This work was supported by the Office of the Assistant Secretary of Defense for Health Affairs, through the Peer Reviewed Cancer Research Program under award W81XWH-16-1-0272. Opinions, interpretations, conclusions, and recommendations are those of the authors and are not necessarily endorsed by the Department of Defense. This work was also supported by a seed grant from the Cornell Stem Cell Program to A.C. White. H. Moon was supported by the Cornell Center for Vertebrate Genomics Scholar Program.

All animal procedures are performed in accordance with Cornell University Institutional Animal Care and Use Committee (IACUC).
1. Preparation
<ol>
	<li>Collect tail clips from 12 day postnatal mice and digest in 400 &#181;L of 0.05 N NaOH at 95 &#176;C for 1 h. Vortex and add 32 &#181;L of 1 M Tris-HCl, pH 7. Genotype mice according to PCR protocols provided through the Jackson Laboratory and identify mice with genotype of interest6. 
	- Tyr-CreER &#8211; hemizygous (+/CreER) 
	- LSL-BrafV600E &#8211; heterozygous (+/LSL-V600E) 
	- Pten &#8211; homozygous flox (flox/flox) 
	- LSL-tdTomato &#8211; hemizygous (+/LSL-tdTomato) 
	NOTE: Primer sequences are provided in Table of Materials.</li>
	<li>Use a hair clipper (electric trimmer) to shave the dorsal skin 2 to 3 days before all experiments described below, and when mice are approximately 7 weeks of age. Take care not to damage the thin mouse skin using the electric trimmer as any injury may elicit a wound healing response which will activate hair follicle stem cells, including MCSCs.</li>
	<li>Determine if the hair cycle is in telogen and whether the skin is wounded during the waiting period. If the skin shows any sign of injury, the mouse should not be used for these procedures. 
	NOTE: Although the hair cycle may slightly differ between genetic backgrounds, at this age the hair cycle in the dorsal skin is usually in the telogen state11. The Tyr-CreER transgene will target MCSCs in telogen skin, and the subsequent genetic alterations will be permanently expressed in all lineages of the MCSC, including differentiated melanocytes and melanocytic tumors.</li>
</ol>
2. Tamoxifen Treatment for Cre-Lox genetic Recombination
<ol>
	<li>Preparation of tamoxifen for intraperitoneal injection (IP) or topical administration for systemic or localized genetic recombination 
	NOTE: In order for tamoxifen to induce recombination, it must first be metabolized by the liver to 4-hydroxytamoxifen (4-OHT), which can bind to and activate the CreER. Topical application of tamoxifen will not be metabolized in this way and 4-OHT must directly be used. Only one method of tamoxifen delivery is required for sufficient recombination.
	<ol>
		<li>Tamoxifen: Prepare tamoxifen at a concentration of 10 mg mL-1 dissolved in corn oil. To aid in the dissolution of the drug into solution, add up to 10% total volume of 100% molecular grade ethanol to the drug in powder form, vortex for 3 min and then add remaining volume of corn oil. Continue to vortex until crystalline material is no longer apparent in solution. Tamoxifen solution can be sterilized by passing through a 0.2 &#181;m filter. Proceed to step 2.2.1 for treatment.</li>
		<li>4-OHT: Prepare a stock solution of hydroxytamoxifen up to 3 mg mL-1 in 100% ethanol. Then, a working solution can be applied as much as needed to cover the skin area of interest (generally a single application). 
		NOTE: A stock solution of hydroxytamoxifen can be dissolved in 100% ethanol for a final concentration of 5 mM. Then, to prepare a working solution, 5 &#181;L of 4OH-tamoxifen stock solution can be diluted into 15 &#181;L of 100% ethanol. For 4 mm2 area, 1 to 3 &#181;L of working solution can be topically applied.</li>
	</ol>
	</li>
	<li>Treating mice with tamoxifen either systemically or topically 
	<ol>
		<li>For systemic treatment, administer 2 mg of tamoxifen via IP injection once daily for 3 days using a 26 G needle. 
		NOTE: Using this model, approximately 93% &#177; 4% of quiescent MCSCs are labeled with tdTomato6.</li>
		<li>For regional activation, perform one topical treatment with 4-OHT. Cover the skin area of interest with the working solution. The amount of working solution can be determined by the size of region of interest as described in step 2.1.2.</li>
	</ol>
	</li>
	<li>At 48 h following the last dose of tamoxifen, proceed to step 3 for chemical depilation induced tumor initiation or to step 4 for UV-B induced tumor initiation</li>
</ol>
3. Chemical Depilation
<ol>
	<li>Equip a mouse treatment room containing an isoflurane system with the following required materials: hair removal cream, cottons swabs, paper cloth, and water.</li>
	<li>Place the mouse into the induction chamber and anesthetize with 3.5 to 4.5% isoflurane and 1 L/min oxygen.</li>
	<li>Once the respiratory rate has stabilized, confirm that the mouse is in the proper plane of anesthesia by performing a toe pinch and transfer the mouse to the main tube maintaining anesthesia with 1 to 1.5% isoflurane and 1 L/min oxygen. Apply eye ointment to keep the eyes from drying while under anesthesia.</li>
	<li>Use a cotton swab to apply a thin layer of hair removal cream to the shaved region of the mouse skin.</li>
	<li>Once the cream has been evenly applied, use clean cotton swabs to begin removal. The total time that the cream is in contact with the skin should not exceed 1 min.</li>
	<li>Gently wipe the skin with a damp paper cloth and ensure that any residual cream has been removed. 
	NOTE: Hair removal cream can cause irritation to the skin if it is not completely removed. Some mice, such as those on a C57BL/6 background, can be prone to developing dermatitis12. Although rare, some animals will develop dermatitis within 24 h after hair removal cream application or mechanical depilation. Make sure to check the mice the day after treatment to look for any signs of regional skin irritation.</li>
	<li>Discard the removed hair shafts and any materials used into a biohazard bin.</li>
	<li>Place the mouse into an empty, clean mouse cage until the anesthesia has worn off.</li>
	<li>Return the mice to their cages.</li>
</ol>
4. UV-B Irradiation
<ol>
	<li>Equip a mouse treatment room containing an isoflurane system with the following required materials: UV-B light system, UV-B light meter, protective covering for the mouse, additional UV-B protective PPE for researcher, and a timer.</li>
	<li>Mice should be irradiated at the UV-B dose of interest (i.e., 0-180 mJ/cm2). Use the UV-B light meter to determine the appropriate length of time to irradiate the mice. 
	NOTE: mW/cm2 x time = dose</li>
	<li>Anesthetize the mouse with isoflurane. While in the induction chamber, use 3.5 to 4.5% isoflurane and 1 L/min oxygen.</li>
	<li>Once the mouse is stabilized, confirm anesthesia effects with a toe pinch and transfer the mouse to the main anesthesia tube located in UV chamber. Apply eye ointment to prevent the eyes from drying while under anesthesia. Maintain anesthesia with 1 to 1.5% isoflurane and 1 L/min oxygen.</li>
	<li>Cover the dorsal skin with UV-B protective material so that only the desired region will be exposed. 
	NOTE: At this time, appropriate PPE should be utilized.&#160;The length of time needed to irradiate the mouse is dependent on the intensity of the light bulb used, but anesthesia may need to be monitored if the required time exceeds 30 s.&#160;</li>
	<li>Cover the UV chamber using UV-resistant lid or any other suitable materials.</li>
	<li>Turn on the UV-B lamp and irradiate the mouse for the time determined by researchers for the specific aim.</li>
	<li>Turn off the UV system and isoflurane, then place the mouse to an empty mouse cage until the anesthesia has worn off.</li>
	<li>Return the mice to their cages.</li>
</ol>
5. Tissue Processing
<ol>
	<li>Skin isolation
	<ol>
		<li>Obtain the following prior to starting: necropsy instruments, filter paper and paper towels.</li>
		<li>Euthanize the mice according to IACUC approved protocols, and confirm death prior to proceeding.</li>
		<li>Using a hair clipper, shave any hair from the dorsal skin area. Lightly brush the area with a lint free tissue to clear the area.</li>
		<li>Make a small incision with sharp scissors just above the base of the tail.</li>
		<li>Insert large blunt scissors into the incision and separate the subdermal connective tissues.</li>
		<li>Carefully isolate the skin region of interest by cutting with sharp scissors along the edge of the tissue.</li>
		<li>Place the skin tissue onto a clean paper towel and use dull forceps to stretch the skin so that it adheres to the towel and is taught. This step serves to provide additional support for the tissue so that it can be manipulated and processed while maintaining its shape. 
		NOTE: Be careful to only handle the outside regions of the skin tissue, as the forceps may cause damage to the skin which can be seen histologically.</li>
	</ol>
	</li>
	<li>Tissue fixation
	<ol>
		<li>Fold a piece of filter paper in half and label appropriately. Place the skin along with paper towel backing into the folded paper immediately adjacent to the crease, ensuring that the sample is smooth and not folded or crumpled. Seal the filter paper by stapling the open sides, and then trim so that the remaining paper can be used for future samples. 
		NOTE: This step is performed so that the skin retains its shape during fixation.</li>
		<li>Fully submerge the tissue sample in 10% neutral buffered formalin for 3 to 5 h at room temperature or overnight at 4 &#176;C.</li>
		<li>Following fixation, remove the samples from formalin, wash in deionized water (2x, 5 min each) and proceed to make tissue blocks. Carefully remove any residual material from the skin tissue (i.e., residual paper).</li>
	</ol>
	</li>
	<li>Making frozen tissue blocks (Figure 1)
	<ol>
		<li>Trim the edges of the skin sample so that they are not jagged and then make 3 sagittal cuts. The width of these strips should not be more than the height of the cryomold (5 mm). Next, make transverse cuts to have pieces of skin which are not longer than the width of the cryomold (20 mm) and can be embedded. Repeat with the remaining half of dorsal skin, or save the tissue for other uses (alternately, save half prior to fixation). 
		NOTE: It&#8217;s important to keep skin pieces in proper orientation.</li>
		<li>Orient the cryomold (25 x 20 x 5 mm3) in a portrait orientation and place 4 to 5 pieces of skin on top of the OCT. Once all pieces are in place, use 2 pairs of fine forceps to bring the long edge of skin to the bottom of the cryomold. Skin should now be standing up in the OCT perpendicular to the base of the mold. Take care to minimize formation of air pockets within the OCT during this step (Figure 1).</li>
		<li>Fill the mold with OCT to the second lip, and place on the flat surface of dry ice. Use forceps to adjust any skin pieces that may have shifted during transfer as the block begins to freeze. Once the bottom layer is solidified, manipulation of tissues will be impossible.</li>
		<li>Cut 8-10 &#181;m slides for analysis.</li>
	</ol>
	</li>
	<li>Making Formalin Fixed Paraffin Embedded (FFPE) tissue blocks
	<ol>
		<li>Place 2 pieces of fixed skin into a labeled cassette and dehydrate in increasing concentrations of ethanol (75% ethanol for 30 min, 85% for 30 min, 90% for 30 min, 95% for 30 min, 100% for 2x 30 min, Xylene or xylene substitute for 2x 30 min). Incubate with Paraffin at 58-60&#730;, first for 30 min, and then overnight.</li>
		<li>Embed the tissue in a 24 x 24 mm2 stainless steel tissue mold with liquid paraffin and solidify at -5 &#176;C. The tissue orientation should be similar to that of frozen tissue blocks so that longitudinal sections across multiple hair follicles can be visualized (Figure 1).</li>
		<li>Once the paraffin has solidified, remove the mold and cut into 5-10 &#956;m sections for analysis.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wernli, K. J., Henrikson, N. B., Morrison, C. C., Nguyen, M., Pocobelli, G., Blasi, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+for+skin+cancer+in+adults:+updated+evidence+report+and+systematic+review+for+the+US+preventive+services+task+force.">Screening for skin cancer in adults: updated evidence report and systematic review for the US preventive services task force.</a> The Journal of the American Medical Association. 316 (4), 436-447 (2016).</li><li>Siegel, R. L., Miller, K. D., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+statistics,+2018.">Cancer statistics, 2018.</a> CA: A Cancer Journal for Clinicians. 68 (1), 7-30 (2018).</li><li>White, A. C., Lowry, W. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refining+the+role+for+adult+stem+cells+as+cancer+cells+of+origin.">Refining the role for adult stem cells as cancer cells of origin.</a> Trends in Cell Biology. 25 (1), 11-20 (2015).</li><li>Moon, H., Donahue, L. R., White, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+cancer+cells+of+origin+in+cutaneous+tumors.">Understanding cancer cells of origin in cutaneous tumors.</a> Cancer Stem Cells. , 263-284 (2016).</li><li>Blanpain, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracing+the+cellular+origin+of+cancer.">Tracing the cellular origin of cancer.</a> Nature Cell Biology. 15 (2), 126-134 (2013).</li><li>Moon, H., Donahue, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanocyte+stem+cell+activation+and+translocation+initiate+cutaneous+melanoma+in+response+to+UV+exposure.">Melanocyte stem cell activation and translocation initiate cutaneous melanoma in response to UV exposure.</a> Cell Stem Cell. 21 (5), 665-678 (2017).</li><li>Moon, H., White, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+path+from+melanocyte+stem+cells+to+cutaneous+melanoma+illuminated+by+UVB.">A path from melanocyte stem cells to cutaneous melanoma illuminated by UVB.</a> Molecular &#38; Cellular Oncology. 5 (2), e1409864 (2018).</li><li>Rabbani, P., Takeo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+activation+of+Wnt+in+epithelial+and+melanocyte+stem+cells+initiates+pigmented+hair+regeneration.">Coordinated activation of Wnt in epithelial and melanocyte stem cells initiates pigmented hair regeneration.</a> Cell. 145 (6), 941-955 (2011).</li><li>Chou, W. C., Takeo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+migration+of+follicular+melanocyte+stem+cells+to+the+epidermis+after+wounding+or+UVB+irradiation+is+dependent+on+Mc1r+signaling.">Direct migration of follicular melanocyte stem cells to the epidermis after wounding or UVB irradiation is dependent on Mc1r signaling.</a> Nature Medicine. 19 (7), 924-929 (2013).</li><li>Keyes, B. E., Segal, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nfatc1+orchestrates+aging+in+hair+follicle+stem+cells.">Nfatc1 orchestrates aging in hair follicle stem cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (51), (2013).</li><li>M&#252;ller-R&#246;ver, S., Handjiski, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+guide+for+the+accurate+classification+of+murine+hair+follicles+in+distinct+hair+cycle+stages.">A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages.</a> The Journal of Investigative Dermatology. 117 (1), 3-15 (2001).</li><li>Kastenmayer, R. J., Fain, M. A., Perdue, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+retrospective+study+of+idiopathic+ulcerative+dermatitis+in+mice+with+a+C57BL/6+background.">A retrospective study of idiopathic ulcerative dermatitis in mice with a C57BL/6 background.</a> Journal of the American Association for Laboratory Animal Science&#8239;: JAALAS. 45 (6), 8-12 (2006).</li><li>Vultur, A., Herlyn, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SnapShot:+melanoma.">SnapShot: melanoma.</a> Cancer Cell. 23 (5), (2013).</li><li>Dankort, D., Curley, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Braf(V600E)+cooperates+with+Pten+loss+to+induce+metastatic+melanoma.">Braf(V600E) cooperates with Pten loss to induce metastatic melanoma.</a> Nature Genetics. 41 (5), 544-552 (2009).</li><li>Viros, A., Sanchez-Laorden, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultraviolet+radiation+accelerates+BRAF-driven+melanomagenesis+by+targeting+TP53.">Ultraviolet radiation accelerates BRAF-driven melanomagenesis by targeting TP53.</a> Nature. 511 (7510), 478-482 (2014).</li></ol>

The authors declare no conflict of interest.

Hallmark genetic alterations frequently found in cutaneous melanoma tumors have been well described13. The most dominant driver mutation is BrafV600E, and a genetically engineered mouse model for BrafV600E-mediated melanoma was generated by the Bosenberg group14 and deposited in the Jackson Laboratory. Using this mouse model, our recent study demonstrated the requirement of cellular activation of tumor-prone MCSCs for the significant ...

Melanoma, the malignant form of melanocytic tumors, is the most aggressive cancer in the skin with cutaneous melanoma responsible for the majority of skin cancer deaths1. In the United States, melanoma is commonly diagnosed; it is projected to be the 5th to 6th most common cancer type among the estimated new cancer cases in 20182. Furthermore, while overall cancer incidences have shown the trend of gradual reduction in recent decades, cutaneous melanoma incidence rates during the last few decades demonstrate a continuous and rapid increase in both genders2.
To combat cutaneous melanoma more efficiently, it is important to clearly understand the early events of melanoma development from their cells of origin to better identify clinically effective preventative methods. It is now known that adult stem cells can significantly contribute to tumor formation as the cellular origins of cancers in many different types of organs including skin tissues3,4,5. Similarly, adult melanocyte stem cells (MCSCs) in the murine dorsal skin can work as melanoma cells of origin upon aberrant activation of the Ras/Raf and Akt pathways6. However, these oncogenic mutations alone are not able to efficiently induce tumor formation from quiescent MCSCs. Melanocytic tumors eventually develop when MCSCs become active during natural hair cycling. However, in this protocol, we will describe methods to artificially induce cellular activation of tumor-prone MCSCs, thus facilitating precise control of melanoma initiation6,7.
Through the methods described here, spatial and temporal control of cutaneous melanoma initiation from tumor-prone MCSCs expressing oncogenic BrafV600E together with loss of Pten expression can be successfully performed, as we have previously reported6. This method incorporates previous findings that demonstrate hair follicle stem cell activation through depilation as well as how exposure of murine skin to UV-B can facilitate activation of MCSCs resident to the hair follicle and translocation of this cellular subpopulation to the interfollicular epidermis6,8,9,10. These in vivo model systems can provide valuable information regarding how physiological and environmental changes can alter the cellular status of melanoma-prone MCSCs, which in turn can induce significant initiation of melanoma in the skin.

<table>
	<tbody>
		<tr>
			<td>Tamoxifen</td>
			<td>Sigma</td>
			<td>T5648-1G</td>
			<td>For systemic injection</td>
		</tr>
		<tr>
			<td>Tamoxifen</td>
			<td>Cayman Chemical</td>
			<td>13258</td>
			<td>For systemic injection</td>
		</tr>
		<tr>
			<td>Corn oil</td>
			<td>Sigma</td>
			<td>45-C8267-2.5L-EA</td>
			<td></td>
		</tr>
		<tr>
			<td>4OH-tamoxifen</td>
			<td>Sigma</td>
			<td>H7904-25MG</td>
			<td>For topical treatment</td>
		</tr>
		<tr>
			<td>26g 1/2&#34; needles</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>1 mL syringe</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Pet hair trimmer</td>
			<td>Wahl</td>
			<td>09990-502</td>
			<td></td>
		</tr>
		<tr>
			<td>Hair removal cream</td>
			<td>Nair</td>
			<td>n/a</td>
			<td>Available at most drug stores</td>
		</tr>
		<tr>
			<td>Cotton swabs</td>
			<td>various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ultraviolet light bulb</td>
			<td>UVP</td>
			<td>95-0042-08</td>
			<td>model XX-15M midrange UV lamp</td>
		</tr>
		<tr>
			<td>200 proof ethanol</td>
			<td>various</td>
			<td></td>
			<td>pure ethanol</td>
		</tr>
		<tr>
			<td>Histoplast PE</td>
			<td>Fisher Scientific</td>
			<td>22900700</td>
			<td>paraffin pellets</td>
		</tr>
		<tr>
			<td>Neutral Buffered Formalin, 10%</td>
			<td>Sigma</td>
			<td>HT501128-4L</td>
			<td></td>
		</tr>
		<tr>
			<td>Clear-Rite 3</td>
			<td>Thermo Scientific</td>
			<td>6901</td>
			<td>xylene substitute</td>
		</tr>
		<tr>
			<td>O.C.T. Compound</td>
			<td>Thermo</td>
			<td>23730571</td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue Cassette</td>
			<td>Sakura</td>
			<td>89199-430</td>
			<td>for FFPE processing</td>
		</tr>
		<tr>
			<td>Cryomolds</td>
			<td>Sakura</td>
			<td>4557</td>
			<td>25 x 20 mm</td>
		</tr>
		<tr>
			<td>FFPE metal mold</td>
			<td>Leica</td>
			<td>3803082</td>
			<td>24 x 24 mm</td>
		</tr>
		<tr>
			<td>Isoflurane</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Anesthesia inhalation system</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Fine scissor</td>
			<td>FST</td>
			<td>14085-09</td>
			<td>Straight, sharp/sharp</td>
		</tr>
		<tr>
			<td>Fine scissor</td>
			<td>FST</td>
			<td>14558-09</td>
			<td>Straight, sharp/sharp</td>
		</tr>
		<tr>
			<td>Metzenbaum</td>
			<td>FST</td>
			<td>14018-13</td>
			<td>Straight, blunt/blunt</td>
		</tr>
		<tr>
			<td>Forcep</td>
			<td>FST</td>
			<td>11252-00</td>
			<td>Dumont #5</td>
		</tr>
		<tr>
			<td>Forcep</td>
			<td>FST</td>
			<td>11018-12</td>
			<td>Micro-Adson</td>
		</tr>
		<tr>
			<td>Tyr-CreER; LSL-BrafV600E; Pten-f/f</td>
			<td>Jackson Labs</td>
			<td>13590</td>
			<td></td>
		</tr>
		<tr>
			<td>LSL-tdTomato</td>
			<td>Jackson Labs</td>
			<td>007914</td>
			<td>ai14</td>
		</tr>
		<tr>
			<td>Cre-1</td>
			<td></td>
			<td>n/a</td>
			<td>GCATTACCGGTCGATGCAACGAGTGATGAG</td>
		</tr>
		<tr>
			<td>Cre-2</td>
			<td></td>
			<td>n/a</td>
			<td>GAGTGAACGAACCTGGTCGAAATCAGTGCG</td>
		</tr>
		<tr>
			<td>Braf-V600E-1</td>
			<td></td>
			<td>n/a</td>
			<td>TGAGTATTTTTGTGGCAACTGC</td>
		</tr>
		<tr>
			<td>Braf-V600E-2</td>
			<td></td>
			<td>n/a</td>
			<td>CTCTGCTGGGAAAGCGGC</td>
		</tr>
		<tr>
			<td>Kras-G12D-1</td>
			<td></td>
			<td>n/a</td>
			<td>AGCTAGCCACCATGGCTTGAGTAAGTCTGCA</td>
		</tr>
		<tr>
			<td>Kras-G12D-2</td>
			<td></td>
			<td>n/a</td>
			<td>CCTTTACAAGCGCACGCAGACTGTAGA</td>
		</tr>
		<tr>
			<td>Pten-1</td>
			<td></td>
			<td>n/a</td>
			<td>ACTCAAGGCAGGGATGAGC</td>
		</tr>
		<tr>
			<td>Pten-2</td>
			<td></td>
			<td>n/a</td>
			<td>AATCTAGGGCCTCTTGTGCC</td>
		</tr>
		<tr>
			<td>Pten-3</td>
			<td></td>
			<td>n/a</td>
			<td>GCTTGATATCGAATTCCTGCAGC</td>
		</tr>
		<tr>
			<td>tdTomato-1</td>
			<td></td>
			<td>n/a</td>
			<td>AAGGGAGCTGCAGTGGAGTA</td>
		</tr>
		<tr>
			<td>tdTomato-2</td>
			<td></td>
			<td>n/a</td>
			<td>CCGAAAATCTGTGGGAAGTC</td>
		</tr>
		<tr>
			<td>tdTomato-3</td>
			<td></td>
			<td>n/a</td>
			<td>GGCATTAAAGCAGCGTATCC</td>
		</tr>
		<tr>
			<td>tdTomato-4</td>
			<td></td>
			<td>n/a</td>
			<td>CTGTTCCTGTACGGCATGG</td>
		</tr>
	</tbody>
</table>

spatial and temporal control of murine melanoma initiation from mutant melanocyte stem cells

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented with increasing depth, the incidence rate of cutaneous melanoma has shown a rapid and continuous increase during recent decades. In order to find effective preventative methods, it is important to understand the early steps of melanoma initiation in the skin. Previous data has demonstrated that follicular melanocyte stem cells (MCSCs) in the adult skin tissues can act as melanoma cells of origin when expressing oncogenic mutations and genetic alterations. Tumorigenesis arising from melanoma-prone MCSCs can be induced when MCSCs transition from a quiescent to active state. This transition in melanoma-prone MCSCs can be promoted by the modulation of either hair follicle stem cells&#39; activity state or through extrinsic environmental factors such as ultraviolet-B (UV-B). These factors can be artificially manipulated in the laboratory by chemical depilation, which causes transition of hair follicle stem cells and MCSCs from a quiescent to active state, and by UV-B exposure using a benchtop light. These methods provide successful spatial and temporal control of cutaneous melanoma initiation in the murine dorsal skin. Therefore, these in vivo model systems will be valuable to define the early steps of cutaneous melanoma initiation and could be used to test potential methods for tumor prevention.

Cutaneous melanoma initiation induced by chemical depilation
The procedure of chemical depilation is depicted in Figure 2. When mice are 7-weeks postnatal, their dorsal skin is in telogen. During telogen, hair follicle stem cells and MCSCs&#160;are known to be in a quiescent, resting state. The skin should show no significant hair growth after shaving. On the other hand, chemical de...

Watch this Scientific Journal Video about Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells at JoVE.com

Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

Mutant melanosit kök hücrelerinden Murine Melanoma başlangıcı uzamsal ve temporal kontrol

The following procedure describes a method for spatial and temporal control of melanocytic tumor initiation in murine dorsal skin, using a genetically engineered mouse model. This protocol describes macroscopic as well as microscopic cutaneous melanoma initiation.

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented ...

spatial-temporal-control-murine-melanoma-initiation-from-mutant

Research

JoVE Journal

Cancer Research

8.6K Görüntüleme.  Cornell University. Melanom yaygın olarak dünya çapında teşhis edilir, artan insidansı ile. Bu protokoller melanom inisiyasyonunun erken evrelerinin dikkatle kontrol edilmesine izin vererek gelişiminin incelenmesini kolaylaştırır. Melanosit kök hücre aktivasyonunun zamanını ve yerini kontrol ederek, kök hücre popülasyonu ve yeni suş melanom inisiyasyonundaki değişiklikleri ayırt etme yeteneğine sahibiz.Prosedürü gösteren Dahihm Kim ve Luye An, laboratuvardan yüksek lisans öğren...

Video: Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

A Mouse Model of Fatigue Induced by Peripheral Irradiation

Cancer-related fatigue (CRF) is a distressing and costly condition that often affects patients receiving cancer treatments, including radiation therapy. Here we describe a method using targeted peripheral irradiation to induce fatigue-like behavior in mice. With appropriate shielding, the irradiation targets the lower abdominal/pelvic region of the mouse, sparing the brain, in an effort to model radiation treatment received by individuals with pelvic cancers. We deliver an irradiation dose that is sufficient to induce fatigue-like behavior in mice, measured by voluntary wheel-running activity (VWRA), without causing obvious morbidity. Since wheel running is a normal, voluntary behavior in mice, its use should have little confounding effect on other behavioral tests or biological measures. Hence, wheel running can be used as a feasible outcome measure in understanding the behavioral and biological correlates of fatigue. CRF is a complex condition with frequent comorbidities, and likely has causes related both to cancer and its various treatments. The methods described in this paper are useful for investigating radiation-induced changes that contribute to the development of CRF and, more generally, to explore the biological networks that can explain the development and persistence of a peripherally-triggered but centrally-driven behavior like fatigue.

We describe a method using targeted peripheral irradiation to induce fatigue-like behavior in mice. The selected non-lethal irradiation dose leads to a week-long reduction in voluntary wheel-running activity.

Periferik Radyasyonla Bağlı Yorgunluk A Fare Modeli

Cancer-related fatigue (CRF) is a distressing and costly condition that often affects patients receiving cancer treatments, including radiation therapy. ...

Kanser Araştırmaları

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to generate RNA-guided nucleases, such as CRISPR-associated (Cas) 9 for site-specific eukaryotic genome editing. Genome engineering by Cas9 is used to efficiently, easily and robustly modify endogenous genes in many biomedically-relevant mammalian cell lines and organisms. Here we show an example of how to utilize the CRISPR/Cas9 methodology to understand the biological function of specific genetic mutations. We model calreticulin (CALR) mutations in murine interleukin-3 (mIL-3) dependent pro-B (Ba/F3) cells by delivery of single guide RNAs (sgRNAs) targeting the endogenous Calr locus in the specific region where insertion and/or deletion (indel) CALR mutations occur in patients with myeloproliferative neoplasms (MPN), a type of blood cancer. The sgRNAs create double strand breaks (DSBs) in the targeted region that are repaired by non-homologous end joining (NHEJ) to give indels of various sizes. We then employ the standard Ba/F3 cellular transformation assay to understand the effect of physiological level expression of Calr mutations on hematopoietic cellular transformation. This approach can be applied to other genes to study their biological function in various mammalian cell lines.

Targeted gene editing using CRISPR/Cas9 has greatly facilitated the understanding of the biological functions of genes. Here, we utilize the CRISPR/Cas9 methodology to model calreticulin mutations in cytokine-dependent hematopoietic cells in order to study their oncogenic activity.

CRISPR/Cas9 kullanarak Gene sitokin bağımlı hematopoetik hücreler Mutant Calreticulin Oncogenic etkinliğini araştırmak için düzenleme

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene disruption, many of these studies have made use of complex gene knockout models. While these studies with knockout mice offer an elegant and time-tested system for investigating genotype-to-phenotype relationships, a rapid and scalable method for assessing candidate genes that play a role in AML cell proliferation or survival in AML models will help accelerate the parallel interrogation of multiple candidate genes. Recent advances in genome-editing technologies have dramatically enhanced our ability to perform genetic perturbations at an unprecedented scale. One such system of genome editing is the CRISPR-Cas9-based method that can be used to make rapid and efficacious alterations in the target cell genome. The ease and scalability of CRISPR/Cas9-mediated gene-deletion makes it one of the most attractive techniques for the interrogation of a large number of genes in phenotypic assays. Here, we present a simple assay using CRISPR/Cas9 mediated gene-disruption combined with high-throughput flow-cytometry-based competition assays to investigate the role of genes that may play an important role in the proliferation or survival of human and murine AML cell lines.

This manuscript describes a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR-Cas9-based method for simple and expeditious investigation of the role of multiple candidate genes in Acute Myeloid Leukemia (AML) cell proliferation in parallel. This technique is scalable and can be applied in other cancer cell lines as well.

CRISPR-Cas9-tabanlı rekabet deneyleri kullanarak genetik bağımlılıkları incelenmesi

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

Rapid Generation of Primary Murine Melanocyte and Fibroblast Cultures

Defects in fibroblast or melanocyte function are associated with skin diseases, including poor barrier function, defective wound healing, pigmentation defects and cancer. Vital to the understanding and amelioration of these diseases are experiments in primary fibroblast and melanocyte cultures. Nevertheless, current protocols for melanocyte isolation require that the epidermal and dermal layers of the skin are trypsinized and manually disassociated. This process is time consuming, technically challenging and contributes to inconsistent yields. Furthermore, methods to simultaneously generate pure fibroblast cultures from the same tissue sample are not readily available. Here, we describe an improved protocol for isolating melanocytes and fibroblasts from the skin of mice on postnatal days 0-4. In this protocol, whole skin is mechanically homogenized using a tissue chopper and then briefly digested with collagenase and trypsin. Cell populations are then isolated through selective plating followed by G418 treatment. This procedure results in consistent melanocyte and fibroblast yields from a single mouse in less than 90 min. This protocol is also easily scalable, allowing researchers to process large cohorts of animals without a significant increase in hands-on time. We show through flow cytometric assessments that cultures established using this protocol are highly enriched for melanocytes or fibroblasts.

This protocol outlines a rapid method to simultaneously generate melanocyte and fibroblast cultures from the skin of 0-4 day old mice. These primary cultures can be maintained and manipulated in vitro to study a variety of physiologically relevant processes, including skin cell biology, pigmentation, wound healing and melanoma.

Primer Murine melanosit ve fibroblast kültürlerinin hızlı üretimi

Defects in fibroblast or melanocyte function are associated with skin diseases, including poor barrier function, defective wound healing, pigmentation ...

Flow Cytometric Analysis of Mitochondrial Reactive Oxygen Species in Murine Hematopoietic Stem and Progenitor Cells and MLL-AF9 Driven Leukemia

We present a flow cytometric approach for analyzing mitochondrial ROS in various live bone marrow (BM)-derived stem and progenitor cell populations from healthy mice as well as mice with AML driven by MLL-AF9. Specifically, we describe a two-step cell staining process, whereby healthy or leukemia BM cells are first stained with a fluorogenic dye that detects mitochondrial superoxides, followed by staining with fluorochrome-linked monoclonal antibodies that are used to distinguish various healthy and malignant hematopoietic progenitor populations. We also provide a strategy for acquiring and analyzing the samples by flow cytometry. The entire protocol can be carried out in a timeframe as short as 3-4 h. We also highlight the key variables to consider as well as the advantages and limitations of monitoring ROS production in the mitochondrial compartment of live hematopoietic and leukemia stem and progenitor subpopulations using fluorogenic dyes by flow cytometry. Furthermore, we present data that mitochondrial ROS abundance varies among distinct healthy HSPC sub-populations and leukemia progenitors and discuss the possible applications of this technique in hematologic research.

We describe a method for using multiparameter flow cytometry to detect mitochondrial reactive oxygen species (ROS) in murine healthy hematopoietic stem and progenitor cells (HSPCs) and leukemia cells from a mouse model of acute myeloid leukemia (AML) driven by MLL-AF9.

Murine Hematopoetik Kök ve Progenitor Hücrelerde Mitokondriyal Reaktif Oksijen Türlerinin Akış Sitometrik Analizi ve MLL-AF9 Tahrikli Lösemi

We present a flow cytometric approach for analyzing mitochondrial ROS in various live bone marrow (BM)-derived stem and progenitor cell populations from ...

Isolation of Exosome-Enriched Extracellular Vesicles Carrying Granulocyte-Macrophage Colony-Stimulating Factor from Embryonic Stem Cells

Embryonic stem cells (ESCs) are pluripotent stem cells capable of self-renewal and differentiation into all types of embryonic cells. Like many other cell types, ESCs release small membrane vesicles, such as exosomes, to the extracellular environment. Exosomes serve as essential mediators of intercellular communication and play a basic role in many (patho)physiological processes. Granulocyte-macrophage colony-stimulating factor (GM-CSF) functions as a cytokine to modulate the immune response. The presence of GM-CSF in exosomes has the potential to boost their immune-regulatory function. Here, GM-CSF was stably overexpressed in the murine ESC cell line ES-D3. A protocol was developed to isolate high-quality exosome-enriched extracellular vesicles (EVs) from ES-D3 cells overexpressing GM-CSF. Isolated exosome-enriched EVs were characterized by a variety of experimental approaches. Importantly, significant amounts of GM-CSF were found to be present in exosome-enriched EVs. Overall, GM-CSF-bearing exosome-enriched EVs from ESCs might function as cell-free vesicles to exert their immune-regulatory activities.

This study describes a method to isolate exosome-enriched extracellular vesicles carrying immune-stimulatory granulocyte macrophage colony-stimulating factors from embryonic stem cells.

Embriyonik Kök Hücrelerden Granülosit-Makrofaj Kolonisi Uyarıcı Faktör Taşıyan EkzozomLa Zenginleştirilmiş Hücre Dışı Veziküllerin İzolasyonu

Embryonic stem cells (ESCs) are pluripotent stem cells capable of self-renewal and differentiation into all types of embryonic cells. Like many other cell ...

Isolation of Stem-like Cells from 3-Dimensional Spheroid Cultures

Despite advances in adult stem cell research, identification and isolation of stem cells from tissue specimens remains a major challenge. While resident stem cells are relatively quiescent with niche restraints in adult tissues, they enter the cell cycle in anchor-free three-dimensional (3D) culture and undergo both symmetric and asymmetric cell division, giving rise to both stem and progenitor cells. The latter proliferate rapidly and are the major cell population at various stages of lineage commitment, forming heterogeneous spheroids. Using primary normal human prostate epithelial cells (HPrEC), a spheroid-based, label-retention assay was developed that permits the identification and functional isolation of the spheroid-initiating stem cells at a single cell resolution.
HPrEC or cell lines are two-dimensionally (2D) cultured with BrdU for 10 days to permit its incorporation into the DNA of all dividing cells, including self-renewing stem cells. Wash out commences upon transfer to the 3D culture for 5 days, during which stem cells self-renew through asymmetric division and initiate spheroid formation. While relatively quiescent daughter stem cells retain BrdU-labeled parental DNA, the daughter progenitors rapidly proliferate, losing the BrdU label. BrdU can be substituted with CFSE or Far Red pro-dyes, which permit live stem cell isolation by FACS. Stem cell characteristics are confirmed by in vitro spheroid formation, in vivo tissue regeneration assays, and by documenting their symmetric/asymmetric cell divisions. The isolated label-retaining stem cells can be rigorously interrogated by downstream molecular and biologic studies, including RNA-seq, ChIP-seq, single cell capture, metabolic activity, proteome profiling, immunocytochemistry, organoid formation, and in vivo tissue regeneration. Importantly, this marker-free functional stem cell isolation approach identifies stem-like cells from fresh cancer specimens and cancer cell lines from multiple organs, suggesting wide applicability. It can be used to identify cancer stem-like cell biomarkers, screen pharmaceuticals targeting cancer stem-like cells, and discover novel therapeutic targets in cancers.

Using human primary prostate epithelial cells, we report a novel biomarker-free method of functional characterization of stem-like cells by a spheroid-based label-retention assay. A step-by-step protocol is described for BrdU, CFSE, or Far Red 2D cell labeling; three-dimensional spheroid formation; label-retaining stem-like cell identification by immunocytochemistry; and isolation by FACS.

3 Boyutlu Spheroid Kültürlerden Kök Benzeri Hücrelerin İzolasyon

Despite advances in adult stem cell research, identification and isolation of stem cells from tissue specimens remains a major challenge. While resident ...

Preparation of Mitochondria from Ovarian Cancer Tissues and Control Ovarian Tissues for Quantitative Proteomics Analysis

Ovarian cancer is a common gynecologic cancer with high mortality but unclear molecular mechanism. Most ovarian cancers are diagnosed in the advanced stage, which seriously hampers therapy. Mitochondrial changes are a hallmark of human ovarian cancers, and mitochondria are the centers of energy metabolism, cell signaling, and oxidative stress. In-depth insights into the changes of the mitochondrial proteome in ovarian cancers compared to control ovarian tissue will benefit in-depth understanding of the molecular mechanisms of ovarian cancer, and the discovery of effective and reliable biomarkers and therapeutic targets. An effective mitochondrial preparation method coupled with an isobaric tag for relative and absolute quantification (iTRAQ) quantitative proteomics are presented here to analyze human ovarian cancer and control mitochondrial proteomes, including differential-speed centrifugation, density gradient centrifugation, quality assessment of mitochondrial samples, protein digestion with trypsin, iTRAQ labeling, strong cation exchange fractionation (SCX), liquid chromatography (LC), tandem mass spectrometry (MS/MS), database analysis, and quantitative analysis of mitochondrial proteins. Many proteins have been successfully identified to maximize the coverage of the human ovarian cancer mitochondrial proteome and to achieve the differentially expressed mitochondrial protein profile in human ovarian cancers.

This article presents a protocol of differential-speed centrifugation in combination with density gradient centrifugation to separate mitochondria from human ovarian cancer tissues and control ovarian tissues for quantitative proteomics analysis, resulting in a high-quality mitochondrial sample and high-throughput and high-reproducibility quantitative proteomics analysis of a human ovarian cancer mitochondrial proteome.

Yumurtalık Kanseri Dokularından Mitokondri Hazırlanması ve Kantitatif Proteomik Analizi Için Yumurtalık Dokularının Kontrolü

Ovarian cancer is a common gynecologic cancer with high mortality but unclear molecular mechanism. Most ovarian cancers are diagnosed in the advanced ...

Isolation and Functional Assessment of Human Breast Cancer Stem Cells from Cell and Tissue Samples

Breast cancer stem cells (BCSCs) are cancer cells with inherited or acquired stem cell-like characteristics. Despite their low frequency, they are major contributors to breast cancer initiation, relapse, metastasis and therapy resistance. It is imperative to understand the biology of breast cancer stem cells in order to identify novel therapeutic targets to treat breast cancer. Breast cancer stem cells are isolated and characterized based on expression of unique cell surface markers such as CD44, CD24 and enzymatic activity of aldehyde dehydrogenase (ALDH). These ALDHhighCD44+CD24- cells constitute the BCSC population and can be isolated by fluorescence-activated cell sorting (FACS) for downstream functional studies. Depending on the scientific question, different in vitro and in vivo methods can be used to assess the functional characteristics of BCSCs. Here, we provide a detailed experimental protocol for isolation of human BCSCs from both heterogenous populations of breast cancer cells as well as primary tumor tissue obtained from breast cancer patients. In addition, we highlight downstream in vitro and in vivo functional assays including colony forming assays, mammosphere assays, 3D culture models and tumor xenograft assays that can be used to assess BCSC function.

This experimental protocol describes the isolation of BCSCs from breast cancer cell and tissue samples as well as the in vitro and in vivo assays that can be used to assess BCSC phenotype and function.

İnsan Meme Kanseri Kök Hücrelerinin Hücre ve Doku Örneklerinden İzolasyonu ve Fonksiyonel Değerlendirmesi

Breast cancer stem cells (BCSCs) are cancer cells with inherited or acquired stem cell-like characteristics. Despite their low frequency, they are major ...

Implantation and Evaluation of Melanoma in the Murine Choroid via Optical Coherence Tomography

Establishing experimental choroidal melanoma models is challenging in terms of the ability to induce tumors at the correct localization. In addition, difficulties in observing posterior choroidal melanoma in vivo limit tumor location and growth evaluation in real-time. The approach described here optimizes techniques for establishing choroidal melanoma in mice via a multi-step sub-choroidal B16LS9 cell injection procedure. To enable precision in injecting into the small dimensions of the mouse uvea, the complete procedure is performed under a microscope. First, a conjunctival peritomy is formed in the dorsal-temporal area of the eye. Then, a tract into the sub-choroidal space is created by inserting a needle through the exposed sclera. This is followed by the insertion of a blunt needle into the tract and the injection of melanoma cells into the choroid. Immediately after injection, noninvasive optical coherence tomography (OCT) imaging is utilized to determine tumor location and progress. Retinal detachment is evaluated as a predictor of tumor site and size. The presented method enables the reproducible induction of choroid-localized melanoma in mice and the live imaging of tumor growth evaluation. As such, it provides a valuable tool for studying intraocular tumors.

Implantation and Evaluation of Melanoma in the Murine Choroid via Optical Coherence Tomography

The present protocol describes the implantation and evaluation of melanoma in the murine choroid utilizing optical coherence tomography.

Murin Koroidinde Melanomun İmplantasyonu ve Optik Koherens Tomografi ile Değerlendirilmesi

Establishing experimental choroidal melanoma models is challenging in terms of the ability to induce tumors at the correct localization. In addition, ...