This work was supported by the Office of the Assistant Secretary of Defense for Health Affairs, through the Peer Reviewed Cancer Research Program under award W81XWH-16-1-0272. Opinions, interpretations, conclusions, and recommendations are those of the authors and are not necessarily endorsed by the Department of Defense. This work was also supported by a seed grant from the Cornell Stem Cell Program to A.C. White. H. Moon was supported by the Cornell Center for Vertebrate Genomics Scholar Program.

All animal procedures are performed in accordance with Cornell University Institutional Animal Care and Use Committee (IACUC).
1. Preparation
<ol>
	<li>Collect tail clips from 12 day postnatal mice and digest in 400 &#181;L of 0.05 N NaOH at 95 &#176;C for 1 h. Vortex and add 32 &#181;L of 1 M Tris-HCl, pH 7. Genotype mice according to PCR protocols provided through the Jackson Laboratory and identify mice with genotype of interest6. 
	- Tyr-CreER &#8211;...

<ol>
	<li>Wernli, K. J., Henrikson, N. B., Morrison, C. C., Nguyen, M., Pocobelli, G., Blasi, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+for+skin+cancer+in+adults:+updated+evidence+report+and+systematic+review+for+the+US+preventive+services+task+force.">Screening for skin cancer in adults: updated evidence report and systematic review for the US preventive services task force.</a> The Journal of the American Medical Association. 316 (4), 436-447 (2016).</li><li>Siegel, R. L., Miller, K. D., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+statistics,+2018.">Cancer statistics, 2018.</a> CA: A Cancer Journal for Clinicians. 68 (1), 7-30 (2018).</li><li>White, A. C., Lowry, W. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refining+the+role+for+adult+stem+cells+as+cancer+cells+of+origin.">Refining the role for adult stem cells as cancer cells of origin.</a> Trends in Cell Biology. 25 (1), 11-20 (2015).</li><li>Moon, H., Donahue, L. R., White, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+cancer+cells+of+origin+in+cutaneous+tumors.">Understanding cancer cells of origin in cutaneous tumors.</a> Cancer Stem Cells. , 263-284 (2016).</li><li>Blanpain, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracing+the+cellular+origin+of+cancer.">Tracing the cellular origin of cancer.</a> Nature Cell Biology. 15 (2), 126-134 (2013).</li><li>Moon, H., Donahue, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanocyte+stem+cell+activation+and+translocation+initiate+cutaneous+melanoma+in+response+to+UV+exposure.">Melanocyte stem cell activation and translocation initiate cutaneous melanoma in response to UV exposure.</a> Cell Stem Cell. 21 (5), 665-678 (2017).</li><li>Moon, H., White, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+path+from+melanocyte+stem+cells+to+cutaneous+melanoma+illuminated+by+UVB.">A path from melanocyte stem cells to cutaneous melanoma illuminated by UVB.</a> Molecular &#38; Cellular Oncology. 5 (2), e1409864 (2018).</li><li>Rabbani, P., Takeo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+activation+of+Wnt+in+epithelial+and+melanocyte+stem+cells+initiates+pigmented+hair+regeneration.">Coordinated activation of Wnt in epithelial and melanocyte stem cells initiates pigmented hair regeneration.</a> Cell. 145 (6), 941-955 (2011).</li><li>Chou, W. C., Takeo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+migration+of+follicular+melanocyte+stem+cells+to+the+epidermis+after+wounding+or+UVB+irradiation+is+dependent+on+Mc1r+signaling.">Direct migration of follicular melanocyte stem cells to the epidermis after wounding or UVB irradiation is dependent on Mc1r signaling.</a> Nature Medicine. 19 (7), 924-929 (2013).</li><li>Keyes, B. E., Segal, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nfatc1+orchestrates+aging+in+hair+follicle+stem+cells.">Nfatc1 orchestrates aging in hair follicle stem cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (51), (2013).</li><li>M&#252;ller-R&#246;ver, S., Handjiski, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+guide+for+the+accurate+classification+of+murine+hair+follicles+in+distinct+hair+cycle+stages.">A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages.</a> The Journal of Investigative Dermatology. 117 (1), 3-15 (2001).</li><li>Kastenmayer, R. J., Fain, M. A., Perdue, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+retrospective+study+of+idiopathic+ulcerative+dermatitis+in+mice+with+a+C57BL/6+background.">A retrospective study of idiopathic ulcerative dermatitis in mice with a C57BL/6 background.</a> Journal of the American Association for Laboratory Animal Science&#8239;: JAALAS. 45 (6), 8-12 (2006).</li><li>Vultur, A., Herlyn, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SnapShot:+melanoma.">SnapShot: melanoma.</a> Cancer Cell. 23 (5), (2013).</li><li>Dankort, D., Curley, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Braf(V600E)+cooperates+with+Pten+loss+to+induce+metastatic+melanoma.">Braf(V600E) cooperates with Pten loss to induce metastatic melanoma.</a> Nature Genetics. 41 (5), 544-552 (2009).</li><li>Viros, A., Sanchez-Laorden, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultraviolet+radiation+accelerates+BRAF-driven+melanomagenesis+by+targeting+TP53.">Ultraviolet radiation accelerates BRAF-driven melanomagenesis by targeting TP53.</a> Nature. 511 (7510), 478-482 (2014).</li></ol>

The authors declare no conflict of interest.

Hallmark genetic alterations frequently found in cutaneous melanoma tumors have been well described13. The most dominant driver mutation is BrafV600E, and a genetically engineered mouse model for BrafV600E-mediated melanoma was generated by the Bosenberg group14 and deposited in the Jackson Laboratory. Using this mouse model, our recent study demonstrated the requirement of cellular activation of tumor-prone MCSCs for the significant ...

Melanoma, the malignant form of melanocytic tumors, is the most aggressive cancer in the skin with cutaneous melanoma responsible for the majority of skin cancer deaths1. In the United States, melanoma is commonly diagnosed; it is projected to be the 5th to 6th most common cancer type among the estimated new cancer cases in 20182. Furthermore, while overall cancer incidences have shown the trend of gradual reduction in recent decades, cutaneous melanoma incidence rates during the last few decades demonstrate a continuous and rapid increase in both genders2.
To combat cutaneous melanoma more efficiently, it is important to clearly understand the early events of melanoma development from their cells of origin to better identify clinically effective preventative methods. It is now known that adult stem cells can significantly contribute to tumor formation as the cellular origins of cancers in many different types of organs including skin tissues3,4,5. Similarly, adult melanocyte stem cells (MCSCs) in the murine dorsal skin can work as melanoma cells of origin upon aberrant activation of the Ras/Raf and Akt pathways6. However, these oncogenic mutations alone are not able to efficiently induce tumor formation from quiescent MCSCs. Melanocytic tumors eventually develop when MCSCs become active during natural hair cycling. However, in this protocol, we will describe methods to artificially induce cellular activation of tumor-prone MCSCs, thus facilitating precise control of melanoma initiation6,7.
Through the methods described here, spatial and temporal control of cutaneous melanoma initiation from tumor-prone MCSCs expressing oncogenic BrafV600E together with loss of Pten expression can be successfully performed, as we have previously reported6. This method incorporates previous findings that demonstrate hair follicle stem cell activation through depilation as well as how exposure of murine skin to UV-B can facilitate activation of MCSCs resident to the hair follicle and translocation of this cellular subpopulation to the interfollicular epidermis6,8,9,10. These in vivo model systems can provide valuable information regarding how physiological and environmental changes can alter the cellular status of melanoma-prone MCSCs, which in turn can induce significant initiation of melanoma in the skin.

<table>
	<tbody>
		<tr>
			<td>Tamoxifen</td>
			<td>Sigma</td>
			<td>T5648-1G</td>
			<td>For systemic injection</td>
		</tr>
		<tr>
			<td>Tamoxifen</td>
			<td>Cayman Chemical</td>
			<td>13258</td>
			<td>For systemic injection</td>
		</tr>
		<tr>
			<td>Corn oil</td>
			<td>Sigma</td>
			<td>45-C8267-2.5L-EA</td>
			<td></td>
		</tr>
		<tr>
			<td>4OH-tamoxifen</td>
			<td>Sigma</td>
			<td>H7904-25MG</td>
			<td>For topical treatment</td>
		</tr>
		<tr>
			<td>26g 1/2&#34; needles</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>1 mL syringe</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Pet hair trimmer</td>
			<td>Wahl</td>
			<td>09990-502</td>
			<td></td>
		</tr>
		<tr>
			<td>Hair removal cream</td>
			<td>Nair</td>
			<td>n/a</td>
			<td>Available at most drug stores</td>
		</tr>
		<tr>
			<td>Cotton swabs</td>
			<td>various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ultraviolet light bulb</td>
			<td>UVP</td>
			<td>95-0042-08</td>
			<td>model XX-15M midrange UV lamp</td>
		</tr>
		<tr>
			<td>200 proof ethanol</td>
			<td>various</td>
			<td></td>
			<td>pure ethanol</td>
		</tr>
		<tr>
			<td>Histoplast PE</td>
			<td>Fisher Scientific</td>
			<td>22900700</td>
			<td>paraffin pellets</td>
		</tr>
		<tr>
			<td>Neutral Buffered Formalin, 10%</td>
			<td>Sigma</td>
			<td>HT501128-4L</td>
			<td></td>
		</tr>
		<tr>
			<td>Clear-Rite 3</td>
			<td>Thermo Scientific</td>
			<td>6901</td>
			<td>xylene substitute</td>
		</tr>
		<tr>
			<td>O.C.T. Compound</td>
			<td>Thermo</td>
			<td>23730571</td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue Cassette</td>
			<td>Sakura</td>
			<td>89199-430</td>
			<td>for FFPE processing</td>
		</tr>
		<tr>
			<td>Cryomolds</td>
			<td>Sakura</td>
			<td>4557</td>
			<td>25 x 20 mm</td>
		</tr>
		<tr>
			<td>FFPE metal mold</td>
			<td>Leica</td>
			<td>3803082</td>
			<td>24 x 24 mm</td>
		</tr>
		<tr>
			<td>Isoflurane</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Anesthesia inhalation system</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Fine scissor</td>
			<td>FST</td>
			<td>14085-09</td>
			<td>Straight, sharp/sharp</td>
		</tr>
		<tr>
			<td>Fine scissor</td>
			<td>FST</td>
			<td>14558-09</td>
			<td>Straight, sharp/sharp</td>
		</tr>
		<tr>
			<td>Metzenbaum</td>
			<td>FST</td>
			<td>14018-13</td>
			<td>Straight, blunt/blunt</td>
		</tr>
		<tr>
			<td>Forcep</td>
			<td>FST</td>
			<td>11252-00</td>
			<td>Dumont #5</td>
		</tr>
		<tr>
			<td>Forcep</td>
			<td>FST</td>
			<td>11018-12</td>
			<td>Micro-Adson</td>
		</tr>
		<tr>
			<td>Tyr-CreER; LSL-BrafV600E; Pten-f/f</td>
			<td>Jackson Labs</td>
			<td>13590</td>
			<td></td>
		</tr>
		<tr>
			<td>LSL-tdTomato</td>
			<td>Jackson Labs</td>
			<td>007914</td>
			<td>ai14</td>
		</tr>
		<tr>
			<td>Cre-1</td>
			<td></td>
			<td>n/a</td>
			<td>GCATTACCGGTCGATGCAACGAGTGATGAG</td>
		</tr>
		<tr>
			<td>Cre-2</td>
			<td></td>
			<td>n/a</td>
			<td>GAGTGAACGAACCTGGTCGAAATCAGTGCG</td>
		</tr>
		<tr>
			<td>Braf-V600E-1</td>
			<td></td>
			<td>n/a</td>
			<td>TGAGTATTTTTGTGGCAACTGC</td>
		</tr>
		<tr>
			<td>Braf-V600E-2</td>
			<td></td>
			<td>n/a</td>
			<td>CTCTGCTGGGAAAGCGGC</td>
		</tr>
		<tr>
			<td>Kras-G12D-1</td>
			<td></td>
			<td>n/a</td>
			<td>AGCTAGCCACCATGGCTTGAGTAAGTCTGCA</td>
		</tr>
		<tr>
			<td>Kras-G12D-2</td>
			<td></td>
			<td>n/a</td>
			<td>CCTTTACAAGCGCACGCAGACTGTAGA</td>
		</tr>
		<tr>
			<td>Pten-1</td>
			<td></td>
			<td>n/a</td>
			<td>ACTCAAGGCAGGGATGAGC</td>
		</tr>
		<tr>
			<td>Pten-2</td>
			<td></td>
			<td>n/a</td>
			<td>AATCTAGGGCCTCTTGTGCC</td>
		</tr>
		<tr>
			<td>Pten-3</td>
			<td></td>
			<td>n/a</td>
			<td>GCTTGATATCGAATTCCTGCAGC</td>
		</tr>
		<tr>
			<td>tdTomato-1</td>
			<td></td>
			<td>n/a</td>
			<td>AAGGGAGCTGCAGTGGAGTA</td>
		</tr>
		<tr>
			<td>tdTomato-2</td>
			<td></td>
			<td>n/a</td>
			<td>CCGAAAATCTGTGGGAAGTC</td>
		</tr>
		<tr>
			<td>tdTomato-3</td>
			<td></td>
			<td>n/a</td>
			<td>GGCATTAAAGCAGCGTATCC</td>
		</tr>
		<tr>
			<td>tdTomato-4</td>
			<td></td>
			<td>n/a</td>
			<td>CTGTTCCTGTACGGCATGG</td>
		</tr>
	</tbody>
</table>

spatial and temporal control of murine melanoma initiation from mutant melanocyte stem cells

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented with increasing depth, the incidence rate of cutaneous melanoma has shown a rapid and continuous increase during recent decades. In order to find effective preventative methods, it is important to understand the early steps of melanoma initiation in the skin. Previous data has demonstrated that follicular melanocyte stem cells (MCSCs) in the adult skin tissues can act as melanoma cells of origin when expressing oncogenic mutations and genetic alterations. Tumorigenesis arising from melanoma-prone MCSCs can be induced when MCSCs transition from a quiescent to active state. This transition in melanoma-prone MCSCs can be promoted by the modulation of either hair follicle stem cells&#39; activity state or through extrinsic environmental factors such as ultraviolet-B (UV-B). These factors can be artificially manipulated in the laboratory by chemical depilation, which causes transition of hair follicle stem cells and MCSCs from a quiescent to active state, and by UV-B exposure using a benchtop light. These methods provide successful spatial and temporal control of cutaneous melanoma initiation in the murine dorsal skin. Therefore, these in vivo model systems will be valuable to define the early steps of cutaneous melanoma initiation and could be used to test potential methods for tumor prevention.

Cutaneous melanoma initiation induced by chemical depilation
The procedure of chemical depilation is depicted in Figure 2. When mice are 7-weeks postnatal, their dorsal skin is in telogen. During telogen, hair follicle stem cells and MCSCs&#160;are known to be in a quiescent, resting state. The skin should show no significant hair growth after shaving. On the other hand, chemical de...

Watch this Scientific Journal Video about Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells at JoVE.com

Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

The following procedure describes a method for spatial and temporal control of melanocytic tumor initiation in murine dorsal skin, using a genetically engineered mouse model. This protocol describes macroscopic as well as microscopic cutaneous melanoma initiation.

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented ...

Melanoma is widely diagnosed worldwide, with increasing incidence. These protocols allow the early stages of melanoma initiation to be carefully controlled, facilitating the study of its development. By controlling the time and location of melanocyte stem cell activation, we have the ability to discern the changes within the stem cell population and its new strain melanoma initiation.Demonstrating the procedure will be Dahihm Kim and Luye An, graduate students from the laboratory. Two to three days before beginning the procedure, use an electric trimmer to shave the dorsal skin from each anesthetized seven-week-old mouse. On the day of the experiment, use a cotton swab to apply a thin layer of depilatory cream to the exposed skin.Once the cream has been evenly applied, use clean cotton swabs to remove the cream, followed by gentle wiping with a damp cloth to remove any residual cream. Then return each mouse to its home cage with monitoring until full recovery. For UV-B irradiation, cover the dorsal skin with UV-B protective material so that only the desired region will be exposed, and cover the UV chamber with a UV-resistant lid.Then turn on the UV-B lamp to irradiate the mouse for the appropriate experimental time period before returning the mouse to an empty cage with monitoring until full recovery. To isolate the skin samples, use an electric trimmer to remove any hair from the dorsal skin area of the euthanized irradiated mice, and lightly brush the exposed skin with a lint-free tissue to clear the area. Make a small incision with sharp scissors just above the base of the tail and insert large, blunt scissors into the incision to separate the subdermal connective tissues.Using sharp scissors, carefully cut along the edge of the skin region of interest to isolate the tissue sample and place the excised skin tissue onto a clean paper towel. Then use dull forceps to stretch the skin so that it adheres to the towel and is taut. When all of the samples have been harvested, place a skin sample and paper towel backing into a piece of folded filter paper immediately adjacent to the crease, taking care that the sample is smooth and not folded or crumpled.Close the sides of the filter paper with staples, and trim the paper. Then fully submerge the samples in 10%neutral buffered formalin for three to five hours at room temperature before washing the tissues with two five-minute washes in deionized water. After the second wash, carefully remove any residual material from the skin tissues, and trim the edges of the samples so that they are not jagged.Next, make three sagittal cuts in each sample so that the width of the strips is no more than five millimeters, and make transverse cuts so that the samples are no more than 20 millimeters wide. Position a cryo mold containing optimum cutting temperature or OCT medium in a portrait orientation, and place four to five pieces of skin on top of the OCT. When all of the pieces are in place, use two pairs of fine forceps to bring the long edge of each piece of skin to the bottom of the cryo mold so that the samples are vertical within the OCT and perpendicular to the base of the mold.Then fill the mold with additional OCT to the second lip and place the mold onto a flat surface of a piece of dry ice, using forceps to adjust any skin pieces that may have shifted during the transfer as the block begins to freeze as necessary. When mice are seven weeks post-natal, their dorsal skin is in telogen. During telogen, hair follicle and melanocyte stem cells are known to be in a quiescent resting state, and the skin should show no significant hair growth after shaving.Chemical depilation, however, can induce hair follicle stem cell activation, inducing significant hair growth within the region of interest. As chemical depilation can significantly induce the activation of both hair follicle and melanocyte stem cells, melanoma-prone melanocyte stem cells in an active state can form tumors and microscopic melanoma initiation can be observed within two weeks of chemical depilation. UV-B irradiation can also induce tumor initiation from quiescent, tumor-prone melanocyte stem cells.Importantly, UV-B induces the direct translocation of melanocyte stem cells from their follicular stem cell niche to the inter-follicular epidermis. Furthermore, UV-B can induce melanocyte stem cell-originating cutaneous melanoma formation throughout the interfollicular epidermis. Similar to dorsal skin, UV-B-induced melanoma initiation can be notably observed in other skin areas, such as ear skin.Indeed, compared to control ear skin, covered by UV-resistant cloth, ear skin exposed to UV-B demonstrates a higher pigmentation due to a higher burden of melanoma initiation. Different doses of UV-B may have different effects on mouse skin and melanocyte activity. Therefore, it is important to determine and optimize the irradiation dose prior to starting your experiment.

spatial-temporal-control-murine-melanoma-initiation-from-mutant

Research

JoVE Journal

Cancer Research

8.5K Görüntüleme.  Cornell University. Melanom yaygın olarak dünya çapında teşhis edilir, artan insidansı ile. Bu protokoller melanom inisiyasyonunun erken evrelerinin dikkatle kontrol edilmesine izin vererek gelişiminin incelenmesini kolaylaştırır. Melanosit kök hücre aktivasyonunun zamanını ve yerini kontrol ederek, kök hücre popülasyonu ve yeni suş melanom inisiyasyonundaki değişiklikleri ayırt etme yeteneğine sahibiz.Prosedürü gösteren Dahihm Kim ve Luye An, laboratuvardan yüksek lisans öğren...