This work was supported by the Office of the Assistant Secretary of Defense for Health Affairs, through the Peer Reviewed Cancer Research Program under award W81XWH-16-1-0272. Opinions, interpretations, conclusions, and recommendations are those of the authors and are not necessarily endorsed by the Department of Defense. This work was also supported by a seed grant from the Cornell Stem Cell Program to A.C. White. H. Moon was supported by the Cornell Center for Vertebrate Genomics Scholar Program.

All animal procedures are performed in accordance with Cornell University Institutional Animal Care and Use Committee (IACUC).
1. Preparation
<ol>
	<li>Collect tail clips from 12 day postnatal mice and digest in 400 &#181;L of 0.05 N NaOH at 95 &#176;C for 1 h. Vortex and add 32 &#181;L of 1 M Tris-HCl, pH 7. Genotype mice according to PCR protocols provided through the Jackson Laboratory and identify mice with genotype of interest6. 
	- Tyr-CreER &#8211; hemizygous (+/CreER) 
	- LSL-BrafV600E &#8211; heterozygous (+/LSL-V600E) 
	- Pten &#8211; homozygous flox (flox/flox) 
	- LSL-tdTomato &#8211; hemizygous (+/LSL-tdTomato) 
	NOTE: Primer sequences are provided in Table of Materials.</li>
	<li>Use a hair clipper (electric trimmer) to shave the dorsal skin 2 to 3 days before all experiments described below, and when mice are approximately 7 weeks of age. Take care not to damage the thin mouse skin using the electric trimmer as any injury may elicit a wound healing response which will activate hair follicle stem cells, including MCSCs.</li>
	<li>Determine if the hair cycle is in telogen and whether the skin is wounded during the waiting period. If the skin shows any sign of injury, the mouse should not be used for these procedures. 
	NOTE: Although the hair cycle may slightly differ between genetic backgrounds, at this age the hair cycle in the dorsal skin is usually in the telogen state11. The Tyr-CreER transgene will target MCSCs in telogen skin, and the subsequent genetic alterations will be permanently expressed in all lineages of the MCSC, including differentiated melanocytes and melanocytic tumors.</li>
</ol>
2. Tamoxifen Treatment for Cre-Lox genetic Recombination
<ol>
	<li>Preparation of tamoxifen for intraperitoneal injection (IP) or topical administration for systemic or localized genetic recombination 
	NOTE: In order for tamoxifen to induce recombination, it must first be metabolized by the liver to 4-hydroxytamoxifen (4-OHT), which can bind to and activate the CreER. Topical application of tamoxifen will not be metabolized in this way and 4-OHT must directly be used. Only one method of tamoxifen delivery is required for sufficient recombination.
	<ol>
		<li>Tamoxifen: Prepare tamoxifen at a concentration of 10 mg mL-1 dissolved in corn oil. To aid in the dissolution of the drug into solution, add up to 10% total volume of 100% molecular grade ethanol to the drug in powder form, vortex for 3 min and then add remaining volume of corn oil. Continue to vortex until crystalline material is no longer apparent in solution. Tamoxifen solution can be sterilized by passing through a 0.2 &#181;m filter. Proceed to step 2.2.1 for treatment.</li>
		<li>4-OHT: Prepare a stock solution of hydroxytamoxifen up to 3 mg mL-1 in 100% ethanol. Then, a working solution can be applied as much as needed to cover the skin area of interest (generally a single application). 
		NOTE: A stock solution of hydroxytamoxifen can be dissolved in 100% ethanol for a final concentration of 5 mM. Then, to prepare a working solution, 5 &#181;L of 4OH-tamoxifen stock solution can be diluted into 15 &#181;L of 100% ethanol. For 4 mm2 area, 1 to 3 &#181;L of working solution can be topically applied.</li>
	</ol>
	</li>
	<li>Treating mice with tamoxifen either systemically or topically 
	<ol>
		<li>For systemic treatment, administer 2 mg of tamoxifen via IP injection once daily for 3 days using a 26 G needle. 
		NOTE: Using this model, approximately 93% &#177; 4% of quiescent MCSCs are labeled with tdTomato6.</li>
		<li>For regional activation, perform one topical treatment with 4-OHT. Cover the skin area of interest with the working solution. The amount of working solution can be determined by the size of region of interest as described in step 2.1.2.</li>
	</ol>
	</li>
	<li>At 48 h following the last dose of tamoxifen, proceed to step 3 for chemical depilation induced tumor initiation or to step 4 for UV-B induced tumor initiation</li>
</ol>
3. Chemical Depilation
<ol>
	<li>Equip a mouse treatment room containing an isoflurane system with the following required materials: hair removal cream, cottons swabs, paper cloth, and water.</li>
	<li>Place the mouse into the induction chamber and anesthetize with 3.5 to 4.5% isoflurane and 1 L/min oxygen.</li>
	<li>Once the respiratory rate has stabilized, confirm that the mouse is in the proper plane of anesthesia by performing a toe pinch and transfer the mouse to the main tube maintaining anesthesia with 1 to 1.5% isoflurane and 1 L/min oxygen. Apply eye ointment to keep the eyes from drying while under anesthesia.</li>
	<li>Use a cotton swab to apply a thin layer of hair removal cream to the shaved region of the mouse skin.</li>
	<li>Once the cream has been evenly applied, use clean cotton swabs to begin removal. The total time that the cream is in contact with the skin should not exceed 1 min.</li>
	<li>Gently wipe the skin with a damp paper cloth and ensure that any residual cream has been removed. 
	NOTE: Hair removal cream can cause irritation to the skin if it is not completely removed. Some mice, such as those on a C57BL/6 background, can be prone to developing dermatitis12. Although rare, some animals will develop dermatitis within 24 h after hair removal cream application or mechanical depilation. Make sure to check the mice the day after treatment to look for any signs of regional skin irritation.</li>
	<li>Discard the removed hair shafts and any materials used into a biohazard bin.</li>
	<li>Place the mouse into an empty, clean mouse cage until the anesthesia has worn off.</li>
	<li>Return the mice to their cages.</li>
</ol>
4. UV-B Irradiation
<ol>
	<li>Equip a mouse treatment room containing an isoflurane system with the following required materials: UV-B light system, UV-B light meter, protective covering for the mouse, additional UV-B protective PPE for researcher, and a timer.</li>
	<li>Mice should be irradiated at the UV-B dose of interest (i.e., 0-180 mJ/cm2). Use the UV-B light meter to determine the appropriate length of time to irradiate the mice. 
	NOTE: mW/cm2 x time = dose</li>
	<li>Anesthetize the mouse with isoflurane. While in the induction chamber, use 3.5 to 4.5% isoflurane and 1 L/min oxygen.</li>
	<li>Once the mouse is stabilized, confirm anesthesia effects with a toe pinch and transfer the mouse to the main anesthesia tube located in UV chamber. Apply eye ointment to prevent the eyes from drying while under anesthesia. Maintain anesthesia with 1 to 1.5% isoflurane and 1 L/min oxygen.</li>
	<li>Cover the dorsal skin with UV-B protective material so that only the desired region will be exposed. 
	NOTE: At this time, appropriate PPE should be utilized.&#160;The length of time needed to irradiate the mouse is dependent on the intensity of the light bulb used, but anesthesia may need to be monitored if the required time exceeds 30 s.&#160;</li>
	<li>Cover the UV chamber using UV-resistant lid or any other suitable materials.</li>
	<li>Turn on the UV-B lamp and irradiate the mouse for the time determined by researchers for the specific aim.</li>
	<li>Turn off the UV system and isoflurane, then place the mouse to an empty mouse cage until the anesthesia has worn off.</li>
	<li>Return the mice to their cages.</li>
</ol>
5. Tissue Processing
<ol>
	<li>Skin isolation
	<ol>
		<li>Obtain the following prior to starting: necropsy instruments, filter paper and paper towels.</li>
		<li>Euthanize the mice according to IACUC approved protocols, and confirm death prior to proceeding.</li>
		<li>Using a hair clipper, shave any hair from the dorsal skin area. Lightly brush the area with a lint free tissue to clear the area.</li>
		<li>Make a small incision with sharp scissors just above the base of the tail.</li>
		<li>Insert large blunt scissors into the incision and separate the subdermal connective tissues.</li>
		<li>Carefully isolate the skin region of interest by cutting with sharp scissors along the edge of the tissue.</li>
		<li>Place the skin tissue onto a clean paper towel and use dull forceps to stretch the skin so that it adheres to the towel and is taught. This step serves to provide additional support for the tissue so that it can be manipulated and processed while maintaining its shape. 
		NOTE: Be careful to only handle the outside regions of the skin tissue, as the forceps may cause damage to the skin which can be seen histologically.</li>
	</ol>
	</li>
	<li>Tissue fixation
	<ol>
		<li>Fold a piece of filter paper in half and label appropriately. Place the skin along with paper towel backing into the folded paper immediately adjacent to the crease, ensuring that the sample is smooth and not folded or crumpled. Seal the filter paper by stapling the open sides, and then trim so that the remaining paper can be used for future samples. 
		NOTE: This step is performed so that the skin retains its shape during fixation.</li>
		<li>Fully submerge the tissue sample in 10% neutral buffered formalin for 3 to 5 h at room temperature or overnight at 4 &#176;C.</li>
		<li>Following fixation, remove the samples from formalin, wash in deionized water (2x, 5 min each) and proceed to make tissue blocks. Carefully remove any residual material from the skin tissue (i.e., residual paper).</li>
	</ol>
	</li>
	<li>Making frozen tissue blocks (Figure 1)
	<ol>
		<li>Trim the edges of the skin sample so that they are not jagged and then make 3 sagittal cuts. The width of these strips should not be more than the height of the cryomold (5 mm). Next, make transverse cuts to have pieces of skin which are not longer than the width of the cryomold (20 mm) and can be embedded. Repeat with the remaining half of dorsal skin, or save the tissue for other uses (alternately, save half prior to fixation). 
		NOTE: It&#8217;s important to keep skin pieces in proper orientation.</li>
		<li>Orient the cryomold (25 x 20 x 5 mm3) in a portrait orientation and place 4 to 5 pieces of skin on top of the OCT. Once all pieces are in place, use 2 pairs of fine forceps to bring the long edge of skin to the bottom of the cryomold. Skin should now be standing up in the OCT perpendicular to the base of the mold. Take care to minimize formation of air pockets within the OCT during this step (Figure 1).</li>
		<li>Fill the mold with OCT to the second lip, and place on the flat surface of dry ice. Use forceps to adjust any skin pieces that may have shifted during transfer as the block begins to freeze. Once the bottom layer is solidified, manipulation of tissues will be impossible.</li>
		<li>Cut 8-10 &#181;m slides for analysis.</li>
	</ol>
	</li>
	<li>Making Formalin Fixed Paraffin Embedded (FFPE) tissue blocks
	<ol>
		<li>Place 2 pieces of fixed skin into a labeled cassette and dehydrate in increasing concentrations of ethanol (75% ethanol for 30 min, 85% for 30 min, 90% for 30 min, 95% for 30 min, 100% for 2x 30 min, Xylene or xylene substitute for 2x 30 min). Incubate with Paraffin at 58-60&#730;, first for 30 min, and then overnight.</li>
		<li>Embed the tissue in a 24 x 24 mm2 stainless steel tissue mold with liquid paraffin and solidify at -5 &#176;C. The tissue orientation should be similar to that of frozen tissue blocks so that longitudinal sections across multiple hair follicles can be visualized (Figure 1).</li>
		<li>Once the paraffin has solidified, remove the mold and cut into 5-10 &#956;m sections for analysis.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wernli, K. J., Henrikson, N. B., Morrison, C. C., Nguyen, M., Pocobelli, G., Blasi, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+for+skin+cancer+in+adults:+updated+evidence+report+and+systematic+review+for+the+US+preventive+services+task+force.">Screening for skin cancer in adults: updated evidence report and systematic review for the US preventive services task force.</a> The Journal of the American Medical Association. 316 (4), 436-447 (2016).</li><li>Siegel, R. L., Miller, K. D., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+statistics,+2018.">Cancer statistics, 2018.</a> CA: A Cancer Journal for Clinicians. 68 (1), 7-30 (2018).</li><li>White, A. C., Lowry, W. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refining+the+role+for+adult+stem+cells+as+cancer+cells+of+origin.">Refining the role for adult stem cells as cancer cells of origin.</a> Trends in Cell Biology. 25 (1), 11-20 (2015).</li><li>Moon, H., Donahue, L. R., White, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+cancer+cells+of+origin+in+cutaneous+tumors.">Understanding cancer cells of origin in cutaneous tumors.</a> Cancer Stem Cells. , 263-284 (2016).</li><li>Blanpain, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracing+the+cellular+origin+of+cancer.">Tracing the cellular origin of cancer.</a> Nature Cell Biology. 15 (2), 126-134 (2013).</li><li>Moon, H., Donahue, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanocyte+stem+cell+activation+and+translocation+initiate+cutaneous+melanoma+in+response+to+UV+exposure.">Melanocyte stem cell activation and translocation initiate cutaneous melanoma in response to UV exposure.</a> Cell Stem Cell. 21 (5), 665-678 (2017).</li><li>Moon, H., White, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+path+from+melanocyte+stem+cells+to+cutaneous+melanoma+illuminated+by+UVB.">A path from melanocyte stem cells to cutaneous melanoma illuminated by UVB.</a> Molecular &#38; Cellular Oncology. 5 (2), e1409864 (2018).</li><li>Rabbani, P., Takeo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+activation+of+Wnt+in+epithelial+and+melanocyte+stem+cells+initiates+pigmented+hair+regeneration.">Coordinated activation of Wnt in epithelial and melanocyte stem cells initiates pigmented hair regeneration.</a> Cell. 145 (6), 941-955 (2011).</li><li>Chou, W. C., Takeo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+migration+of+follicular+melanocyte+stem+cells+to+the+epidermis+after+wounding+or+UVB+irradiation+is+dependent+on+Mc1r+signaling.">Direct migration of follicular melanocyte stem cells to the epidermis after wounding or UVB irradiation is dependent on Mc1r signaling.</a> Nature Medicine. 19 (7), 924-929 (2013).</li><li>Keyes, B. E., Segal, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nfatc1+orchestrates+aging+in+hair+follicle+stem+cells.">Nfatc1 orchestrates aging in hair follicle stem cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (51), (2013).</li><li>M&#252;ller-R&#246;ver, S., Handjiski, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+guide+for+the+accurate+classification+of+murine+hair+follicles+in+distinct+hair+cycle+stages.">A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages.</a> The Journal of Investigative Dermatology. 117 (1), 3-15 (2001).</li><li>Kastenmayer, R. J., Fain, M. A., Perdue, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+retrospective+study+of+idiopathic+ulcerative+dermatitis+in+mice+with+a+C57BL/6+background.">A retrospective study of idiopathic ulcerative dermatitis in mice with a C57BL/6 background.</a> Journal of the American Association for Laboratory Animal Science&#8239;: JAALAS. 45 (6), 8-12 (2006).</li><li>Vultur, A., Herlyn, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SnapShot:+melanoma.">SnapShot: melanoma.</a> Cancer Cell. 23 (5), (2013).</li><li>Dankort, D., Curley, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Braf(V600E)+cooperates+with+Pten+loss+to+induce+metastatic+melanoma.">Braf(V600E) cooperates with Pten loss to induce metastatic melanoma.</a> Nature Genetics. 41 (5), 544-552 (2009).</li><li>Viros, A., Sanchez-Laorden, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultraviolet+radiation+accelerates+BRAF-driven+melanomagenesis+by+targeting+TP53.">Ultraviolet radiation accelerates BRAF-driven melanomagenesis by targeting TP53.</a> Nature. 511 (7510), 478-482 (2014).</li></ol>

The authors declare no conflict of interest.

Hallmark genetic alterations frequently found in cutaneous melanoma tumors have been well described13. The most dominant driver mutation is BrafV600E, and a genetically engineered mouse model for BrafV600E-mediated melanoma was generated by the Bosenberg group14 and deposited in the Jackson Laboratory. Using this mouse model, our recent study demonstrated the requirement of cellular activation of tumor-prone MCSCs for the significant ...

Melanoma, the malignant form of melanocytic tumors, is the most aggressive cancer in the skin with cutaneous melanoma responsible for the majority of skin cancer deaths1. In the United States, melanoma is commonly diagnosed; it is projected to be the 5th to 6th most common cancer type among the estimated new cancer cases in 20182. Furthermore, while overall cancer incidences have shown the trend of gradual reduction in recent decades, cutaneous melanoma incidence rates during the last few decades demonstrate a continuous and rapid increase in both genders2.
To combat cutaneous melanoma more efficiently, it is important to clearly understand the early events of melanoma development from their cells of origin to better identify clinically effective preventative methods. It is now known that adult stem cells can significantly contribute to tumor formation as the cellular origins of cancers in many different types of organs including skin tissues3,4,5. Similarly, adult melanocyte stem cells (MCSCs) in the murine dorsal skin can work as melanoma cells of origin upon aberrant activation of the Ras/Raf and Akt pathways6. However, these oncogenic mutations alone are not able to efficiently induce tumor formation from quiescent MCSCs. Melanocytic tumors eventually develop when MCSCs become active during natural hair cycling. However, in this protocol, we will describe methods to artificially induce cellular activation of tumor-prone MCSCs, thus facilitating precise control of melanoma initiation6,7.
Through the methods described here, spatial and temporal control of cutaneous melanoma initiation from tumor-prone MCSCs expressing oncogenic BrafV600E together with loss of Pten expression can be successfully performed, as we have previously reported6. This method incorporates previous findings that demonstrate hair follicle stem cell activation through depilation as well as how exposure of murine skin to UV-B can facilitate activation of MCSCs resident to the hair follicle and translocation of this cellular subpopulation to the interfollicular epidermis6,8,9,10. These in vivo model systems can provide valuable information regarding how physiological and environmental changes can alter the cellular status of melanoma-prone MCSCs, which in turn can induce significant initiation of melanoma in the skin.

<table><tbody><tr><td>Tamoxifen</td><td>Sigma</td><td>T5648-1G</td><td>For systemic injection</td></tr><tr><td>Tamoxifen</td><td>Cayman Chemical</td><td>13258</td><td>For systemic injection</td></tr><tr><td>Corn oil</td><td>Sigma</td><td>45-C8267-2.5L-EA</td><td></td></tr><tr><td>4OH-tamoxifen</td><td>Sigma</td><td>H7904-25MG</td><td>For topical treatment</td></tr><tr><td>26 G 1/2&quot; needles</td><td>various</td><td></td><td>Veterinary grade</td></tr><tr><td>1 mL syringe</td><td>various</td><td></td><td>Veterinary grade</td></tr><tr><td>Pet hair trimmer</td><td>Wahl</td><td>09990-502</td><td></td></tr><tr><td>Hair removal cream</td><td>Nair</td><td>n/a</td><td>Available at most drug stores</td></tr><tr><td>Cotton swabs</td><td>various</td><td></td><td></td></tr><tr><td>Ultraviolet light bulb</td><td>UVP</td><td>95-0042-08</td><td>model XX-15M midrange UV lamp</td></tr><tr><td>200 proof ethanol</td><td>various</td><td></td><td>pure ethanol</td></tr><tr><td>Histoplast PE</td><td>Fisher Scientific</td><td>22900700</td><td>paraffin pellets</td></tr><tr><td>Neutral Buffered Formalin, 10%</td><td>Sigma</td><td>HT501128-4L</td><td></td></tr><tr><td>Clear-Rite 3</td><td>Thermo Scientific</td><td>6901</td><td>xylene substitute</td></tr><tr><td>O.C.T. Compound</td><td>Thermo</td><td>23730571</td><td></td></tr><tr><td>Tissue Cassette</td><td>Sakura</td><td>89199-430</td><td>for FFPE processing</td></tr><tr><td>Cryomolds</td><td>Sakura</td><td>4557</td><td>25 x 20 mm</td></tr><tr><td>FFPE metal mold</td><td>Leica</td><td>3803082</td><td>24 mm x 24 mm</td></tr><tr><td>Isoflurane</td><td>various</td><td></td><td>Veterinary grade</td></tr><tr><td>Anesthesia inhalation system</td><td>various</td><td></td><td>Veterinary grade</td></tr><tr><td>Fine scissor</td><td>FST</td><td>14085-09</td><td>Straight, sharp/sharp</td></tr><tr><td>Fine scissor</td><td>FST</td><td>14558-09</td><td>Straight, sharp/sharp</td></tr><tr><td>Metzenbaum</td><td>FST</td><td>14018-13</td><td>Straight, blunt/blunt</td></tr><tr><td>Forcep</td><td>FST</td><td>11252-00</td><td>Dumont #5</td></tr><tr><td>Forcep</td><td>FST</td><td>11018-12</td><td>Micro-Adson</td></tr><tr><td>Tyr-CreER; LSL-BrafV600E; Pten-f/f</td><td>Jackson Labs</td><td>13590</td><td></td></tr><tr><td>LSL-tdTomato</td><td>Jackson Labs</td><td>007914</td><td>ai14</td></tr><tr><td>Cre-1</td><td></td><td>n/a</td><td>GCATTACCGGTCGATGCAACGA&lt;br /&gt;GTGATGAG</td></tr><tr><td>Cre-2</td><td></td><td>n/a</td><td>GAGTGAACGAACCTGGTCGAA&lt;br /&gt;ATCAGTGCG</td></tr><tr><td>Braf-V600E-1</td><td></td><td>n/a</td><td>TGAGTATTTTTGTGGCAACTGC</td></tr><tr><td>Braf-V600E-2</td><td></td><td>n/a</td><td>CTCTGCTGGGAAAGCGGC</td></tr><tr><td>Kras-G12D-1</td><td></td><td>n/a</td><td>AGCTAGCCACCATGGCTTGAGT&lt;br /&gt;AAGTCTGCA</td></tr><tr><td>Kras-G12D-2</td><td></td><td>n/a</td><td>CCTTTACAAGCGCACGCAGACT&lt;br /&gt;GTAGA</td></tr><tr><td>Pten-1</td><td></td><td>n/a</td><td>ACTCAAGGCAGGGATGAGC</td></tr><tr><td>Pten-2</td><td></td><td>n/a</td><td>AATCTAGGGCCTCTTGTGCC</td></tr><tr><td>Pten-3</td><td></td><td>n/a</td><td>GCTTGATATCGAATTCCTGCAGC</td></tr><tr><td>tdTomato-1</td><td></td><td>n/a</td><td>AAGGGAGCTGCAGTGGAGTA</td></tr><tr><td>tdTomato-2</td><td></td><td>n/a</td><td>CCGAAAATCTGTGGGAAGTC</td></tr><tr><td>tdTomato-3</td><td></td><td>n/a</td><td>GGCATTAAAGCAGCGTATCC</td></tr><tr><td>tdTomato-4</td><td></td><td>n/a</td><td>CTGTTCCTGTACGGCATGG</td></tr></tbody></table>

spatial and temporal control of murine melanoma initiation from mutant melanocyte stem cells

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented with increasing depth, the incidence rate of cutaneous melanoma has shown a rapid and continuous increase during recent decades. In order to find effective preventative methods, it is important to understand the early steps of melanoma initiation in the skin. Previous data has demonstrated that follicular melanocyte stem cells (MCSCs) in the adult skin tissues can act as melanoma cells of origin when expressing oncogenic mutations and genetic alterations. Tumorigenesis arising from melanoma-prone MCSCs can be induced when MCSCs transition from a quiescent to active state. This transition in melanoma-prone MCSCs can be promoted by the modulation of either hair follicle stem cells&#39; activity state or through extrinsic environmental factors such as ultraviolet-B (UV-B). These factors can be artificially manipulated in the laboratory by chemical depilation, which causes transition of hair follicle stem cells and MCSCs from a quiescent to active state, and by UV-B exposure using a benchtop light. These methods provide successful spatial and temporal control of cutaneous melanoma initiation in the murine dorsal skin. Therefore, these in vivo model systems will be valuable to define the early steps of cutaneous melanoma initiation and could be used to test potential methods for tumor prevention.

Cutaneous melanoma initiation induced by chemical depilation
The procedure of chemical depilation is depicted in Figure 2. When mice are 7-weeks postnatal, their dorsal skin is in telogen. During telogen, hair follicle stem cells and MCSCs&#160;are known to be in a quiescent, resting state. The skin should show no significant hair growth after shaving. On the other hand, chemical de...

Watch this Scientific Journal Video about Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells at JoVE.com

Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

The following procedure describes a method for spatial and temporal control of melanocytic tumor initiation in murine dorsal skin, using a genetically engineered mouse model. This protocol describes macroscopic as well as microscopic cutaneous melanoma initiation.

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented ...

spatial-temporal-control-murine-melanoma-initiation-from-mutant

Research

JoVE Journal

Cancer Research

8.6K Views.  Cornell University. Melanoom wordt wereldwijd op grote schaal gediagnosticeerd, met toenemende incidentie. Deze protocollen maken het mogelijk de vroege stadia van melanoom initiatie zorgvuldig worden gecontroleerd, het vergemakkelijken van de studie van de ontwikkeling ervan. Door de tijd en locatie van melanocyten stamcelactivering te controleren, hebben we de mogelijkheid om de veranderingen binnen de stamcelpopulatie en de nieuwe stammelanoominitiatie te onderscheiden.Het aantonen van de procedure zal...

Video: Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

Feeder-free Derivation of Melanocytes from Human Pluripotent Stem Cells

Human pluripotent stem cells (hPSCs) represent a platform to study human development in vitro under both normal and disease conditions. Researchers can direct the differentiation of hPSCs into the cell type of interest by manipulating the culture conditions to recapitulate signals seen during development. One such cell type is the melanocyte, a pigment-producing cell of neural crest (NC) origin responsible for protecting the skin against UV irradiation. This protocol presents an extension of a currently available in vitro Neural Crest differentiation protocol from hPSCs to further differentiate NC into fully pigmented melanocytes. Melanocyte precursors can be enriched from the Neural Crest protocol via a timed exposure to activators of WNT, BMP, and EDN3 signaling under dual-SMAD-inhibition conditions. The resultant melanocyte precursors are then purified and matured into fully pigmented melanocytes by culture in a selective medium. The resultant melanocytes are fully pigmented and stain appropriately for proteins characteristic of mature melanocytes.

This work describes an in vitro differentiation protocol to produce pigmented, mature melanocytes from human pluripotent stem cells via a neural crest and melanoblast intermediate stage using a feeder-free, 25 day protocol.

Human pluripotent stem cells (hPSCs) represent a platform to study human development in vitro under both normal and disease conditions. Researchers can ...

Developmental Biology

A 3D Organotypic Melanoma Spheroid Skin Model

Malignant transformation of melanocytes, the pigment cells of human skin, causes formation of melanoma, a highly aggressive cancer with increased metastatic potential. Recently, mono-chemotherapies continue to improve by melanoma specific combination therapies with targeted kinase inhibitors. Still, metastatic melanoma remains a life-threatening disease because tumors exhibit primary resistance or develop resistance to novel therapies, thereby regaining tumorigenic capacity. In order to improve the therapeutic success of malignant melanoma, the determination of molecular mechanisms conferring resistance against conventional treatment approaches is necessary; however, it requires innovative cellular in vitro models. Here, we introduce an in vitro three-dimensional (3D) organotypic melanoma spheroid model that can portray the in vivo architecture of malignant melanoma and may warrant new insights into intra-tumoral as well as tumor-host interactions. The model incorporates defined numbers of mature and differentiated melanoma spheroids in a 3D human full skin reconstruction model consisting of primary skin cells. The cellular composition and differentiation status of the embedded melanoma spheroids is similar to the one of cutaneous melanoma metastasis in vivo. Using this organotypic melanoma spheroid model as a drug screening platform may support the identification of responders to selected combination therapies, while sparing the unnecessary treatment burden for non-responders, thereby increasing the benefit of therapeutic interventions.

Here, we present a protocol to generate a 3D organotypic melanoma spheroid skin model that recapitulates both the architecture and multicellular complexity of an organ/tumor in vivo but at the same time accommodates systematic experimental intervention.

Malignant transformation of melanocytes, the pigment cells of human skin, causes formation of melanoma, a highly aggressive cancer with increased ...

Rapid Generation of Primary Murine Melanocyte and Fibroblast Cultures

Defects in fibroblast or melanocyte function are associated with skin diseases, including poor barrier function, defective wound healing, pigmentation defects and cancer. Vital to the understanding and amelioration of these diseases are experiments in primary fibroblast and melanocyte cultures. Nevertheless, current protocols for melanocyte isolation require that the epidermal and dermal layers of the skin are trypsinized and manually disassociated. This process is time consuming, technically challenging and contributes to inconsistent yields. Furthermore, methods to simultaneously generate pure fibroblast cultures from the same tissue sample are not readily available. Here, we describe an improved protocol for isolating melanocytes and fibroblasts from the skin of mice on postnatal days 0-4. In this protocol, whole skin is mechanically homogenized using a tissue chopper and then briefly digested with collagenase and trypsin. Cell populations are then isolated through selective plating followed by G418 treatment. This procedure results in consistent melanocyte and fibroblast yields from a single mouse in less than 90 min. This protocol is also easily scalable, allowing researchers to process large cohorts of animals without a significant increase in hands-on time. We show through flow cytometric assessments that cultures established using this protocol are highly enriched for melanocytes or fibroblasts.

This protocol outlines a rapid method to simultaneously generate melanocyte and fibroblast cultures from the skin of 0-4 day old mice. These primary cultures can be maintained and manipulated in vitro to study a variety of physiologically relevant processes, including skin cell biology, pigmentation, wound healing and melanoma.

Defects in fibroblast or melanocyte function are associated with skin diseases, including poor barrier function, defective wound healing, pigmentation ...

Pharmacologic Induction of Epidermal Melanin and Protection Against Sunburn in a Humanized Mouse Model

Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection 1. Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

Epidermal melanin is induced by topical application of forskolin in a murine model of the fair-skinned UV-sensitive human. Pharmacologic manipulation of cAMP levels in the skin and epidermal darkening strongly protect against UV-mediated inflammation (sunburn) as measured by the minimum erythematous dose (MED) assay.

Fairness of skin, UV sensitivity and skin cancer  risk all correlate with the physiologic function of the melanocortin 1  receptor, a Gs-coupled signaling ...

Medicine

Analysis of Lymph Node Volume by Ultra-High-Frequency Ultrasound Imaging in the Braf/Pten Genetically Engineered Mouse Model of Melanoma

Tyr::CreER+,BrafCA/+,Ptenlox/lox&#160;genetically engineered mice (Braf/Pten mice) are widely used as an in vivo model of metastatic melanoma. Once a primary tumor has been induced by tamoxifen treatment, an increase in metastatic burden is observed within 4-6 weeks after induction. This paper shows how Ultra-High-Frequency UltraSound (UHFUS) imaging can be exploited to monitor the increase in metastatic involvement of the inguinal lymph nodes by measuring the increase in their volume.
The UHFUS system is used to scan anesthetized mice with a UHFUS linear probe (22-55 MHz, axial resolution 40 &#181;m). B-mode images from the inguinal lymph nodes (both left and right sides) are acquired in a short-axis view, positioning the animals in dorsal recumbency. Ultrasound records are acquired using a 44 &#181;m step size on a motorized mechanical arm. Afterward, two-dimensional (2D) B-mode acquisitions are imported into the software platform for ultrasound image post-processing, and inguinal lymph nodes are identified and segmented semi-automatically in the acquired cross-sectional 2D images. Finally, a total reconstruction of the three-dimensional (3D) volume is automatically obtained along with the rendering of the lymph node volume, which is also expressed as an absolute measurement.
This non-invasive in vivo technique is very well tolerated and allows the scheduling of multiple imaging sessions on the same experimental animal over 2 weeks. It is, therefore, ideal to assess the impact of pharmacological treatment on metastatic disease.

Melanoma is a very aggressive disease that quickly spreads to other organs. This protocol describes the application of ultra-high-frequency ultrasound imaging, coupled with 3D rendering, to monitor the volume of the inguinal lymph nodes in the Braf/Pten mouse model of metastatic melanoma.

Tyr::CreER+,BrafCA/+,Ptenlox/lox&#160;genetically engineered mice (Braf/Pten mice) are widely used as an in vivo model of metastatic melanoma. Once a ...

A Robust Discovery Platform for the Identification of Novel Mediators of Melanoma Metastasis

Metastasis is a complex process, requiring cells to overcome barriers that are only incompletely modeled by in vitro assays. A systematic workflow was established using robust, reproducible in vivo models and standardized methods to identify novel players in melanoma metastasis. This approach allows for data inference at specific experimental stages to precisely characterize a gene's role in metastasis. Models are established by introducing genetically modified melanoma cells via intracardiac, intradermal, or subcutaneous injections into mice, followed by monitoring with serial in vivo imaging. Once preestablished endpoints are reached, primary tumors and/or metastases-bearing organs are harvested and processed for various analyses. Tumor cells can be sorted and subjected to any of several 'omics' platforms, including single-cell RNA sequencing. Organs undergo imaging and immunohistopathological analyses to quantify the overall burden of metastases and map their specific anatomic location. This optimized pipeline, including standardized protocols for engraftment, monitoring, tissue harvesting, processing, and analysis, can be adopted for patient-derived, short-term cultures and established human and murine cell lines of various solid cancer types.

This article describes a workflow of techniques employed for testing novel candidate mediators of melanoma metastasis and their mechanism(s) of action.

Metastasis is a complex process, requiring cells to overcome barriers that are only incompletely modeled by in vitro assays. A systematic workflow was ...

Implantation and Evaluation of Melanoma in the Murine Choroid via Optical Coherence Tomography

Establishing experimental choroidal melanoma models is challenging in terms of the ability to induce tumors at the correct localization. In addition, difficulties in observing posterior choroidal melanoma in vivo limit tumor location and growth evaluation in real-time. The approach described here optimizes techniques for establishing choroidal melanoma in mice via a multi-step sub-choroidal B16LS9 cell injection procedure. To enable precision in injecting into the small dimensions of the mouse uvea, the complete procedure is performed under a microscope. First, a conjunctival peritomy is formed in the dorsal-temporal area of the eye. Then, a tract into the sub-choroidal space is created by inserting a needle through the exposed sclera. This is followed by the insertion of a blunt needle into the tract and the injection of melanoma cells into the choroid. Immediately after injection, noninvasive optical coherence tomography (OCT) imaging is utilized to determine tumor location and progress. Retinal detachment is evaluated as a predictor of tumor site and size. The presented method enables the reproducible induction of choroid-localized melanoma in mice and the live imaging of tumor growth evaluation. As such, it provides a valuable tool for studying intraocular tumors.

Implantation and Evaluation of Melanoma in the Murine Choroid via Optical Coherence Tomography

The present protocol describes the implantation and evaluation of melanoma in the murine choroid utilizing optical coherence tomography.

Establishing experimental choroidal melanoma models is challenging in terms of the ability to induce tumors at the correct localization. In addition, ...

Direct Reprogramming of Mouse Fibroblasts into Melanocytes

The loss of function of melanocytes leads to vitiligo, which seriously affects the physical and mental health of the affected individuals. Presently, there is no effective long-term treatment for vitiligo. Therefore, it is imperative to develop a convenient and effective treatment for vitiligo. Regenerative medicine technology for direct reprogramming of skin cells into melanocytes seems to be a promising novel treatment of vitiligo. This involves the direct reprogramming of the patient's skin cells into functional melanocytes to help ameliorate the loss of melanocytes in patients with vitiligo. However, this method needs to be first tested on mice. Although direct reprogramming is widely used, there is no clear protocol for direct reprogramming into melanocytes. Moreover, the number of available transcription factors is overwhelming. 
Here, a concentrated lentivirus packaging system protocol is presented to produce transcription factors selected for reprogramming skin cells to melanocytes, including Sox10, Mitf, Pax3, Sox2, Sox9, and Snai2. Mouse embryonic fibroblasts (MEFs) were infected with the concentrated lentivirus for all these transcription factors for the direct reprogramming of the MEFs into induced melanocytes (iMels) in vitro. Furthermore, these transcription factors were screened, and the system was optimized for direct reprogramming to melanocytes. The expression of the characteristic markers of melanin in iMels at the gene or protein level was significantly increased. These results suggest that direct reprogramming of fibroblasts to melanocytes could be a successful new therapeutic strategy for vitiligo and confirm the mechanism of melanocyte development, which will provide the basis for further direct reprogramming of fibroblasts into melanocytes in vivo.

Here, we describe an optimized direct reprogramming system for melanocytes and a high-efficiency, concentrated virus packaging system that ensures smooth direct reprogramming.

The loss of function of melanocytes leads to vitiligo, which seriously affects the physical and mental health of the affected individuals. Presently, ...

Isolating Primary Melanocyte-like Cells from the Mouse Heart

We identified a novel population of melanocyte-like cells (also known as cardiac melanocytes) in the hearts of mice and humans that contribute to atrial arrhythmia triggers in mice. To investigate the electrical and biological properties of cardiac melanocytes we developed a procedure to isolate them from mouse hearts that we derived from those designed to isolate neonatal murine cardiomyocytes. In order to obtain healthier cardiac melanocytes suitable for more extensive patch clamp or biochemical studies, we developed a refined procedure for isolating and plating cardiac melanocytes based on those originally designed to isolate cutaneous melanocytes. The refined procedure is demonstrated in this review and produces larger numbers of healthy melanocyte-like cells that can be plated as a pure population or with cardiomyocytes.

In this protocol, we identified a novel population of melanocyte-like cells (also known as cardiac melanocytes) in the hearts of mice and humans that contribute to atrial arrhythmia triggers in mice.&#160;

We identified a novel population of melanocyte-like cells (also known as cardiac melanocytes) in the hearts of mice and humans that contribute to atrial ...

Biology

Ex vivo Culture of Mouse Embryonic Skin and Live-imaging of Melanoblast Migration

Melanoblasts are the neural crest derived precursors of melanocytes; the cells responsible for producing the pigment in skin and hair. Melanoblasts migrate through the epidermis of the embryo where they subsequently colonize the developing hair follicles1,2. Neural crest cell migration is extensively studied in vitro but in vivo methods are still not well developed, especially in mammalian systems. One alternative is to use ex vivo organotypic culture3-6. Culture of mouse embryonic skin requires the maintenance of an air-liquid interface (ALI) across the surface of the tissue3,6. High resolution live-imaging of mouse embryonic skin has been hampered by the lack of a good method that not only maintains this ALI but also allows the culture to be inverted and therefore compatible with short working distance objective lenses and most confocal microscopes. This article describes recent improvements to a method that uses a gas permeable membrane to overcome these problems and allow high-resolution confocal imaging of embryonic skin in ex vivo culture6. By using a melanoblast specific Cre-recombinase expressing mouse line combined with the R26YFPR reporter line we are able to fluorescently label the melanoblast population within these skin cultures. The technique allows live-imaging of melanoblasts and observation of their behavior and interactions with the tissue in which they develop. Representative results are included to demonstrate the capability to live-image 6&#160;cultures in parallel.

Ex vivo Culture of Mouse Embryonic Skin and Live-imaging of Melanoblast Migration

We describe the dissection and ex vivo culture of mouse embryonic skin. The culture system maintains an air-liquid interface across the tissue surface and allows imaging on an inverted microscope. Melanoblasts, a component of the developing skin, are fluorescently labeled allowing their behavior to be observed using confocal microscopy.

Melanoblasts are the neural crest derived precursors of melanocytes; the cells responsible for producing the pigment in skin and hair. Melanoblasts ...

Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

Samenvatting

Meer video's verkennen