Name: spatial and temporal control of murine melanoma initiation from mutant melanocyte stem cells
Uploaded: 2019-06-07T14:45:00
Description: Watch this Scientific Journal Video about Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells at JoVE.com

This work was supported by the Office of the Assistant Secretary of Defense for Health Affairs, through the Peer Reviewed Cancer Research Program under award W81XWH-16-1-0272. Opinions, interpretations, conclusions, and recommendations are those of the authors and are not necessarily endorsed by the Department of Defense. This work was also supported by a seed grant from the Cornell Stem Cell Program to A.C. White. H. Moon was supported by the Cornell Center for Vertebrate Genomics Scholar Program.

All animal procedures are performed in accordance with Cornell University Institutional Animal Care and Use Committee (IACUC).
1. Preparation
<ol>
	<li>Collect tail clips from 12 day postnatal mice and digest in 400 &#181;L of 0.05 N NaOH at 95 &#176;C for 1 h. Vortex and add 32 &#181;L of 1 M Tris-HCl, pH 7. Genotype mice according to PCR protocols provided through the Jackson Laboratory and identify mice with genotype of interest6. 
	- Tyr-CreER &#8211;...

<ol>
	<li>Wernli, K. J., Henrikson, N. B., Morrison, C. C., Nguyen, M., Pocobelli, G., Blasi, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+for+skin+cancer+in+adults:+updated+evidence+report+and+systematic+review+for+the+US+preventive+services+task+force.">Screening for skin cancer in adults: updated evidence report and systematic review for the US preventive services task force.</a> The Journal of the American Medical Association. 316 (4), 436-447 (2016).</li><li>Siegel, R. L., Miller, K. D., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+statistics,+2018.">Cancer statistics, 2018.</a> CA: A Cancer Journal for Clinicians. 68 (1), 7-30 (2018).</li><li>White, A. C., Lowry, W. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refining+the+role+for+adult+stem+cells+as+cancer+cells+of+origin.">Refining the role for adult stem cells as cancer cells of origin.</a> Trends in Cell Biology. 25 (1), 11-20 (2015).</li><li>Moon, H., Donahue, L. R., White, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+cancer+cells+of+origin+in+cutaneous+tumors.">Understanding cancer cells of origin in cutaneous tumors.</a> Cancer Stem Cells. , 263-284 (2016).</li><li>Blanpain, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracing+the+cellular+origin+of+cancer.">Tracing the cellular origin of cancer.</a> Nature Cell Biology. 15 (2), 126-134 (2013).</li><li>Moon, H., Donahue, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanocyte+stem+cell+activation+and+translocation+initiate+cutaneous+melanoma+in+response+to+UV+exposure.">Melanocyte stem cell activation and translocation initiate cutaneous melanoma in response to UV exposure.</a> Cell Stem Cell. 21 (5), 665-678 (2017).</li><li>Moon, H., White, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+path+from+melanocyte+stem+cells+to+cutaneous+melanoma+illuminated+by+UVB.">A path from melanocyte stem cells to cutaneous melanoma illuminated by UVB.</a> Molecular &#38; Cellular Oncology. 5 (2), e1409864 (2018).</li><li>Rabbani, P., Takeo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+activation+of+Wnt+in+epithelial+and+melanocyte+stem+cells+initiates+pigmented+hair+regeneration.">Coordinated activation of Wnt in epithelial and melanocyte stem cells initiates pigmented hair regeneration.</a> Cell. 145 (6), 941-955 (2011).</li><li>Chou, W. C., Takeo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+migration+of+follicular+melanocyte+stem+cells+to+the+epidermis+after+wounding+or+UVB+irradiation+is+dependent+on+Mc1r+signaling.">Direct migration of follicular melanocyte stem cells to the epidermis after wounding or UVB irradiation is dependent on Mc1r signaling.</a> Nature Medicine. 19 (7), 924-929 (2013).</li><li>Keyes, B. E., Segal, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nfatc1+orchestrates+aging+in+hair+follicle+stem+cells.">Nfatc1 orchestrates aging in hair follicle stem cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (51), (2013).</li><li>M&#252;ller-R&#246;ver, S., Handjiski, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+guide+for+the+accurate+classification+of+murine+hair+follicles+in+distinct+hair+cycle+stages.">A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages.</a> The Journal of Investigative Dermatology. 117 (1), 3-15 (2001).</li><li>Kastenmayer, R. J., Fain, M. A., Perdue, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+retrospective+study+of+idiopathic+ulcerative+dermatitis+in+mice+with+a+C57BL/6+background.">A retrospective study of idiopathic ulcerative dermatitis in mice with a C57BL/6 background.</a> Journal of the American Association for Laboratory Animal Science&#8239;: JAALAS. 45 (6), 8-12 (2006).</li><li>Vultur, A., Herlyn, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SnapShot:+melanoma.">SnapShot: melanoma.</a> Cancer Cell. 23 (5), (2013).</li><li>Dankort, D., Curley, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Braf(V600E)+cooperates+with+Pten+loss+to+induce+metastatic+melanoma.">Braf(V600E) cooperates with Pten loss to induce metastatic melanoma.</a> Nature Genetics. 41 (5), 544-552 (2009).</li><li>Viros, A., Sanchez-Laorden, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultraviolet+radiation+accelerates+BRAF-driven+melanomagenesis+by+targeting+TP53.">Ultraviolet radiation accelerates BRAF-driven melanomagenesis by targeting TP53.</a> Nature. 511 (7510), 478-482 (2014).</li></ol>

Hallmark genetic alterations frequently found in cutaneous melanoma tumors have been well described13. The most dominant driver mutation is BrafV600E, and a genetically engineered mouse model for BrafV600E-mediated melanoma was generated by the Bosenberg group14 and deposited in the Jackson Laboratory. Using this mouse model, our recent study demonstrated the requirement of cellular activation of tumor-prone MCSCs for the significant ...

Melanoma, the malignant form of melanocytic tumors, is the most aggressive cancer in the skin with cutaneous melanoma responsible for the majority of skin cancer deaths1. In the United States, melanoma is commonly diagnosed; it is projected to be the 5th to 6th most common cancer type among the estimated new cancer cases in 20182. Furthermore, while overall cancer incidences have shown the trend of gradual reduction in recent decades, cutaneous melanoma incidence rates during the last few decades demonstrate a continuous and rapid increase in both genders2.
To combat cutaneous melanoma more efficiently, it is important to clearly understand the early events of melanoma development from their cells of origin to better identify clinically effective preventative methods. It is now known that adult stem cells can significantly contribute to tumor formation as the cellular origins of cancers in many different types of organs including skin tissues3,4,5. Similarly, adult melanocyte stem cells (MCSCs) in the murine dorsal skin can work as melanoma cells of origin upon aberrant activation of the Ras/Raf and Akt pathways6. However, these oncogenic mutations alone are not able to efficiently induce tumor formation from quiescent MCSCs. Melanocytic tumors eventually develop when MCSCs become active during natural hair cycling. However, in this protocol, we will describe methods to artificially induce cellular activation of tumor-prone MCSCs, thus facilitating precise control of melanoma initiation6,7.
Through the methods described here, spatial and temporal control of cutaneous melanoma initiation from tumor-prone MCSCs expressing oncogenic BrafV600E together with loss of Pten expression can be successfully performed, as we have previously reported6. This method incorporates previous findings that demonstrate hair follicle stem cell activation through depilation as well as how exposure of murine skin to UV-B can facilitate activation of MCSCs resident to the hair follicle and translocation of this cellular subpopulation to the interfollicular epidermis6,8,9,10. These in vivo model systems can provide valuable information regarding how physiological and environmental changes can alter the cellular status of melanoma-prone MCSCs, which in turn can induce significant initiation of melanoma in the skin.

<table>
	<tbody>
		<tr>
			<td>Tamoxifen</td>
			<td>Sigma</td>
			<td>T5648-1G</td>
			<td>For systemic injection</td>
		</tr>
		<tr>
			<td>Tamoxifen</td>
			<td>Cayman Chemical</td>
			<td>13258</td>
			<td>For systemic injection</td>
		</tr>
		<tr>
			<td>Corn oil</td>
			<td>Sigma</td>
			<td>45-C8267-2.5L-EA</td>
			<td></td>
		</tr>
		<tr>
			<td>4OH-tamoxifen</td>
			<td>Sigma</td>
			<td>H7904-25MG</td>
			<td>For topical treatment</td>
		</tr>
		<tr>
			<td>26g 1/2&#34; needles</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>1 mL syringe</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Pet hair trimmer</td>
			<td>Wahl</td>
			<td>09990-502</td>
			<td></td>
		</tr>
		<tr>
			<td>Hair removal cream</td>
			<td>Nair</td>
			<td>n/a</td>
			<td>Available at most drug stores</td>
		</tr>
		<tr>
			<td>Cotton swabs</td>
			<td>various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ultraviolet light bulb</td>
			<td>UVP</td>
			<td>95-0042-08</td>
			<td>model XX-15M midrange UV lamp</td>
		</tr>
		<tr>
			<td>200 proof ethanol</td>
			<td>various</td>
			<td></td>
			<td>pure ethanol</td>
		</tr>
		<tr>
			<td>Histoplast PE</td>
			<td>Fisher Scientific</td>
			<td>22900700</td>
			<td>paraffin pellets</td>
		</tr>
		<tr>
			<td>Neutral Buffered Formalin, 10%</td>
			<td>Sigma</td>
			<td>HT501128-4L</td>
			<td></td>
		</tr>
		<tr>
			<td>Clear-Rite 3</td>
			<td>Thermo Scientific</td>
			<td>6901</td>
			<td>xylene substitute</td>
		</tr>
		<tr>
			<td>O.C.T. Compound</td>
			<td>Thermo</td>
			<td>23730571</td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue Cassette</td>
			<td>Sakura</td>
			<td>89199-430</td>
			<td>for FFPE processing</td>
		</tr>
		<tr>
			<td>Cryomolds</td>
			<td>Sakura</td>
			<td>4557</td>
			<td>25 x 20 mm</td>
		</tr>
		<tr>
			<td>FFPE metal mold</td>
			<td>Leica</td>
			<td>3803082</td>
			<td>24 x 24 mm</td>
		</tr>
		<tr>
			<td>Isoflurane</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Anesthesia inhalation system</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Fine scissor</td>
			<td>FST</td>
			<td>14085-09</td>
			<td>Straight, sharp/sharp</td>
		</tr>
		<tr>
			<td>Fine scissor</td>
			<td>FST</td>
			<td>14558-09</td>
			<td>Straight, sharp/sharp</td>
		</tr>
		<tr>
			<td>Metzenbaum</td>
			<td>FST</td>
			<td>14018-13</td>
			<td>Straight, blunt/blunt</td>
		</tr>
		<tr>
			<td>Forcep</td>
			<td>FST</td>
			<td>11252-00</td>
			<td>Dumont #5</td>
		</tr>
		<tr>
			<td>Forcep</td>
			<td>FST</td>
			<td>11018-12</td>
			<td>Micro-Adson</td>
		</tr>
		<tr>
			<td>Tyr-CreER; LSL-BrafV600E; Pten-f/f</td>
			<td>Jackson Labs</td>
			<td>13590</td>
			<td></td>
		</tr>
		<tr>
			<td>LSL-tdTomato</td>
			<td>Jackson Labs</td>
			<td>007914</td>
			<td>ai14</td>
		</tr>
		<tr>
			<td>Cre-1</td>
			<td></td>
			<td>n/a</td>
			<td>GCATTACCGGTCGATGCAACGAGTGATGAG</td>
		</tr>
		<tr>
			<td>Cre-2</td>
			<td></td>
			<td>n/a</td>
			<td>GAGTGAACGAACCTGGTCGAAATCAGTGCG</td>
		</tr>
		<tr>
			<td>Braf-V600E-1</td>
			<td></td>
			<td>n/a</td>
			<td>TGAGTATTTTTGTGGCAACTGC</td>
		</tr>
		<tr>
			<td>Braf-V600E-2</td>
			<td></td>
			<td>n/a</td>
			<td>CTCTGCTGGGAAAGCGGC</td>
		</tr>
		<tr>
			<td>Kras-G12D-1</td>
			<td></td>
			<td>n/a</td>
			<td>AGCTAGCCACCATGGCTTGAGTAAGTCTGCA</td>
		</tr>
		<tr>
			<td>Kras-G12D-2</td>
			<td></td>
			<td>n/a</td>
			<td>CCTTTACAAGCGCACGCAGACTGTAGA</td>
		</tr>
		<tr>
			<td>Pten-1</td>
			<td></td>
			<td>n/a</td>
			<td>ACTCAAGGCAGGGATGAGC</td>
		</tr>
		<tr>
			<td>Pten-2</td>
			<td></td>
			<td>n/a</td>
			<td>AATCTAGGGCCTCTTGTGCC</td>
		</tr>
		<tr>
			<td>Pten-3</td>
			<td></td>
			<td>n/a</td>
			<td>GCTTGATATCGAATTCCTGCAGC</td>
		</tr>
		<tr>
			<td>tdTomato-1</td>
			<td></td>
			<td>n/a</td>
			<td>AAGGGAGCTGCAGTGGAGTA</td>
		</tr>
		<tr>
			<td>tdTomato-2</td>
			<td></td>
			<td>n/a</td>
			<td>CCGAAAATCTGTGGGAAGTC</td>
		</tr>
		<tr>
			<td>tdTomato-3</td>
			<td></td>
			<td>n/a</td>
			<td>GGCATTAAAGCAGCGTATCC</td>
		</tr>
		<tr>
			<td>tdTomato-4</td>
			<td></td>
			<td>n/a</td>
			<td>CTGTTCCTGTACGGCATGG</td>
		</tr>
	</tbody>
</table>

spatial and temporal control of murine melanoma initiation from mutant melanocyte stem cells

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented with increasing depth, the incidence rate of cutaneous melanoma has shown a rapid and continuous increase during recent decades. In order to find effective preventative methods, it is important to understand the early steps of melanoma initiation in the skin. Previous data has demonstrated that follicular melanocyte stem cells (MCSCs) in the adult skin tissues can act as melanoma cells of origin when expressing oncogenic mutations and genetic alterations. Tumorigenesis arising from melanoma-prone MCSCs can be induced when MCSCs transition from a quiescent to active state. This transition in melanoma-prone MCSCs can be promoted by the modulation of either hair follicle stem cells&#39; activity state or through extrinsic environmental factors such as ultraviolet-B (UV-B). These factors can be artificially manipulated in the laboratory by chemical depilation, which causes transition of hair follicle stem cells and MCSCs from a quiescent to active state, and by UV-B exposure using a benchtop light. These methods provide successful spatial and temporal control of cutaneous melanoma initiation in the murine dorsal skin. Therefore, these in vivo model systems will be valuable to define the early steps of cutaneous melanoma initiation and could be used to test potential methods for tumor prevention.

Cutaneous melanoma initiation induced by chemical depilation
The procedure of chemical depilation is depicted in Figure 2. When mice are 7-weeks postnatal, their dorsal skin is in telogen. During telogen, hair follicle stem cells and MCSCs&#160;are known to be in a quiescent, resting state. The skin should show no significant hair growth after shaving. On the other hand, chemical de...

Watch this Scientific Journal Video about Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells at JoVE.com

Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

The following procedure describes a method for spatial and temporal control of melanocytic tumor initiation in murine dorsal skin, using a genetically engineered mouse model. This protocol describes macroscopic as well as microscopic cutaneous melanoma initiation.

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented ...

Melanoma is widely diagnosed worldwide, with increasing incidence. These protocols allow the early stages of melanoma initiation to be carefully controlled, facilitating the study of its development. By controlling the time and location of melanocyte stem cell activation, we have the ability to discern the changes within the stem cell population and its new strain melanoma initiation.Demonstrating the procedure will be Dahihm Kim and Luye An, graduate students from the laboratory. Two to three days before beginning the procedure, use an electric trimmer to shave the dorsal skin from each anesthetized seven-week-old mouse. On the day of the experiment, use a cotton swab to apply a thin layer of depilatory cream to the exposed skin.Once the cream has been evenly applied, use clean cotton swabs to remove the cream, followed by gentle wiping with a damp cloth to remove any residual cream. Then return each mouse to its home cage with monitoring until full recovery. For UV-B irradiation, cover the dorsal skin with UV-B protective material so that only the desired region will be exposed, and cover the UV chamber with a UV-resistant lid.Then turn on the UV-B lamp to irradiate the mouse for the appropriate experimental time period before returning the mouse to an empty cage with monitoring until full recovery. To isolate the skin samples, use an electric trimmer to remove any hair from the dorsal skin area of the euthanized irradiated mice, and lightly brush the exposed skin with a lint-free tissue to clear the area. Make a small incision with sharp scissors just above the base of the tail and insert large, blunt scissors into the incision to separate the subdermal connective tissues.Using sharp scissors, carefully cut along the edge of the skin region of interest to isolate the tissue sample and place the excised skin tissue onto a clean paper towel. Then use dull forceps to stretch the skin so that it adheres to the towel and is taut. When all of the samples have been harvested, place a skin sample and paper towel backing into a piece of folded filter paper immediately adjacent to the crease, taking care that the sample is smooth and not folded or crumpled.Close the sides of the filter paper with staples, and trim the paper. Then fully submerge the samples in 10%neutral buffered formalin for three to five hours at room temperature before washing the tissues with two five-minute washes in deionized water. After the second wash, carefully remove any residual material from the skin tissues, and trim the edges of the samples so that they are not jagged.Next, make three sagittal cuts in each sample so that the width of the strips is no more than five millimeters, and make transverse cuts so that the samples are no more than 20 millimeters wide. Position a cryo mold containing optimum cutting temperature or OCT medium in a portrait orientation, and place four to five pieces of skin on top of the OCT. When all of the pieces are in place, use two pairs of fine forceps to bring the long edge of each piece of skin to the bottom of the cryo mold so that the samples are vertical within the OCT and perpendicular to the base of the mold.Then fill the mold with additional OCT to the second lip and place the mold onto a flat surface of a piece of dry ice, using forceps to adjust any skin pieces that may have shifted during the transfer as the block begins to freeze as necessary. When mice are seven weeks post-natal, their dorsal skin is in telogen. During telogen, hair follicle and melanocyte stem cells are known to be in a quiescent resting state, and the skin should show no significant hair growth after shaving.Chemical depilation, however, can induce hair follicle stem cell activation, inducing significant hair growth within the region of interest. As chemical depilation can significantly induce the activation of both hair follicle and melanocyte stem cells, melanoma-prone melanocyte stem cells in an active state can form tumors and microscopic melanoma initiation can be observed within two weeks of chemical depilation. UV-B irradiation can also induce tumor initiation from quiescent, tumor-prone melanocyte stem cells.Importantly, UV-B induces the direct translocation of melanocyte stem cells from their follicular stem cell niche to the inter-follicular epidermis. Furthermore, UV-B can induce melanocyte stem cell-originating cutaneous melanoma formation throughout the interfollicular epidermis. Similar to dorsal skin, UV-B-induced melanoma initiation can be notably observed in other skin areas, such as ear skin.Indeed, compared to control ear skin, covered by UV-resistant cloth, ear skin exposed to UV-B demonstrates a higher pigmentation due to a higher burden of melanoma initiation. Different doses of UV-B may have different effects on mouse skin and melanocyte activity. Therefore, it is important to determine and optimize the irradiation dose prior to starting your experiment.

spatial-temporal-control-murine-melanoma-initiation-from-mutant

Research

JoVE Journal

Cancer Research

A Mouse Model of Fatigue Induced by Peripheral Irradiation

Cancer-related fatigue (CRF) is a distressing and costly condition that often affects patients receiving cancer treatments, including radiation therapy. Here we describe a method using targeted peripheral irradiation to induce fatigue-like behavior in mice. With appropriate shielding, the irradiation targets the lower abdominal/pelvic region of the mouse, sparing the brain, in an effort to model radiation treatment received by individuals with pelvic cancers. We deliver an irradiation dose that is sufficient to induce fatigue-like behavior in mice, measured by voluntary wheel-running activity (VWRA), without causing obvious morbidity. Since wheel running is a normal, voluntary behavior in mice, its use should have little confounding effect on other behavioral tests or biological measures. Hence, wheel running can be used as a feasible outcome measure in understanding the behavioral and biological correlates of fatigue. CRF is a complex condition with frequent comorbidities, and likely has causes related both to cancer and its various treatments. The methods described in this paper are useful for investigating radiation-induced changes that contribute to the development of CRF and, more generally, to explore the biological networks that can explain the development and persistence of a peripherally-triggered but centrally-driven behavior like fatigue.

We describe a method using targeted peripheral irradiation to induce fatigue-like behavior in mice. The selected non-lethal irradiation dose leads to a week-long reduction in voluntary wheel-running activity.

Cancer-related fatigue (CRF) is a distressing and costly condition that often affects patients receiving cancer treatments, including radiation therapy. ...

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to generate RNA-guided nucleases, such as CRISPR-associated (Cas) 9 for site-specific eukaryotic genome editing. Genome engineering by Cas9 is used to efficiently, easily and robustly modify endogenous genes in many biomedically-relevant mammalian cell lines and organisms. Here we show an example of how to utilize the CRISPR/Cas9 methodology to understand the biological function of specific genetic mutations. We model calreticulin (CALR) mutations in murine interleukin-3 (mIL-3) dependent pro-B (Ba/F3) cells by delivery of single guide RNAs (sgRNAs) targeting the endogenous Calr locus in the specific region where insertion and/or deletion (indel) CALR mutations occur in patients with myeloproliferative neoplasms (MPN), a type of blood cancer. The sgRNAs create double strand breaks (DSBs) in the targeted region that are repaired by non-homologous end joining (NHEJ) to give indels of various sizes. We then employ the standard Ba/F3 cellular transformation assay to understand the effect of physiological level expression of Calr mutations on hematopoietic cellular transformation. This approach can be applied to other genes to study their biological function in various mammalian cell lines.

Targeted gene editing using CRISPR/Cas9 has greatly facilitated the understanding of the biological functions of genes. Here, we utilize the CRISPR/Cas9 methodology to model calreticulin mutations in cytokine-dependent hematopoietic cells in order to study their oncogenic activity.

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene disruption, many of these studies have made use of complex gene knockout models. While these studies with knockout mice offer an elegant and time-tested system for investigating genotype-to-phenotype relationships, a rapid and scalable method for assessing candidate genes that play a role in AML cell proliferation or survival in AML models will help accelerate the parallel interrogation of multiple candidate genes. Recent advances in genome-editing technologies have dramatically enhanced our ability to perform genetic perturbations at an unprecedented scale. One such system of genome editing is the CRISPR-Cas9-based method that can be used to make rapid and efficacious alterations in the target cell genome. The ease and scalability of CRISPR/Cas9-mediated gene-deletion makes it one of the most attractive techniques for the interrogation of a large number of genes in phenotypic assays. Here, we present a simple assay using CRISPR/Cas9 mediated gene-disruption combined with high-throughput flow-cytometry-based competition assays to investigate the role of genes that may play an important role in the proliferation or survival of human and murine AML cell lines.

This manuscript describes a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR-Cas9-based method for simple and expeditious investigation of the role of multiple candidate genes in Acute Myeloid Leukemia (AML) cell proliferation in parallel. This technique is scalable and can be applied in other cancer cell lines as well.

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

Rapid Generation of Primary Murine Melanocyte and Fibroblast Cultures

Defects in fibroblast or melanocyte function are associated with skin diseases, including poor barrier function, defective wound healing, pigmentation defects and cancer. Vital to the understanding and amelioration of these diseases are experiments in primary fibroblast and melanocyte cultures. Nevertheless, current protocols for melanocyte isolation require that the epidermal and dermal layers of the skin are trypsinized and manually disassociated. This process is time consuming, technically challenging and contributes to inconsistent yields. Furthermore, methods to simultaneously generate pure fibroblast cultures from the same tissue sample are not readily available. Here, we describe an improved protocol for isolating melanocytes and fibroblasts from the skin of mice on postnatal days 0-4. In this protocol, whole skin is mechanically homogenized using a tissue chopper and then briefly digested with collagenase and trypsin. Cell populations are then isolated through selective plating followed by G418 treatment. This procedure results in consistent melanocyte and fibroblast yields from a single mouse in less than 90 min. This protocol is also easily scalable, allowing researchers to process large cohorts of animals without a significant increase in hands-on time. We show through flow cytometric assessments that cultures established using this protocol are highly enriched for melanocytes or fibroblasts.

This protocol outlines a rapid method to simultaneously generate melanocyte and fibroblast cultures from the skin of 0-4 day old mice. These primary cultures can be maintained and manipulated in vitro to study a variety of physiologically relevant processes, including skin cell biology, pigmentation, wound healing and melanoma.

Defects in fibroblast or melanocyte function are associated with skin diseases, including poor barrier function, defective wound healing, pigmentation ...

Flow Cytometric Analysis of Mitochondrial Reactive Oxygen Species in Murine Hematopoietic Stem and Progenitor Cells and MLL-AF9 Driven Leukemia

We present a flow cytometric approach for analyzing mitochondrial ROS in various live bone marrow (BM)-derived stem and progenitor cell populations from healthy mice as well as mice with AML driven by MLL-AF9. Specifically, we describe a two-step cell staining process, whereby healthy or leukemia BM cells are first stained with a fluorogenic dye that detects mitochondrial superoxides, followed by staining with fluorochrome-linked monoclonal antibodies that are used to distinguish various healthy and malignant hematopoietic progenitor populations. We also provide a strategy for acquiring and analyzing the samples by flow cytometry. The entire protocol can be carried out in a timeframe as short as 3-4 h. We also highlight the key variables to consider as well as the advantages and limitations of monitoring ROS production in the mitochondrial compartment of live hematopoietic and leukemia stem and progenitor subpopulations using fluorogenic dyes by flow cytometry. Furthermore, we present data that mitochondrial ROS abundance varies among distinct healthy HSPC sub-populations and leukemia progenitors and discuss the possible applications of this technique in hematologic research.

We describe a method for using multiparameter flow cytometry to detect mitochondrial reactive oxygen species (ROS) in murine healthy hematopoietic stem and progenitor cells (HSPCs) and leukemia cells from a mouse model of acute myeloid leukemia (AML) driven by MLL-AF9.

We present a flow cytometric approach for analyzing mitochondrial ROS in various live bone marrow (BM)-derived stem and progenitor cell populations from ...

Isolation of Exosome-Enriched Extracellular Vesicles Carrying Granulocyte-Macrophage Colony-Stimulating Factor from Embryonic Stem Cells

Embryonic stem cells (ESCs) are pluripotent stem cells capable of self-renewal and differentiation into all types of embryonic cells. Like many other cell types, ESCs release small membrane vesicles, such as exosomes, to the extracellular environment. Exosomes serve as essential mediators of intercellular communication and play a basic role in many (patho)physiological processes. Granulocyte-macrophage colony-stimulating factor (GM-CSF) functions as a cytokine to modulate the immune response. The presence of GM-CSF in exosomes has the potential to boost their immune-regulatory function. Here, GM-CSF was stably overexpressed in the murine ESC cell line ES-D3. A protocol was developed to isolate high-quality exosome-enriched extracellular vesicles (EVs) from ES-D3 cells overexpressing GM-CSF. Isolated exosome-enriched EVs were characterized by a variety of experimental approaches. Importantly, significant amounts of GM-CSF were found to be present in exosome-enriched EVs. Overall, GM-CSF-bearing exosome-enriched EVs from ESCs might function as cell-free vesicles to exert their immune-regulatory activities.

This study describes a method to isolate exosome-enriched extracellular vesicles carrying immune-stimulatory granulocyte macrophage colony-stimulating factors from embryonic stem cells.

Embryonic stem cells (ESCs) are pluripotent stem cells capable of self-renewal and differentiation into all types of embryonic cells. Like many other cell ...

Isolation of Stem-like Cells from 3-Dimensional Spheroid Cultures

Despite advances in adult stem cell research, identification and isolation of stem cells from tissue specimens remains a major challenge. While resident stem cells are relatively quiescent with niche restraints in adult tissues, they enter the cell cycle in anchor-free three-dimensional (3D) culture and undergo both symmetric and asymmetric cell division, giving rise to both stem and progenitor cells. The latter proliferate rapidly and are the major cell population at various stages of lineage commitment, forming heterogeneous spheroids. Using primary normal human prostate epithelial cells (HPrEC), a spheroid-based, label-retention assay was developed that permits the identification and functional isolation of the spheroid-initiating stem cells at a single cell resolution.
HPrEC or cell lines are two-dimensionally (2D) cultured with BrdU for 10 days to permit its incorporation into the DNA of all dividing cells, including self-renewing stem cells. Wash out commences upon transfer to the 3D culture for 5 days, during which stem cells self-renew through asymmetric division and initiate spheroid formation. While relatively quiescent daughter stem cells retain BrdU-labeled parental DNA, the daughter progenitors rapidly proliferate, losing the BrdU label. BrdU can be substituted with CFSE or Far Red pro-dyes, which permit live stem cell isolation by FACS. Stem cell characteristics are confirmed by in vitro spheroid formation, in vivo tissue regeneration assays, and by documenting their symmetric/asymmetric cell divisions. The isolated label-retaining stem cells can be rigorously interrogated by downstream molecular and biologic studies, including RNA-seq, ChIP-seq, single cell capture, metabolic activity, proteome profiling, immunocytochemistry, organoid formation, and in vivo tissue regeneration. Importantly, this marker-free functional stem cell isolation approach identifies stem-like cells from fresh cancer specimens and cancer cell lines from multiple organs, suggesting wide applicability. It can be used to identify cancer stem-like cell biomarkers, screen pharmaceuticals targeting cancer stem-like cells, and discover novel therapeutic targets in cancers.

Using human primary prostate epithelial cells, we report a novel biomarker-free method of functional characterization of stem-like cells by a spheroid-based label-retention assay. A step-by-step protocol is described for BrdU, CFSE, or Far Red 2D cell labeling; three-dimensional spheroid formation; label-retaining stem-like cell identification by immunocytochemistry; and isolation by FACS.

Despite advances in adult stem cell research, identification and isolation of stem cells from tissue specimens remains a major challenge. While resident ...

Preparation of Mitochondria from Ovarian Cancer Tissues and Control Ovarian Tissues for Quantitative Proteomics Analysis

Ovarian cancer is a common gynecologic cancer with high mortality but unclear molecular mechanism. Most ovarian cancers are diagnosed in the advanced stage, which seriously hampers therapy. Mitochondrial changes are a hallmark of human ovarian cancers, and mitochondria are the centers of energy metabolism, cell signaling, and oxidative stress. In-depth insights into the changes of the mitochondrial proteome in ovarian cancers compared to control ovarian tissue will benefit in-depth understanding of the molecular mechanisms of ovarian cancer, and the discovery of effective and reliable biomarkers and therapeutic targets. An effective mitochondrial preparation method coupled with an isobaric tag for relative and absolute quantification (iTRAQ) quantitative proteomics are presented here to analyze human ovarian cancer and control mitochondrial proteomes, including differential-speed centrifugation, density gradient centrifugation, quality assessment of mitochondrial samples, protein digestion with trypsin, iTRAQ labeling, strong cation exchange fractionation (SCX), liquid chromatography (LC), tandem mass spectrometry (MS/MS), database analysis, and quantitative analysis of mitochondrial proteins. Many proteins have been successfully identified to maximize the coverage of the human ovarian cancer mitochondrial proteome and to achieve the differentially expressed mitochondrial protein profile in human ovarian cancers.

This article presents a protocol of differential-speed centrifugation in combination with density gradient centrifugation to separate mitochondria from human ovarian cancer tissues and control ovarian tissues for quantitative proteomics analysis, resulting in a high-quality mitochondrial sample and high-throughput and high-reproducibility quantitative proteomics analysis of a human ovarian cancer mitochondrial proteome.

Ovarian cancer is a common gynecologic cancer with high mortality but unclear molecular mechanism. Most ovarian cancers are diagnosed in the advanced ...

Isolation and Functional Assessment of Human Breast Cancer Stem Cells from Cell and Tissue Samples

Breast cancer stem cells (BCSCs) are cancer cells with inherited or acquired stem cell-like characteristics. Despite their low frequency, they are major contributors to breast cancer initiation, relapse, metastasis and therapy resistance. It is imperative to understand the biology of breast cancer stem cells in order to identify novel therapeutic targets to treat breast cancer. Breast cancer stem cells are isolated and characterized based on expression of unique cell surface markers such as CD44, CD24 and enzymatic activity of aldehyde dehydrogenase (ALDH). These ALDHhighCD44+CD24- cells constitute the BCSC population and can be isolated by fluorescence-activated cell sorting (FACS) for downstream functional studies. Depending on the scientific question, different in vitro and in vivo methods can be used to assess the functional characteristics of BCSCs. Here, we provide a detailed experimental protocol for isolation of human BCSCs from both heterogenous populations of breast cancer cells as well as primary tumor tissue obtained from breast cancer patients. In addition, we highlight downstream in vitro and in vivo functional assays including colony forming assays, mammosphere assays, 3D culture models and tumor xenograft assays that can be used to assess BCSC function.

This experimental protocol describes the isolation of BCSCs from breast cancer cell and tissue samples as well as the in vitro and in vivo assays that can be used to assess BCSC phenotype and function.

Breast cancer stem cells (BCSCs) are cancer cells with inherited or acquired stem cell-like characteristics. Despite their low frequency, they are major ...

Implantation and Evaluation of Melanoma in the Murine Choroid via Optical Coherence Tomography

Establishing experimental choroidal melanoma models is challenging in terms of the ability to induce tumors at the correct localization. In addition, difficulties in observing posterior choroidal melanoma in vivo limit tumor location and growth evaluation in real-time. The approach described here optimizes techniques for establishing choroidal melanoma in mice via a multi-step sub-choroidal B16LS9 cell injection procedure. To enable precision in injecting into the small dimensions of the mouse uvea, the complete procedure is performed under a microscope. First, a conjunctival peritomy is formed in the dorsal-temporal area of the eye. Then, a tract into the sub-choroidal space is created by inserting a needle through the exposed sclera. This is followed by the insertion of a blunt needle into the tract and the injection of melanoma cells into the choroid. Immediately after injection, noninvasive optical coherence tomography (OCT) imaging is utilized to determine tumor location and progress. Retinal detachment is evaluated as a predictor of tumor site and size. The presented method enables the reproducible induction of choroid-localized melanoma in mice and the live imaging of tumor growth evaluation. As such, it provides a valuable tool for studying intraocular tumors.

Implantation and Evaluation of Melanoma in the Murine Choroid via Optical Coherence Tomography

The present protocol describes the implantation and evaluation of melanoma in the murine choroid utilizing optical coherence tomography.

Establishing experimental choroidal melanoma models is challenging in terms of the ability to induce tumors at the correct localization. In addition, ...