographer well known for her contribution to the discovery of the DNA structure by Photo 5123,24,25.

<table border="0" cellpadding="0" cellspacing="0" style="width:581px;" width="581">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td>Chemicals specific for the protocol</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">1 Kb Plus DNA Ladder</td>
			<td style="width:144px;">Thermo Fisher Scientific</td>
			<td>10787018</td>
			<td style="width:175px;">Electrophoresis</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Ampicillin sodium salt</td>
			<td style="width:144px;">Sigma Aldrich</td>
			<td>A9518</td>
			<td style="width:175px;">Selection of E. coli transformants</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">BsaI-HF (20 U/&#181;l)</td>
			<td style="width:144px;">New England BioLabs</td>
			<td>R353L</td>
			<td style="width:175px;">Golden Gate Cloning</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:156px;">Cell Lysis Solution (from kit Puregene Yeast/Bact. Kit B)</td>
			<td style="width:144px;">QIAGEN</td>
			<td>854016</td>
			<td style="width:175px;">Isolation of genomic DNA from S. cerevisiae</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">CutSmart Buffer</td>
			<td style="width:144px;">New England BioLabs</td>
			<td>B7204S</td>
			<td style="width:175px;">Linearization of pRN1120</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:156px;">Deoxyribonucleic acid sodium salt from salmon testes</td>
			<td style="width:144px;">Sigma Aldrich</td>
			<td>D1626</td>
			<td style="width:175px;">Transfromation of 
			S. cerevisiae (carrier DNA)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">dNTPs</td>
			<td style="width:144px;">Invitrogen</td>
			<td>10297018</td>
			<td style="width:175px;">PCRs</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">EcoRI-HF</td>
			<td style="width:144px;">New England BioLabs</td>
			<td>R3101S</td>
			<td style="width:175px;">Linearization of pRN1120</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Ethanol absolute for analysis</td>
			<td style="width:144px;">Merck</td>
			<td>100983</td>
			<td style="width:175px;">Isolation of genomic DNA from S. cerevisiae</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Ethylenediamine-tetraacetic acid</td>
			<td style="width:144px;">Sigma Aldrich</td>
			<td>ED</td>
			<td style="width:175px;">Transformation of 
			S. cerevisiae</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">G418 disulfate salt</td>
			<td style="width:144px;">Sigma Aldrich</td>
			<td>A1720</td>
			<td style="width:175px;">Selection of S. cerevisiae transformants</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Histodenz</td>
			<td style="width:144px;">Sigma Aldrich</td>
			<td>D2158&#160;</td>
			<td style="width:175px;">Yeast pixel art</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Isopropanol</td>
			<td style="width:144px;">Merck</td>
			<td>100993</td>
			<td style="width:175px;">Isolation of genomic DNA from S. cerevisiae</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Lithium acetate dihydrate</td>
			<td style="width:144px;">Sigma Aldrich</td>
			<td>L6883</td>
			<td style="width:175px;">Transformation of 
			S. cerevisiae</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Nancy-520 DNA Gel Stain</td>
			<td style="width:144px;">Sigma Aldrich</td>
			<td>1494</td>
			<td style="width:175px;">Electrophoresis</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:156px;">NEB10 competent E. coli cells</td>
			<td style="width:144px;">New England BioLabs</td>
			<td>C3019H</td>
			<td style="width:175px;">Transformation of E. coli: dx.doi.org/10.17504/protocols.io.nkvdcw6</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Nourseothricin</td>
			<td style="width:144px;">Jena Bioscience</td>
			<td>AB102</td>
			<td style="width:175px;">Selection of S. cerevisiae transformants</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Phusion buffer</td>
			<td style="width:144px;">New England BioLabs</td>
			<td>M0530L</td>
			<td style="width:175px;">PCRs</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Phusion High-Fidelity DNA Polymerase</td>
			<td style="width:144px;">New England BioLabs</td>
			<td>M0530L</td>
			<td style="width:175px;">PCRs</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Polyethylene glycol 4000</td>
			<td style="width:144px;">Merck</td>
			<td>7490</td>
			<td style="width:175px;">Transformation of 
			S. cerevisiae</td>
		</tr>
		<tr height="80">
			<td height="80" style="height:80px;width:156px;">Protein Precipitation Solution (10 M NH4AC) (from kit Puregene Yeast/Bact. Kit B)</td>
			<td style="width:144px;">QIAGEN</td>
			<td>854016</td>
			<td style="width:175px;">Isolation of genomic DNA from S. cerevisiae</td>
		</tr>
		<tr height="38">
			<td height="38" style="height:39px;width:156px;">Purple loading dye</td>
			<td style="width:144px;">New England BioLabs</td>
			<td>B7024S</td>
			<td style="width:175px;">Electrophoresis</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:144px;">QIAGEN</td>
			<td>27106</td>
			<td style="width:175px;">Purification of plasmids</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">RNase coctail enzyme mix</td>
			<td style="width:144px;">Thermo Fisher Scientific</td>
			<td>AM2286</td>
			<td style="width:175px;">Isolation of genomic DNA from S. cerevisiae</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">T4 DNA ligase buffer</td>
			<td style="width:144px;">Invitrogen</td>
			<td>46300-018</td>
			<td style="width:175px;">Golden Gate Cloning</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">T4 DNA Ligase (1 U/&#181;l)</td>
			<td style="width:144px;">Invitrogen</td>
			<td>1705218</td>
			<td style="width:175px;">Golden Gate Cloning</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">UltraPure Agarose</td>
			<td style="width:144px;">Invitrogen</td>
			<td>16500500</td>
			<td style="width:175px;">Electrophoresis</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:156px;">Wizard SV Gel and PCR Clean-Up System Kit</td>
			<td style="width:144px;">Promega</td>
			<td>A9282</td>
			<td style="width:175px;">Purification of PCR products and linearized pRN1120</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Xhol</td>
			<td style="width:144px;">New England BioLabs</td>
			<td>R0146S</td>
			<td style="width:175px;">Linearization of pRN1120</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:156px;">Zymolyase 50 mg/ml (5 units/&#181;L)</td>
			<td style="width:144px;">Zymo Research</td>
			<td>E1006</td>
			<td style="width:175px;">Isolation of genomic DNA from S. cerevisiae (yeast lysis enzyme)</td>
		</tr>
		<tr height="101">
			<td height="101" style="height:101px;width:156px;">Zymolyase storage buffer</td>
			<td style="width:144px;">Zymo Research</td>
			<td>E1004-B</td>
			<td style="width:175px;">Isolation of genomic DNA from S. cerevisiae (necessary for the preparation of yeast lysis enzyme)</td>
		</tr>
		<tr height="21">
			<td>Chemicals of general use</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">2*Peptone-Yeast extract (PY) agar</td>
			<td></td>
			<td></td>
			<td style="width:175px;">Plate growth of E. coli</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">2*PY medium</td>
			<td></td>
			<td></td>
			<td style="width:175px;">Cultivation of E. coli</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Demineralized water</td>
			<td></td>
			<td></td>
			<td style="width:175px;">Transformation of 
			S. cerevisiae</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">ELFO buffer</td>
			<td></td>
			<td></td>
			<td style="width:175px;">Electrophoresis</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">MQ</td>
			<td></td>
			<td></td>
			<td style="width:175px;">Multiple steps</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Physiological salt solution</td>
			<td></td>
			<td></td>
			<td style="width:175px;">Transformation of 
			S. cerevisiae</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:156px;">TE buffer</td>
			<td></td>
			<td></td>
			<td style="width:175px;">Storage of DNA, transformation of S. cerevisiae</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:156px;">Yeast extract-peptone-dextrose (YEPD; 2% glucose) medium</td>
			<td></td>
			<td></td>
			<td style="width:175px;">Cultivation of S. cerevisiae</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:156px;">YEPD (2% glucose) agar</td>
			<td></td>
			<td></td>
			<td style="width:175px;">Plate growth of 
			S. cerevisiae</td>
		</tr>
		<tr height="21">
			<td>Consumables</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Eppendorf tubes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Falcon tubes (50 mL)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Microplate 96 wells</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Petri dishes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Pipette tips 0.5 - 10 &#181;L</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Pipette tips 10 - 200 &#181;L</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Pipette tips 100 - 1000 &#181;L</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Shake flasks (500 mL)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:156px;">Sterile filters</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Centrifuge (Falcon tubes)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Echo 525 acoustic liquid handler</td>
			<td style="width:144px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Incubator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">NanoDrop</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Set for eletrophoresis</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:156px;">Spectrophotometer</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">Table centrifuge (Eppendorfs tubes)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:156px;">Thermocycler</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td>Plasmids</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pCSN067</td>
			<td>Addgene</td>
			<td>ID 101748</td>
			<td>https://www.addgene.org/</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pRN1120</td>
			<td>Addgene</td>
			<td>ID 101750</td>
			<td>https://www.addgene.org/</td>
		</tr>
		<tr height="21">
			<td>Strains</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:156px;">S. cerevisiae strain 
			CEN.PK113-7D</td>
			<td style="width:144px;">EUROSCARF collection</td>
			<td></td>
			<td>http://www.euroscarf.de</td>
		</tr>
	</tbody>
</table>

crispr/cas12a multiplex genome editing of saccharomyces cerevisiae and the creation of yeast pixel art

High efficiency, ease of use and versatility of the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system has facilitated advanced genetic modification of Saccharomyces cerevisiae, a model organism and workhorse in industrial biotechnology. CRISPR-associated protein 12a (Cas12a), an RNA-guided endonuclease with features distinguishable from Cas9 is applied in this work, further extending the molecular toolbox for genome editing purposes. A benefit of the CRISPR/Cas12a system is that it can be used in multiplex genome editing with multiple guide RNAs expressed from a single transcriptional unit (single CRISPR RNA (crRNA) array). We present a protocol for multiplex integration of multiple heterologous genes into independent loci of the S. cerevisiae genome using the CRISPR/Cas12a system with multiple crRNAs expressed from a single crRNA array construct. The proposed method exploits the ability of S. cerevisiae to perform in vivo recombination of DNA fragments to assemble the single crRNA array into a plasmid that can be used for transformant selection, as well as the assembly of donor DNA sequences that integrate into the genome at intended positions. Cas12a is pre-expressed constitutively, facilitating cleavage of the S.&#160;cerevisiae genome at the intended positions upon expression of the single crRNA array. The protocol includes the design and construction of a single crRNA array and donor DNA expression cassettes, and exploits an integration approach making use of unique 50-bp DNA connectors sequences and separate integration flank DNA sequences, which simplifies experimental design through standardization and modularization and extends the range of applications. Finally, we demonstrate a straightforward technique for creating yeast pixel art with an acoustic liquid handler using differently colored carotenoid producing yeast strains that were constructed.

The protocol for multiplex genome editing using CRISRP/Cas12a was demonstrated by constructing three carotenoid producing S. cerevisiae strains expressing the crtE, crtYB and crtI genes using heterologous promoters of high, medium and low strength: strain 1, 2 and, 3 respectively (Supplementary Table 3). Construction of these strains required generation of three donor DNA expression cassettes and six flanking regions per strain for targeting to three different loci in genomic DNA (shown in Figure 2B). As described herein, promoter, open reading frame, terminator and two contiguous 50-bp connectors sequences were assembled into an expression cassette via a Golden Gate Cloning reaction and the assembly was verified by PCR (Figure 3A). The single crRNA array was ordered as a synthetic DNA fragment and was amplified by PCR (Figure 3B). The recipient plasmid for the single crRNA array (plasmid pRN1120) was linearized with EcoRI-HF and XhoI and linearization was confirmed by electrophoresis (Figure 3C). The design and nucleotide sequences of the introduced donor DNA expression cassettes and flanking regions are shown in Supplementary Table 3 and Supplementary Table 4. The sequence of single crRNA array expression cassettes is provided in Supplementary Table 1. Functionality of the spacers included in the single crRNA array was tested beforehand by singleplex genome editing with individual crRNAs19.
The efficiency of genome editing using Cas12a was firstly evaluated based on the number of colored colonies obtained after transformation (Table 1, Figure 4). The editing efficiency of the three constructed strains varied from 50% to 94%. Notably, introduction of expression cassettes used to generate strain 1 displayed the lowest editing efficiency, possibly caused by the nature of the donor DNA (i.e., these expression cassettes encode crtE, crtYB and crtI from three high strength promoters). Secondly, correct integration of the three donor DNA expression cassettes at the intended loci on the genomic DNA was confirmed by PCR (Figure 5). Primers were designed in such a way that PCR products were obtained when correct integration of donor DNA at the intended locus occurred. For each transformation experiment, eight colonies were picked from the transformation plate and tested (note that only three are presented in Figure 5). In general, out of 8 colonies tested per donor DNA, correct integration of the crtE donor DNA at the INT1 locus, crtYB at the INT2 locus and crtI at the INT3 locus was confirmed in &#62;90% of the transformants. These results demonstrate the CRISPR/Cas12a system in combination with a single crRNA array enables efficient multiplex editing of the S. cerevisiae genome at multiple loci simultaneously.
Additionally, we demonstrate the creation of &#8220;yeast pixel art&#8221; using the three carotenoid producing strains that were constructed together with a non-colored wild-type strain. Starting from a black and white picture of Rosalind Franklin (Figure 6A), a 4-color picture (Figure 6B) and spotting list was created which was then used to spot the four different yeast strains on an agar microplate using an acoustic liquid handler, resulting in a high-resolution &#8220;yeast painting&#8221; of Rosalind Franklin (Figure 6C,D,E).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59350/59350fig1v5.jpg" /> 
Figure 1: Workflow of the protocol for CRISPR/Cas12a multiplex genome editing in S. cerevisiae. The workflow includes crucial steps of the presented method. For details see the Protocol. <a href="https://www.jove.com/files/ftp_upload/59350/59350fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59350/59350fig2.jpg" /> 
Figure 2: Scheme of CRISPR/Cas12a multiplex genome editing using a single crRNA array. (A) The single crRNA array is composed of three crRNAs units in their mature form, a 20-bp direct repeat specific for LbCas12a (grey squares) with a 23-bp guide sequence (colored diamonds). Expression of the crRNA array is enabled by the SNR52 promoter and SUP4 terminator. Transformation of S. cerevisiae with a linearized pRN1120 and the single crRNA array expression cassette containing homology with pRN1120 (diagonal stripes) allows for in vivo recombination into a circular plasmid in cells pre-expressing LbCas12a. The single crRNA array is subsequently processed by Cas12a. (B) Cas12a is directed to the intended INT1, INT2 and INT3 genomic target sites and creates double stranded breaks. In the transformation mixture, donor DNA consisting of flanking regions and the carotenoid gene expression cassette were included. Donor DNA assemblies were targeted to one stretch of DNA in genomic DNA around the INT1 (crtE), INT2 (crtYB) and INT3 (crtI) loci by in vivo recombination due to the presence of 50-bp homologous connectors sequences, indicated as 5, A, B, C, D or E. P1&#8211;P3, different promoters; T1&#8211;T3, different terminators. This figure has been modified from Verwaal et al. 201819. Genetic constructs shown using Synthetic Biology Open Language (SBOL) Visual symbols40. <a href="https://www.jove.com/files/ftp_upload/59350/59350fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59350/59350fig3.jpg" /> 
Figure 3: PCR verifying the genome editing experiments. (A) Verification of Golden Gate Cloning reactions of assembled donor DNA cassettes. Obtained results are in agreement with expected lengths. (B) PCR of the single crRNA array. (C) Linearization of plasmid pRN1120. <a href="https://www.jove.com/files/ftp_upload/59350/59350fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59350/59350fig4.jpg" /> 
Figure 4: Plates of S. cerevisiae transformations using the multiplex genome editing approach. (A) Strain&#160;1 expressing crtE, crtYB and crtI from three strong promoters (dark orange colonies). (B) Strain 2 expressing crtE, crtYB and crtI from three medium strength promoters (orange colonies). (C) Strain 3 expressing crtE, crtYB and crtI from three low strength promoters (yellow colonies). <a href="https://www.jove.com/files/ftp_upload/59350/59350fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/59350/59350fig5.jpg" /> 
Figure 5: PCR verifying integration of the donor DNA expression cassettes at the intended loci within the genomic DNA. (A) Verification of three colonies of the strain 1. (B) Verification of three colonies of the strain 2. (C) Verification of three colonies of the strain 3. <a href="https://www.jove.com/files/ftp_upload/59350/59350fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/59350/59350fig6.jpg" /> 
Figure 6: Yeast pixel art of Rosalind Franklin. (A) Black and white RGB photo of 220 &#215; 280 pixels of Rosalind Franklin that was used as a template. (B) Computer conversion of the black and white photo of Rosalind Franklin into a 4-color 64 &#215; 96 pixel list. (C) Photo of yeast pixel art with 64 &#215; 96 yeast colonies with a zoomed-in section. (D)&#160;Photo of an acoustic liquid handler with two full grown plates. (E) Photo of a&#160;full grown microplate with 64 &#215; 96 yeast colonies. <a href="https://www.jove.com/files/ftp_upload/59350/59350fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td></td>
			<td>Strain 1</td>
			<td>Strain 2</td>
			<td>Strain 3</td>
		</tr>
		<tr>
			<td>Colored colonies</td>
			<td>16</td>
			<td>279</td>
			<td>220</td>
		</tr>
		<tr>
			<td>White colonies</td>
			<td>16</td>
			<td>18</td>
			<td>18</td>
		</tr>
		<tr>
			<td>Total colonies</td>
			<td>32</td>
			<td>297</td>
			<td>238</td>
		</tr>
		<tr>
			<td>Efficiency</td>
			<td>50%</td>
			<td>94%</td>
			<td>92%</td>
		</tr>
	</tbody>
</table>
Table 1: Editing efficiency of the multiplex genome editing approach.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>crRNA array sequencea,b,c,d,e,f</td>
		</tr>
		<tr>
			<td>CATGTTTGACAGCTTATCATCGATAATCCGGAGCTAGCATGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGTCTTTGAAAA 
			GATAATGTATGATTATGCTTTCACTCATATTTATACAGAAACTTGATGTTTTCTTTCGAGTATATACAAGG 
			TGATTACATGTACGTTTGAAGTACAACTCTAGATTTTGTAGTGCCCTCTTGGGCTAGCGGTAAAGGTGCGCA 
			TTTTTTCACACCCTACAATGTTCTGTTCAAAAGATTTTGGTCAAACGCTGTAGAAGTGAAAGTTGGTGCGC 
			ATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCAATTTCTACTAAGTGTAGAT 
			CTGGTGGGAGAGAAAGCTTATGAAATTTCTACTAAGTGTAGATGTGCCGTAC 
			GCCGGAGCCGACGGAATTTCTACTAAGTGTAGATTGCCCCTCTTATACGATTATATTTT 
			TTTTTGTTTTTTATGTCTGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGG 
			GTTAATTCCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTG</td>
		</tr>
		<tr>
			<td>a. Homology to pRN1120 (bold). 
			b. SNR52 promoter (italics). 
			c. Genomic target sequences (underlined). 
			d. Guide direct repeats specific for LbCas12a (italics, bold). 
			e. SUP4 terminator (italics). 
			f. Homology to pRN1120 (bold).</td>
		</tr>
	</tbody>
</table>
Supplementary Table 1: Single crRNA array for LbCas12a containing homology with plasmid pRN1120.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Sequencea</td>
			<td>Descriptionb</td>
			<td>Used in point</td>
		</tr>
		<tr>
			<td>KC-101</td>
			<td>CATGTTTGACAGCTTATCATC</td>
			<td>FW primer for amplification of single crRNA array</td>
			<td>2.1.4</td>
		</tr>
		<tr>
			<td>KC-102</td>
			<td>CACACAGGAAACAGCTATGAC</td>
			<td>RV primer for amplification of single crRNA array</td>
			<td>2.1.4</td>
		</tr>
		<tr>
			<td>KC-103</td>
			<td>AAGCGACTTCCAATCGCTTTGC</td>
			<td>FW primer for amplification of donor DNA with connector 5</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-104</td>
			<td>AAAGCAAAGGAAGGAGAGAAC</td>
			<td>RV primer for amplification of donor DNA with connector A</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-105</td>
			<td>CGGATCGATGTACACAACCG</td>
			<td>FW primer for amplification of donor DNA with connector B</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-106</td>
			<td>CAACAGGAGGCGGATGGATATAC</td>
			<td>RV primer for amplification of donor DNA with connector C</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-107</td>
			<td>AACGTTGTCCAGGTTTGTATCC</td>
			<td>FW primer for amplification of donor DNA with connector D</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-108</td>
			<td>AGGTACAACAAGCACGACCG</td>
			<td>RV primer for amplification of donor DNA with connector E</td>
			<td>3.6.1</td>
		</tr>
		<tr>
			<td>KC-109</td>
			<td>CACTATAGCAATCTGGCTATATG</td>
			<td>FW primer for amplification of INT1 5&#39; with connector 5</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-110</td>
			<td>AAACGCCTGTGGGTGTGGTAC 
			TGGATATGCAAAGCGATTGGAA 
			GTCGCTTGACTCCTCTGCCGTC 
			ATTCC</td>
			<td>RV primer for amplification of INT1 5&#39; with connector 5</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-111</td>
			<td>TTGCCCATCGAACGTACAAG 
			TACTCCTCTGTTCTCTCCTTCCTT 
			TGCTTTAAGCGTTGAAGTTTCCTC 
			TTTG</td>
			<td>FW primer for amplification of INT1 3&#39; with connector A</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-112</td>
			<td>TGTCAACTGGAGAGCTATCG</td>
			<td>RV primer for amplification of INT1 3&#39; with connector A</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-113</td>
			<td>AGAAGATTTCTCTTCAATCTC</td>
			<td>FW primer for amplification of INT2 5&#39; with connector B</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-114</td>
			<td>TGCTAAGATTTGTGTTCGTT 
			TGGGTGCAGTCGGTTGTGTACAT 
			CGATCCGCCCTTATCAAGGATACC 
			TGGTTG</td>
			<td>RV primer for amplification of INT2 5&#39; with connector B</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-115</td>
			<td>ACGCTTTCCGGCATCTTCCA 
			GACCACAGTATATCCATCCGCCT 
			CCTGTTGGGCGATTACACAAGCG 
			GTGG</td>
			<td>FW primer for amplification of INT2 3&#39; with connector C</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-116</td>
			<td>TCTCCTCTTCGATGACCGGG</td>
			<td>RV primer for amplification of INT2 3&#39; with connector C</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-117</td>
			<td>GGTCGTTTTTGTGCAGCATATTG</td>
			<td>FW primer for amplification of INT3 5&#39; with connector D</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-118</td>
			<td>GCGGAATATTGGCGGAACGG 
			ACACACGTGGATACAAACCTG 
			GACAACGTTTTCCAAGGAGGTG 
			AAGAACG</td>
			<td>RV primer for amplification of INT3 5&#39; with connector D</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-119</td>
			<td>AAATAACCACAAACATCCTT 
			CCCATATGCTCGGTCGTGCTTGTT 
			GTACCTGATGGGACGTCAGCACT 
			GTAC</td>
			<td>FW primer for amplification of INT3 3&#39; with connector E</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-120</td>
			<td>GAGCTTACTCTATATATTCATTC</td>
			<td>RV primer for amplification of INT3 3&#39; with connector E</td>
			<td>4.4</td>
		</tr>
		<tr>
			<td>KC-121</td>
			<td>GTTACTAAACTGGAACTGTCCG</td>
			<td>FW primer for verification of integration of con5-crtE-conA to INT1 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-122</td>
			<td>CACTGCTAACTACGTTTACTTC</td>
			<td>FW primer for verification of integration of con5-crtE-conA to INT1 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-123</td>
			<td>CACTGGAACTTGAGCTTGAG</td>
			<td>FW primer for verification of integration of conB-crtYB-conC to INT2 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-124</td>
			<td>GTCTCCAGCTGAATTGGTCC</td>
			<td>FW primer for verification of integration of conB-crtYB-conC to INT2 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-125</td>
			<td>CTCTCATGAAGCAGTCAAGTC</td>
			<td>FW primer for verification of integration of conD-crtI-conE to INT3 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-126</td>
			<td>GATCGGTCAATTAGGTGAAG</td>
			<td>FW primer for verification of integration of conD-crtI-conE to INT3 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-127</td>
			<td>CCTTGTCCAAGTAGGTGTCC</td>
			<td>RV primer for verification of integration of con5-crtE-conA to INT1 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-128</td>
			<td>GCTGTCATGATCTGTGATAAC</td>
			<td>RV primer for verification of integration of con5-crtE-conA to INT1 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-129</td>
			<td>CTGGCAATGTTGACCAATTGC</td>
			<td>RV primer for verification of integration of conB-crtYB-conC to INT2 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-130</td>
			<td>CCAACGTGCCTTAAAGTCTG</td>
			<td>RV primer for verification of integration of conB-crtYB-conC to INT2 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-131</td>
			<td>CCTTACCTTCTGGAGCAGCAG</td>
			<td>RV primer for verification of integration of conD-crtI-conE to INT3 5&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td>KC-132</td>
			<td>CTGGTTACTTCCCTAAGACTG</td>
			<td>RV primer for verification of integration of conD-crtI-conE to INT3 3&#39;</td>
			<td>7.4.1</td>
		</tr>
		<tr>
			<td></td>
			<td>a. Bold sequences denote connector sequences. 
			b. Forward and reverse primers are designated as FW and RV, respectively.</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>
Supplementary Table 2: Primer sequences.
<img alt="Supplementary Table 3" src="/files/ftp_upload/59350/59350suptable3.jpg" /> 
Supplementary Table 3: Design of constructed strains.
<img alt="Supplementary Table 4" src="/files/ftp_upload/59350/59350suptable4.jpg" /> 
Supplementary Table 4: Sequences of donor DNA expression cassettes and flaking regions. <a href="https://www.jove.com/files/ftp_upload/59350/Suppl_Table_4.docx" target="_blank">Please click here to download this file.</a>

Watch this Scientific Journal Video about CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art at JoVE.com

CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art

The CRISPR/Cas12a system in combination with a single crRNA array enables efficient multiplex editing of the S.&#160;cerevisiae genome at multiple loci simultaneously. This is demonstrated by constructing carotenoid producing yeast strains which are subsequently used to create yeast pixel art.

CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art

High efficiency, ease of use and versatility of the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) ...

crisprcas12a-multiplex-genome-editing-saccharomyces-cerevisiae

Research

JoVE Journal

Bioengineering

16.7K Views.  DSM Biotechnology Center. The CRISPR/Cas12a system in combination with a single crRNA array enables efficient multiplex editing of the S. cerevisiae genome at multiple loci simultaneously. This is demonstrated by constructing carotenoid producing yeast strains which are subsequently used to create yeast pixel art.

Video: CRISPR/Cas12a Multiplex Genome Editing of Saccharomyces cerevisiae and the Creation of Yeast Pixel Art

Plasma Lithography Surface Patterning for Creation of Cell Networks

Systematic manipulation of a cell microenvironment with micro- and nanoscale resolution is often required for deciphering various cellular and molecular phenomena. To address this requirement, we have developed a plasma lithography technique to manipulate the cellular microenvironment by creating a patterned surface with feature sizes ranging from 100 nm to millimeters. The goal of this technique is to be able to study, in a controlled way, the behaviors of individual cells as well as groups of cells and their interactions.
This plasma lithography method is based on selective modification of the surface chemistry on a substrate by means of shielding the contact of low-temperature plasma with a physical mold. This selective shielding leaves a chemical pattern which can guide cell attachment and movement. This pattern, or surface template, can then be used to create networks of cells whose structure can mimic that found in nature and produces a controllable environment for experimental investigations. The technique is well suited to studying biological phenomenon as it produces stable surface patterns on transparent polymeric substrates in a biocompatible manner. The surface patterns last for weeks to months and can thus guide interaction with cells for long time periods which facilitates the study of long-term cellular processes, such as differentiation and adaption. The modification to the surface is primarily chemical in nature and thus does not introduce topographical or physical interference for interpretation of results. It also does not involve any harsh or toxic substances to achieve patterning and is compatible for tissue culture. Furthermore, it can be applied to modify various types of polymeric substrates, which due to the ability to tune their properties are ideal for and are widely used in biological applications. The resolution achievable is also beneficial, as isolation of specific processes such as migration, adhesion, or binding allows for discrete, clear observations at the single to multicell level.
This method has been employed to form diverse networks of different cell types for investigations involving migration, signaling, tissue formation, and the behavior and interactions of neurons arraigned in a network.

A versatile plasma lithography technique has been developed to generate stable surface patterns for guiding cellular attachment. This technique can be applied to create cell networks including those that mimic natural tissues and has been used for studying several, distinct cell types.

Systematic manipulation of a cell microenvironment with micro- and nanoscale resolution is often required for deciphering various cellular and molecular ...

Lensfree On-chip Tomographic Microscopy Employing Multi-angle Illumination and Pixel Super-resolution

Tomographic imaging has been a widely used tool in medicine as it can provide three-dimensional (3D) structural information regarding objects of different size scales. In micrometer and millimeter scales, optical microscopy modalities find increasing use owing to the non-ionizing nature of visible light, and the availability of a rich set of illumination sources (such as lasers and light-emitting-diodes) and detection elements (such as large format CCD and CMOS detector-arrays). Among the recently developed optical tomographic microscopy modalities, one can include optical coherence tomography, optical diffraction tomography, optical projection tomography and light-sheet microscopy. 1-6 These platforms provide sectional imaging of cells, microorganisms and model animals such as C. elegans, zebrafish and mouse embryos.
Existing 3D optical imagers generally have relatively bulky and complex architectures, limiting the availability of these equipments to advanced laboratories, and impeding their integration with lab-on-a-chip platforms and microfluidic chips. To provide an alternative tomographic microscope, we recently developed lensfree optical tomography (LOT) as a high-throughput, compact and cost-effective optical tomography modality. 7 LOT discards the use of lenses and bulky optical components, and instead relies on multi-angle illumination and digital computation to achieve depth-resolved imaging of micro-objects over a large imaging volume. LOT can image biological specimen at a spatial resolution of &lt;1 &mu;m x &lt;1 &mu;m x &lt;3 &mu;m in the x, y and z dimensions, respectively, over a large imaging volume of 15-100 mm3, and can be particularly useful for lab-on-a-chip platforms.

Lensfree optical tomography is a three-dimensional microscopy technique that offers a spatial resolution of &lt;1 &mu;m &times; &lt;1 &mu;m &times; &lt;3 &mu;m in x, y and z dimensions, respectively, over a large imaging-volume of 15-100 mm3, which can be particularly useful for integration with lab-on-a-chip platforms.

Tomographic imaging has been a widely used tool in medicine as it can provide three-dimensional (3D) structural information regarding objects of different ...

Continuous High-resolution Microscopic Observation of Replicative Aging in Budding Yeast

We demonstrate the use of a simple microfluidic setup, in which single budding yeast cells can be tracked throughout their entire lifespan. The microfluidic chip exploits the size difference between mother and daughter cells using an array of micropads. Upon loading, cells are trapped underneath these micropads, because the distance between the micropad and cover glass is similar to the diameter of a yeast cell (3-4 &mu;m). After the loading procedure, culture medium is continuously flushed through the chip, which not only creates a constant and defined environment throughout the entire experiment, but also flushes out the emerging daughter cells, which are not retained underneath the pads due to their smaller size. The setup retains mother cells so efficiently that in a single experiment up to 50 individual cells can be monitored in a fully automated manner for 5 days or, if necessary, longer. In addition, the excellent optical properties of the chip allow high-resolution imaging of cells during the entire aging process.

We describe here the operation of a microfluidic device that allows continuous and high-resolution microscopic imaging of single budding yeast cells during their complete replicative and/or chronological lifespan.

We demonstrate the use of a simple microfluidic setup, in which single budding yeast cells can be tracked throughout their entire lifespan. The ...

Techniques for the Evolution of Robust Pentose-fermenting Yeast for Bioconversion of Lignocellulose to Ethanol

Lignocellulosic biomass is an abundant, renewable feedstock useful for production of fuel-grade ethanol and other bio-products. Pretreatment and enzyme saccharification processes release sugars that can be fermented by yeast. Traditional industrial yeasts do not ferment xylose (comprising up to 40% of plant sugars) and are not able to function in concentrated hydrolyzates. Concentrated hydrolyzates are needed to support economical ethanol recovery, but they are laden with toxic byproducts generated during pretreatment. While detoxification methods can render hydrolyzates fermentable, they are costly and generate waste disposal liabilities. Here, adaptive evolution and isolation techniques are described and demonstrated to yield derivatives of the native Scheffersomyces stipitis strain NRRL Y-7124 that are able to efficiently convert hydrolyzates to economically recoverable ethanol despite adverse culture conditions. Improved individuals are enriched in an evolving population using multiple selection pressures reliant on natural genetic diversity of the S. stipitis population and mutations induced by exposures to two diverse hydrolyzates, ethanol or UV radiation. Final evolution cultures are dilution plated to harvest predominant isolates, while intermediate populations, frozen in glycerol at various stages of evolution, are enriched on selective media using appropriate stress gradients to recover most promising isolates through dilution plating. Isolates are screened on various hydrolyzate types and ranked using a novel procedure involving dimensionless relative performance index (RPI) transformations of the xylose uptake rate and ethanol yield data. Using the RPI statistical parameter, an overall relative performance average is calculated to rank isolates based on multiple factors, including culture conditions (varying in nutrients and inhibitors) and kinetic characteristics. Through application of these techniques, derivatives of the parent strain had the following improved features in enzyme saccharified hydrolyzates at pH 5-6: reduced initial lag phase preceding growth, reduced diauxic lag during glucose-xylose transition, significantly enhanced fermentation rates, improved ethanol tolerance and accumulation to 40 g/L.

Adaptive evolution and isolation techniques are described and demonstrated to yield derivatives of Scheffersomyces stipitis strain NRRL Y-7124 that are able to rapidly consume hexose and pentose mixed sugars in enzyme saccharified undetoxified hydrolyzates and to accumulate over 40 g/L ethanol.

Lignocellulosic biomass is an abundant, renewable feedstock useful for production of fuel-grade ethanol and other bio-products. Pretreatment and enzyme ...

Efficient Generation and Editing of Feeder-free IPSCs from Human Pancreatic Cells Using the CRISPR-Cas9 System

Embryonic and induced pluripotent stem cells can self-renew and differentiate into multiple cell types of the body. The pluripotent cells are thus coveted for research in regenerative medicine and are currently in clinical trials for eye diseases, diabetes, heart diseases, and other disorders. The potential to differentiate into specialized cell types coupled with the recent advances in genome editing technologies including the CRISPR/Cas system have provided additional opportunities for tailoring the genome of iPSC for varied applications including disease modeling, gene therapy, and biasing pathways of differentiation, to name a few. Among the available editing technologies, the CRISPR/Cas9 from Streptococcus pyogenes has emerged as a tool of choice for site-specific editing of the eukaryotic genome. The CRISPRs are easily accessible, inexpensive, and highly efficient in engineering targeted edits. The system requires a Cas9 nuclease and a guide sequence (20-mer) specific to the genomic target abutting a 3-nucleotide &#34;NGG&#34; protospacer-adjacent-motif (PAM) for targeting Cas9 to the desired genomic locus, alongside a universal Cas9 binding tracer RNA (together called single guide RNA or sgRNA). Here we present a step-by-step protocol for efficient generation of feeder-independent and footprint-free iPSC and describe methodologies for genome editing of iPSC using the Cas9 ribonucleoprotein (RNP) complexes. The genome editing protocol is effective and can be easily multiplexed by pre-complexing sgRNAs for more than one target with the Cas9 protein and simultaneously delivering into the cells. Finally, we describe a simplified approach for identification and characterization of iPSCs with desired edits. Taken together, the outlined strategies are expected to streamline generation and editing of iPSC for manifold applications.

This protocol describes in detail the generation of footprint-free induced pluripotent stem cells (iPSCs) from human pancreatic cells in feeder-free conditions, followed by editing using CRISPR/Cas9 ribonucleoproteins and characterization of the modified single-cell clones.

Embryonic and induced pluripotent stem cells can self-renew and differentiate into multiple cell types of the body. The pluripotent cells are thus coveted ...

Microinjection of Western Corn Rootworm, Diabrotica virgifera virgifera, Embryos for Germline Transformation, or CRISPR/Cas9 Genome Editing

The western corn rootworm (WCR) is an important pest of corn and is well known for its ability to rapidly adapt to pest management strategies. Although RNA interference (RNAi) has proved to be a powerful tool for studying WCR biology, it has its limitations. Specifically, RNAi itself is transient (i.e. does not result in long-term Mendelian inheritance of the associated phenotype), and it requires knowing the DNA sequence of the target gene. The latter can be limiting if the phenotype of interest is controlled by poorly conserved, or even novel genes, because identifying useful targets would be challenging, if not impossible. Therefore, the number of tools in WCR&#39;s genomic toolbox should be expanded by the development of methods that could be used to create stable mutant strains and enable sequence-independent surveys of the WCR genome. Herein, we detail the methods used to collect and microinject precellular WCR embryos with nucleic acids. While the protocols described herein are aimed at the creation of transgenic WCR, CRISPR/Cas9-genome editing could also be performed using the same protocols, with the only difference being the composition of the solution injected into the embryos.

Microinjection of Western Corn Rootworm, Diabrotica virgifera virgifera, Embryos for Germline Transformation, or CRISPR/Cas9 Genome Editing

Here we present protocols for collecting and microinjecting precellular western corn rootworm embryos for the purpose of performing functional-genomic assays such as germline transformation and CRISPR/Cas9-genome editing.

The western corn rootworm (WCR) is an important pest of corn and is well known for its ability to rapidly adapt to pest management strategies. Although ...

A Net Mold-based Method of Scaffold-free Three-Dimensional Cardiac Tissue Creation

This protocol describes a novel and easy net mold-based method to create three-dimensional (3-D) cardiac tissues without additional scaffold material. Human-induced pluripotent stem-cell-derived cardiomyocytes (iPSC-CMs), human cardiac fibroblasts (HCFs), and human umbilical vein endothelial cells (HUVECs) are isolated and used to generate a cell suspension with 70% iPSC-CMs, 15% HCFs, and 15% HUVECs. They are co-cultured in an ultra-low attachment "hanging drop" system, which contains micropores for condensing hundreds of spheroids at one time. The cells aggregate and spontaneously form beating spheroids after 3 days of co-culture. The spheroids are harvested, seeded into a novel mold cavity, and cultured on a shaker in the incubator. The spheroids become a mature functional tissue approximately 7 days after seeding. The resultant multilayered tissues consist of fused spheroids with satisfactory structural integrity and synchronous beating behavior. This new method has promising potential as a reproducible and cost-effective method to create engineered tissues for the treatment of heart failure in the future.

This protocol describes a net mold-based method to create three-dimensional scaffold-free cardiac tissues with satisfactory structural integrity and synchronous beating behavior.

This protocol describes a novel and easy net mold-based method to create three-dimensional (3-D) cardiac tissues without additional scaffold material. ...

Microinjection of Corn Planthopper, Peregrinus maidis, Embryos for CRISPR/Cas9 Genome Editing

The corn planthopper, Peregrinus maidis, is&#160;a pest of maize and a vector of several maize viruses. Previously published methods describe the triggering of RNA interference (RNAi) in P. maidis through microinjection of double-stranded RNAs (dsRNAs) into nymphs and adults. Despite the power of RNAi, phenotypes generated via this technique are transient and lack long-term Mendelian inheritance. Therefore, the P. maidis toolbox needs to be expanded to include functional genomic tools that would enable the production of stable mutant strains, opening the door for researchers to bring new control methods to bear on this economically important pest. However, unlike the dsRNAs used for RNAi, the components used in CRISPR/Cas9-based genome editing and germline transformation do not easily cross cell membranes. As a result, plasmid DNAs, RNAs, and/or proteins must be microinjected into embryos before the embryo cellularizes, making the timing of injection a critical factor for success. To that end, an agarose-based egg-lay method was developed to allow embryos to be harvested from P. maidis females at relatively short intervals. Herein are provided detailed protocols for collecting and microinjecting precellular P. maidis embryos with CRISPR components (Cas9 nuclease that has been complexed with guide RNAs), and results of Cas9-based gene knockout of a P. maidis eye-color gene, white, are presented. Although these protocols describe CRISPR/Cas9-genome editing in P. maidis, they can also be used for producing transgenic P. maidis via germline transformation by simply changing the composition of the injection solution.

Microinjection of Corn Planthopper, Peregrinus maidis, Embryos for CRISPR/Cas9 Genome Editing

Herein are protocols for collecting and microinjecting precellular corn planthopper embryos for the purpose of modifying their genome via CRISPR/Cas9-based genome editing or for the addition of marked transposable elements through germline transformation.

The corn planthopper, Peregrinus maidis, is&#160;a pest of maize and a vector of several maize viruses. Previously published methods describe the ...

Microtubule Plus-End Dynamics Visualization in Huntington's Disease Model based on Human Primary Skin Fibroblasts

Transfection with a fluorescently labeled marker protein of interest in combination with time-lapse video microscopy is a classic method of studying the dynamic properties of the cytoskeleton. This protocol offers a technique for human primary fibroblast transfection, which can be difficult because of the specifics of primary cell cultivation conditions. Additionally, cytoskeleton dynamic property maintenance requires a low level of transfection to obtain a good signal-to-noise ratio without causing microtubule stabilization. It is important to take measures to protect the cells from light-induced stress and fluorescent dye fading. In the course of our work, we tested different transfection methods and protocols as well as different vectors to select the best combination of conditions suitable for human primary fibroblast studies. We analyzed the resulting time-lapse videos and calculated microtubule dynamics using ImageJ. The dynamics of microtubules' plus-ends in the different cell parts are not similar, so we divided the analysis into subgroups - the centrosome region, the lamella, and the tail of fibroblasts. Notably, this protocol can be used for in vitro analysis of cytoskeleton dynamics in patient samples, enabling the next step towards understanding the dynamics of the various disease development.

This protocol is dedicated to the microtubule plus-end visualization by EB3 protein transfection to study their dynamic properties in primary cell culture. The protocol was implemented on human primary skin fibroblasts obtained from Huntington's disease patients.

Transfection with a fluorescently labeled marker protein of interest in combination with time-lapse video microscopy is a classic method of studying the ...

A Nonsequencing Approach for the Rapid Detection of RNA Editing

RNA editing is a process that leads to posttranscriptional sequence alterations in RNAs. Detection and quantification of RNA editing rely mainly on Sanger sequencing and RNA sequencing techniques. However, these methods can be costly and time-consuming. In this protocol, a portable microtemperature gradient gel electrophoresis (&#181;TGGE) system is used as a nonsequencing approach for the rapid detection of RNA editing. The process is based on the principle of electrophoresis, which uses high temperatures to denature nucleic acid samples as they move across a polyacrylamide gel. Across a range of temperatures, a DNA fragment forms a gradient of fully double-stranded DNA to partially separated strands and then to entirely separated single-stranded DNA. RNA-edited sites with distinct nucleotide bases produce different melting profiles in &#181;TGGE analyses. We used the &#181;TGGE-based approach to characterize the differences between the melting profiles of four edited RNA fragments and their corresponding nonedited (wild-type) fragments. Pattern Similarity Scores (PaSSs) were calculated by comparing the band patterns produced by the edited and nonedited RNAs and were used to assess the reproducibility of the method. Overall, the platform described here enables the detection of even single base mutations in RNAs in a straightforward, simple, and cost-effective manner. It is anticipated that this analysis tool will aid new molecular biology findings.

Rapid detection and reliable quantification of RNA editing events at a genomic scale remain challenging and currently rely on direct RNA sequencing methods. The protocol described here uses microtemperature gradient gel electrophoresis (&#181;TGGE) as a simple, quick, and portable method of detecting RNA editing.

RNA editing is a process that leads to posttranscriptional sequence alterations in RNAs. Detection and quantification of RNA editing rely mainly on Sanger ...