We wish to thank Hitomi Sawada and Elizabeth Garcia for animal care. This work was supported by KAKENHI (15K20134, 17K11222, 16H06276 and 16K01946) and Hokugin Research Grant (to H.N.), and Jichi Medical University Young Investigator Award (to H.U.).&#160;The Otsuka Toshimi Scholarship Foundation supported M.D.

All animal care and procedures performed in this study were undertaken according to the rules and regulations of the Guide for the Care and Use of Laboratory Animals. The experimental protocol was approved by the Animal Care Committee of Laboratory Animals of University of Toyama, University of Tokyo, Jichi University, and Max Planck Florida Institute for Neuroscience. Information about all reagents is showed in the Table of Materials.
1. CRISPR reagents design
<ol>
	<li>crRNA design
	<ol>
		<li>Visit CRISPR direct19 (https://crispr.dbcls.jp/) to design specific crRNAs with reduced off-target sites. 
		NOTE: There are many other useful tools to design the crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).</li>
		<li>Insert the target nucleotide sequence and make the following changes: 
		PAM sequence requirement = NGG 
		Specificity check = Mouse (Mus musculus) genome, GRCm38/mm10 (Dec, 2011) 
		NOTE: As an example, to generate Tyrosinase (Tyr) knockout mice, exon 2 (nucleotide sequence from 9476&#8211;9692) was targeted.</li>
		<li>Click Design, and for highly specific hits, mark Show Highly Specific Target Only.</li>
		<li>To reduce potential off-target effects, choose the target sequence with the lowest value in the columns of &#34;12 mer+PAM&#34; and &#34;8 mer+PAM&#34;. 
		NOTE: In these columns, (&#34;1&#34;) indicates that the sequence has only one perfect match with the intended target site and numbers greater than one indicate the presence of potential off-target sites.</li>
		<li>Order the resulting oligonucleotides from crRNA synthesis companies (Supplimentary Table 1). 
		NOTE: For the exon 2 Tyr gene, the following target sequence was used: GGACCACTATTACGTAATCC, with +TGG as the PAM sequence (Figure 2A).</li>
	</ol>
	</li>
	<li>Single strand oligodeoxynucleotide (ssODN) design for HDR-mediated editing experiments (i.e., knock-in mice generation).
	<ol>
		<li>Design the ssODN length to be around 80&#8211;180 bp including 30&#8211;60 nucleotide (nt) homology arms on both sides. 
		NOTE: An ssODN of 75&#8211;85 nt length, including a 30&#8211;35 nt homology arm and complementary to the gRNA, showed high knock-in editing efficiency21.</li>
		<li>Insert the intended modification and silent mutation at the PAM sequence or, if not possible, at the 5&#8242; neighboring base of PAM to block the recutting after genome editing. 
		NOTE: The crRNA and ssODN used in this study are listed in Supplementary Table 1.</li>
	</ol>
	</li>
</ol>
2. In vitro fertilization, embryo cryopreservation, and freeze-thawing
<ol>
	<li>In vitro fertilization
	<ol>
		<li>Superovulate C57BL/6J female mice (4 or 8-weeks-old) by IP injection with&#160;pregnant mare serum gonadotropin (PMSG) followed by injection with 7.5 IU human chorionic gonadotropin (hCG) after 48 h. 
		NOTE: The number of ovulated oocytes can be increased by about 3x using ultra-superovulation22.</li>
		<li>Remove the cauda epididymides from sexually mature C57BL/6J male mice (3&#8211;5-months-old). 
		NOTE: It is possible to collect spermatozoa without sacrificing the male mice.</li>
		<li>Extract clots of spermatozoa with a dissecting needle and incubate them in a 200 &#181;L drop of human tubal&#160;fluid (HTF) in CO2 incubator for 1.5 h for capacitation.</li>
		<li>Collect cumulus-oocyte complexes (COCs) from the oviducts 16&#8211;18 h after the hCG injection and incubate them in a fresh 200 &#181;L drop of&#160;HTF medium covered with paraffin liquid in a CO2 incubator (5% CO2, 37 &#176;C) for no more than 2 h. 
		NOTE: It is preferable to sacrifice the mice by cervical dislocation under anesthesia because euthanasia via CO2 inhalation affects IVF and embryo development23.</li>
		<li>Add 1&#8211;5 &#181;L of sperm suspension from the boundary of the incubation medium to the 200 &#181;L drop of HTF medium containing COCs and incubate them in a CO2 incubator for 3 h.</li>
		<li>Wash the oocytes with potassium-supplemented simplex optimization medium (KSOM) 3x to remove remaining sperm and cumulus cells.</li>
		<li>Check the pronuclear formation and the grade of one-cell embryos using an inverted microscope.</li>
	</ol>
	</li>
	<li>Cryopreservation of one-cell embryos
	<ol>
		<li>Incubate one-cell embryos in a 200 &#181;L drop of HTF containing 20% FBS (not covered with paraffin liquid) for 10 min in a CO2 incubator.</li>
		<li>Transfer 20&#8211;100 embryos to 50 &#181;L of 1 M dimethyl sulfoxide (DMSO) solution24.</li>
		<li>Transfer 5 &#181;L of a solution containing 100 embryos into the bottom of a cryotube and cool for 5 min at 0 &#176;C using a chiller or on ice.</li>
		<li>Add 45 &#181;L of DAP213 (2 M dimethyl sulfoxide, 1 M acetamide, and 3 M propylene glycol) solution slowly along the tube wall, cap the tubes, and keep for 5 min in a chiller or on ice at 0 &#176;C. 
		NOTE: Do not fasten the caps too tightly to remove them easily during sample thawing.</li>
		<li>Store tubes rapidly in liquid nitrogen.</li>
	</ol>
	</li>
	<li>Embryo thawing
	<ol>
		<li>Open the lid of the cryotube, discard the remaining liquid nitrogen, and add 900 &#181;L of 0.25 M sucrose solution preheated to 37 &#176;C. 
		NOTE: The 0.25 M sucrose solution must be warmed to 37 &#176;C in advance because the use of cold solution decreases embryo viability after thawing.</li>
		<li>Pipet quickly for 10x and transfer the contents of the cryotube into a plastic dish. 
		NOTE: The pipetting should be performed carefully, so that no bubbles are generated and damage the embryos.</li>
		<li>Wash the morphologically normal fertilized oocytes 2x in KSOM medium covered with paraffin liquid and keep them in a CO2 incubator until electroporation.</li>
	</ol>
	</li>
</ol>
3. Assembly and electroporation of CRISPR reagents
NOTE: For electroporation, we used a platinum plate electrode (height: 0.5 mm, length: 10 mm, width: 3 mm, gap: 1 mm) and a one-step type electroporator that were described previously8 (Table of Materials). A two-step type electroporator can be used too (Table of Materials).
<ol>
	<li>Preparation and assembly of CRISPR reagents
	<ol>
		<li>Order CRISPR reagents (i.e., crRNA, tracrRNA, and Cas9 protein) and ssODN if performing HDR-mediated editing experiments (Table of Materials and Supplementary Table 1).</li>
		<li>Prepare the annealing solution as follows.
		<ol>
			<li>Prepare 1 &#956;g/&#181;L crRNA and 1 &#956;g/&#181;L tracrRNA in Reduced-Serum Minimal Essential Medium solution (Table of Materials), and add 6 &#181;L of each solution to 42 &#181;L of the nuclease-free buffer.</li>
			<li>Incubate the mixture in the dry heater at 95 &#176;C for 3 min and cool at RT for 5 min.</li>
			<li>Prepare 1 &#956;g/&#181;L HiFi Cas9 protein diluted in Opti-MEM I and add 6 &#181;L to the previous mixture for a total volume of 60 &#181;L.</li>
			<li>In performing HDR-mediated editing experiments, add 6 &#181;L of 1 &#956;g/&#181;L ssODN. Because the final volume should be 60 &#181;L, use 36 &#181;L of nuclease-free water in step 3.1.2.1. 
			NOTE: The final concentration of crRNA, tracrRNA, Cas9 protein, and ssODN will be 100 ng/&#181;L.</li>
			<li>Transfer up to 100 embryos to 25 &#181;L of the final mixture (RNP complex) in a one hole slide glass and incubate them at 37 &#176;C for 10 min.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Electroporation
	<ol>
		<li>Fill the electrode gap with 6 &#181;L of the new mixture of CRISPR reagents and add 20&#8211;25 embryos to the mixture. 
		NOTE: It is important to avoid any contact between the embryos and the electroporation electrode, which can damage embryos during electrical pulses.</li>
		<li>Perform the electroporation at the following conditions for an one-step type electroporator: 
		Voltage: 25 V, Pulse direction (Pd) + 
		ON: 3 ms, OFF: 97 ms 
		Repeats: 5x 
		NOTE: Electroporation should be performed no more than 1 h after thawing to ensure genome editing occurs before the first DNA replication to prevent mosaicism.</li>
		<li>For a two-step type electroporator, set the conditions as follows: 
		Poring Pulse = 40V, Pd + 
		ON = 1 or 2.5 ms; Pulse interval = 50 ms 
		Repeats: 4x, Decay 10% 
		 
		Transfer Pulse = 5 or 7V; Pd +/-. 
		ON: 50 ms; Pulse interval = 50 ms. 
		Repeats = 5x; Decay = 40%. 
		NOTE: It is important to adjust the volume in order to maintain impedance within the specific range specified by the manufacturer.</li>
		<li>Wash the embryos 3x with modified Krebs-Ringer Bicarbonate Buffer 2 (M2) medium followed by two washes with a drop of KSOM medium covered with paraffin liquid.</li>
		<li>Incubate the washed embryos (in KSOM medium) in a CO2 incubator overnight for further transplantation.</li>
	</ol>
	</li>
</ol>
4. Embryo transfer
<ol>
	<li>Prepare pseudopregnant female mice. Mate ICR female mice (3&#8211;6 months) with vasectomized male mice 1 day before the embryo transfer (ET). 
	NOTE: Mice should be checked the next morning for a copulatory plug. The mice with a plug are considered pseudopregnant and can be used for ET.</li>
	<li>Aspirate air and KSOM (without paraffin liquid) in alternate intervals of 2&#8211;3 mm into a glass capillary as a marker for successful implantation.</li>
	<li>Introduce 20&#8211;24 embryos into a 200 &#956;L drop of KSOM (without paraffin liquid) and draw 10&#8211;12 embryos into the glass capillary for implantation in each oviduct.</li>
	<li>Anesthetize the female mice by isoflurane (inhalation) or an IP injection of a solution combining medetomidine/midazolam/butorphanol (0.3 mg/kg, 4.0 mg/kg, and 5.0 mg/kg respectively). Position the anesthetized mouse on its ventral side on a heating pad. Protect the eyes of the anesthetized mouse with a moisturizing gel.</li>
	<li>Shave along the lower part of the dorsal midline and disinfect the area with povidone iodine followed by with 70% ethanol.</li>
	<li>Make a long ~1 cm incision parallel to the dorsal midline.</li>
	<li>Take out the oviduct and place on a sterile plastic drape. Keep it moist using warm sterile saline.</li>
	<li>Place the oviduct under the stereoscopic microscope.</li>
	<li>Make a hole into the wall of the oviduct between the infundibulum and ampulla a few millimeters upstream of the ampulla by microspring scissors.</li>
	<li>Insert the tip of the glass capillary containing the embryos into the hole and blow gently into the mouthpiece of the capillary holder to expel the embryos until an air bubble is visible in the ampulla. 
	NOTE: Transfer between 10&#8211;12 embryos per oviduct.</li>
	<li>Withdraw the glass capillary from the oviduct wall and push the reproductive organ gently back into the body cavity.</li>
	<li>Repeat the previous process to introduce the embryos into the other oviduct.</li>
	<li>Upon completing the ET procedure, suture the peritoneum with a simple interrupted suture pattern (5&#173;0, absorbable, braided synthetic sutures) and then the skin with a simple interrupted pattern or a buried subcuticular interrupted stitch pattern (6&#173;0 non&#173;absorbable, monosynthetic sutures).</li>
	<li>Keep the mouse warm on a 37 &#176;C warming plate until it recovers from anesthesia.</li>
	<li>Monitor the health of the animal daily for 7 days after surgery.</li>
</ol>
5. Genotyping and sequence analysis
<ol>
	<li>Genomic DNA extraction 
	NOTE: We used NucleoSpin tissue DNA extraction kits to extract the genomic DNA from mice ear tissue following the manufacturer&#8217;s recommendations.
	<ol>
		<li>Add 180 &#181;L of Buffer T1 and 25 &#181;L of Proteinase K solution to the sample and mix by vortexing for 10 s.</li>
		<li>Incubate at 56 &#176;C for 2 h or until complete lysis is obtained. Vortex for 10 s every 30 min of the incubation.</li>
		<li>Add 200 &#181;L of Buffer B3, vortex vigorously for 30 s, and incubate at 70 &#176;C for 10 min.</li>
		<li>Add 210 &#181;L of 100% ethanol to the sample and vortex vigorously.</li>
		<li>For each sample, place one tissue column into a collection tube and apply the sample to the column.</li>
		<li>Centrifuge for 1 min at 11,000 x g, discard the flowthrough, and place the column back into the collection tube.</li>
		<li>Add 500 &#181;L of Buffer BW to wash the sample (1st wash), centrifuge for 1 min at 11,000 x g, discard the flowthrough and place the column back into the collection tube.</li>
		<li>Add 600 &#181;L of Buffer B5 to the column (2nd wash), centrifuge for 1 min at 11,000 x g, discard the flowthrough, and place the column back into the collection tube.</li>
		<li>Centrifuge the column for 1 min at 11,000 x g to dry the silica membrane and place the NucleoSpin tissue column into a 1.5 mL microcentrifuge tube.</li>
		<li>Add 100 &#181;L of Buffer BE, incubate at room temperature for 1 min, then centrifuge 1 min at 11,000 x g.</li>
	</ol>
	</li>
	<li>PCR amplification and purification
	<ol>
		<li>Design the primers using the primer3 plus website (https://primer3plus.com/) in order to amplify a 400&#8211;500 bp sequence surrounding the targeted locus.</li>
		<li>Design a new PCR protocol and test it empirically.</li>
		<li>Purify the PCR product to remove the unwanted enzymes, nucleotides, primers, and buffer components. A standard purification method can be used as follows.
		<ol>
			<li>Add 50 &#181;L of phenol to 50 &#181;L of the PCR products and mix by vortexing.</li>
			<li>Centrifuge for 1 min at 11,000 x g and transfer the upper transparent layer to a new tube.</li>
			<li>Add 120 &#181;L of 99.5% ethanol and 20 &#181;L of 5 M ammonium acetate and vortex for 30 s.</li>
			<li>Keep at RT for 10 min and centrifuge at 11,000 x g for 10 min.</li>
			<li>Discard the supernatant and wash the DNA pellet with 1 mL of 70% ethanol.</li>
			<li>Dry the pellet at RT for 10 min and dissolve in 10 &#181;L of RNase free water. 
			NOTE: PCR column-based purification kits are recommented because phenol is toxic to humans.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Sanger sequencing
	<ol>
		<li>Run DNA quantification analysis (see Table of Materials) to quantify the purified PCR amplicon.</li>
		<li>Send PCR product(s) and sequencing primer(s) to a sequencing service provider.</li>
		<li>Analyze the sequence using the available online websites. 
		NOTE: In this study, CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) was used for sequence analysis.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/cas-mediated+genome+engineering.">One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering.</a> Cell. 153 (4), 910-918 (2013).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA+-+guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-822 (2012).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/VCas+systems.">Multiplex genome engineering using CRISPR/VCas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), 1258096 (2014).</li><li>Mashiko, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+mutant+mice+by+pronuclear+injection+of+circular+plasmid+expressing+Cas9+and+single+guided+RNA.">Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA.</a> Scientific Reports. 3, 3355 (2013).</li><li>Yen, S. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mosaicism+and+allele+complexity+induced+by+CRISPR/Cas9+RNA+injections+in+mouse+zygotes.">Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes.</a> Developmental Biology. 393 (1), 3-9 (2014).</li><li>Kaneko, T., Mashimo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+genome+editing+of+rodent+intact+embryos+by+electroporation.">Simple genome editing of rodent intact embryos by electroporation.</a> PLoS ONE. 10 (11), 1-7 (2015).</li><li>Qin, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+CRISPR/cas9-mediated+genome+editing+in+mice+by+zygote+electroporation+of+nuclease.">Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease.</a> Genetics. 200 (2), 423-430 (2015).</li><li>Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+knockout+by+electroporation+of+engineered+endonucleases+into+intact+rat+embryos.">Simple knockout by electroporation of engineered endonucleases into intact rat embryos.</a> Scientific Reports. 4, 6382 (2014).</li><li>Hashimoto, M., Takemoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+enables+the+efficient+mRNA+delivery+into+the+mouse+zygotes+and+facilitates+CRISPR/Cas9-based+genome+editing.">Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing.</a> Scientific Reports. 5, 11315 (2015).</li><li>Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+mouse+genome+editing+by+CRISPR+ribonucleoprotein+electroporation+of+zygotes.">Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes.</a> Journal of Biological Chemistry. 291 (28), 14457-14467 (2016).</li><li>Modzelewski, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+mouse+genome+engineering+by+CRISPR-EZ+technology.">Efficient mouse genome engineering by CRISPR-EZ technology.</a> Nature Protocols. 13 (6), 1253-1274 (2018).</li><li>Teixeira, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+mice+zygotes+with+dual+guide+RNA/Cas9+complexes+for+simple+and+efficient+cloning-free+genome+editing.">Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing.</a> Scientific Reports. 8, 474 (2018).</li><li>Nakagawa, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+knockout+mice+by+DNA+microinjection+of+various+CRISPR/Cas9+vectors+into+freeze-thawed+fertilized+oocytes.">Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes.</a> BMC Biotechnology. 15 (1), 1-10 (2015).</li><li>Darwish, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+high-efficient+generation+of+mutant+mice+using+freeze-thawed+embryos+of+the+C57BL/6J+strain.">Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain.</a> Journal of Neuroscience Methods. 317, 149-156 (2019).</li><li>Hashimoto, M., Yamashita, Y., Takemoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+Cas9+protein/sgRNA+into+early+pronuclear+zygotes+generates+non-mosaic+mutants+in+the+mouse.">Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse.</a> Developmental Biology. 418 (1), 1-9 (2016).</li><li>Sakamoto, W., Kaneko, T., Nakagata, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+frozen-thawed+oocytes+for+efficient+production+of+normal+offspring+from+cryopreserved+mouse+spermatozoa+showing+low+fertility.">Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility.</a> Comparative Medicine. 55 (2), 136-139 (2005).</li><li>Naito, Y., Hino, K., Bono, H., Ui-Tei, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRdirect:+Software+for+designing+CRISPR/Cas+guide+RNA+with+reduced+off-target+sites.">CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites.</a> Bioinformatics. 31 (7), 1120-1123 (2015).</li><li>Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=WeReview:+CRISPR+Tools-Live+Repository+of+Computational+Tools+for+Assisting+CRISPR/Cas+Experiments.">WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments.</a> Bioengineering. 6 (3), 63 (2019).</li><li>Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+genome+editing+for+single-base+substitutions+using+optimized+ssODNs+with+Cas9-RNPs.">Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs.</a> Scientific Reports. 9, 4811 (2019).</li><li>Takeo, T., Nakagata, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+using+the+combined+administration+of+inhibin+antiserum+and+equine+chorionic+gonadotropin+increases+the+number+of+ovulated+oocytes+in+C57BL/6+female+mice.">Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice.</a> PLoS ONE. 10 (5), 1-11 (2015).</li><li>Wuri, L., Agca, C., Agca, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Euthanasia+via+CO2+inhalation+causes+premature+cortical+granule+exocytosis+in+mouse+oocytes+and+influences+in+vitro+fertilization+and+embryo+development.">Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development.</a> Molecular Reproduction and Development. 86 (7), 825-834 (2019).</li><li>Nakagata, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+survival+rate+of+unfertilized+mouse+oocytes+after+vitrification.">High survival rate of unfertilized mouse oocytes after vitrification.</a> Journal of Reproduction and Fertility. 87 (2), 479-483 (1989).</li><li>Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISP-ID:+Decoding+CRISPR+mediated+indels+by+Sanger+sequencing.">CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing.</a> Scientific Reports. 6, 28973 (2016).</li><li>Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation-mediated+genome+editing+in+vitrified/warmed+mouse+zygotes+created+by+ivf+via+ultra-superovulation.">Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation.</a> Experimental Animals. 67 (4), 535-543 (2018).</li><li>Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+albino+Xenopus+tropicalis+using+zinc-finger+nucleases.">Generation of albino Xenopus tropicalis using zinc-finger nucleases.</a> Development Growth and Differentiation. 54 (9), 777-784 (2012).</li><li>Hur, J. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+mutagenesis+in+mice+by+electroporation+of+Cpf1+ribonucleoproteins.">Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins.</a> Nature Biotechnology. 34, 807-808 (2016).</li><li>Dumeau, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introducing+gene+deletions+by+mouse+zygote+electroporation+of+Cas12a/Cpf1.">Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1.</a> Transgenic Research. 28 (5-6), 525-535 (2019).</li><li>Chen, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-READI:+Efficient+Generation+of+Knockin+Mice+by+CRISPR+RNP+Electroporation+and+AAV+Donor+Infection.">CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection.</a> Cell Reports. 27 (13), 3780-3789 (2019).</li><li>Mizuno, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intra-embryo+Gene+Cassette+Knockin+by+CRISPR/Cas9-Mediated+Genome+Editing+with+Adeno-Associated+Viral+Vector.">Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector.</a> iScience. 9, 286-297 (2018).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Efficient+RNA-guide+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Research. 24 (6), 1012-1019 (2014).</li><li>Vakulskas, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-fidelity+Cas9+mutant+delivered+as+a+ribonucleoprotein+complex+enables+efficient+gene+editing+in+human+hematopoietic+stem+and+progenitor+cells.">A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells.</a> Nature Medicine. 24 (8), 1216-1224 (2018).</li><li>Rodriguez-Rodriguez, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+Roles+of+RZZ+and+Bub1-KNL1+in+Mitotic+Checkpoint+Signaling+and+Kinetochore+Expansion.">Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion.</a> Current Biology. 28 (21), 3422-3429 (2018).</li><li>Smits, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+Plasticity+Rescues+Target+Activity+in+CRISPR+Knockouts.">Biological Plasticity Rescues Target Activity in CRISPR Knockouts.</a> Nature Methods. 16, 1087-1093 (2019).</li></ol>

The authors have no relevant financial disclosures.

The described protocol allows for the generation of GM mice with high efficiency and low mosaic rates (Table 1). It enables researchers without advanced embryo manipulation skills to create mutant mice easily because it takes advantage of the latest and most useful advances in both reproductive engineering and genome editing technologies: CRISPR/Cas9 ribonucleoprotein (RNP) and electroporation into freeze-thawed embryos. These advances facilitated and expedited the generation of the GM mice. As described...

The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system is a scientific breakthrough that provides unprecedented targeted modification in the genome1. The CRISPR/Cas9 system is comprised of Cas9 protein and guide RNA (gRNA) with two molecular components: a target-specific CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA)2 . A gRNA directs the Cas9 protein to the specific locus in the genome, 20 nucleotides complementary to crRNA, and adjacent to the protospacer adjacent motif (PAM). The Cas9 protein binds to the target sequence and induces double-strand breaks (DSBs) that are repaired by either error-prone nonhomologous end joining (NHEJ) or high fidelity homology-directed repair (HDR)3,4,5. The NHEJ leads to insertions or/and deletions (indels), and hence to gene loss of function when a coding sequence is targeted. The HDR leads to precise genome editing in the presence of a repair template containing homology sequences3,4,5. The NHEJ and HDR have been harnessed to generate knockout and knock-in mice, respectively.
While the CRISPR/Cas9 system has markedly accelerated the generation of GM mice with outstanding efficacy and fidelity, scientists who apply these methods often encounter technical challenges. First, conventional protocols require microinjection for introducing the CRISPR editing tools into the pronucleus of fertilized eggs6,7. This technique is time-consuming and usually requires extensive training. Thus, several groups replaced microinjection with electroporation8,9,10,11,12,13. However, in the early electroporation protocols fresh embryos were used for electroporation. This caused another problem, because preparing fresh embryos before each experiment is difficult14.
Recently we and others have combined the use of freeze-thawed embryos and electroporation for genome editing, which facilitates the generation of GM mice15,16. This protocol enables researchers without advanced embryo manipulation skills to rapidly generate animal models of human diseases with high efficiency. The protocol also significantly reduces practical challenges in generating GM mice, such as genetic heterogeneity in the founders16. To overcome mosaicism, we perform the electroporation of CRISPR reagents within 1 h after embryo thawing to ensure that editing occurs before the first replication of the genome. Another improvement includes the use of Cas9 protein instead of Cas9 mRNA to reduce undesirable mosaicism17. Furthermore, we developed an optimal method for one-cell embryo cryopreservation that increases the developmental rate to the two-cell stage16: use of fetal bovine serum (FBS) dramatically improves the survival of freeze-thawed oocytes after fertilization, perhaps by the same mechanism that makes freeze-thawed unfertilized oocytes more resilient18.
Here we present a comprehensive protocol for the generation of GM mice using freeze-thawed embryos, including the modified method for cryopreservation of one-cell C57BL/6J embryos. It includes 1) gRNA design, CRISPR reagent preparation and assembly; 2) IVF, cryopreservation, and thawing of one-cell embryos; 3) Electroporation of CRISPR reagents into freeze-thawed embryos; 4) Embryo transfer into the oviduct of pseudopregnant female mice; and 5) Genotyping and sequence analysis of the F0 founder animals.

<table><tbody><tr><td>0.25 M Sucrose</td><td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td><td>SUCROSE</td><td></td></tr><tr><td>1 M DMSO</td><td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td><td>1M DMSO</td><td></td></tr><tr><td>Butorphanol</td><td>Meiji Seika Pharma Co., Ltd. (Tokyo, Japan)</td><td>Vetorphale 5mg</td><td></td></tr><tr><td>Cas9 protein: Alt-R&amp;reg; S.p. HiFi Cas9 Nuclease 3NLS</td><td>Integrated DNA Technologies, Inc. (Coralville, IA)</td><td>1081060</td><td></td></tr><tr><td>C57BL/6J mice</td><td>Japan SLC (Hamamatsu, Japan)</td><td>N/A</td><td></td></tr><tr><td>DAP213</td><td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td><td>DAP213</td><td></td></tr><tr><td>FBS</td><td>Sigma-Aldrich, Inc. (St. Louis, MO)</td><td>ES-009-C</td><td></td></tr><tr><td>hCG</td><td>MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan)</td><td>HCG Mochida 3000</td><td></td></tr><tr><td>HTF</td><td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td><td>HTF</td><td></td></tr><tr><td>ICR mice</td><td>Japan SLC (Hamamatsu, Japan)</td><td>N/A</td><td></td></tr><tr><td>Isoflurane</td><td>Petterson Vet Supply, Inc. (Greeley, CO)</td><td>07-893-1389</td><td></td></tr><tr><td>KSOM</td><td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td><td>KSOM</td><td></td></tr><tr><td>LN2 Tank</td><td>Chart Industries (Ball Ground, GA)</td><td>XC 34/18</td><td></td></tr><tr><td>M2</td><td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td><td>M2</td><td></td></tr><tr><td>Medetomidine</td><td>Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan)</td><td>1124401A1060</td><td></td></tr><tr><td>Microscope</td><td>Nikon Co. (Tokyo, Japan)</td><td>SMZ745T</td><td></td></tr><tr><td>Midazolam</td><td>Sandoz K.K. (Tokyo, Japan)</td><td>1124401A1060</td><td></td></tr><tr><td>Nuclease free buffer</td><td>Integrated DNA Technologies, Inc. (Coralville, IA)</td><td>1072570</td><td></td></tr><tr><td>Nucleospin DNA extraction kit</td><td>Takara Bio Inc (Kusatsu, Japan)</td><td>740952 .5</td><td></td></tr><tr><td>One-hole slide glass</td><td>Matsunami Glass Ind., Ltd. (Kishiwada, Japan)</td><td>S339929</td><td></td></tr><tr><td>One-step type Electroporator</td><td>BEX Co., Ltd. (Tokyo, Japan)</td><td>CUY21EDIT II</td><td></td></tr><tr><td>Paraffin Liquid</td><td>NACALAI TESQUE Inc. (Kyoto, Japan)</td><td>SP 26137-85</td><td></td></tr><tr><td>Platinum plate electrode</td><td>BEX Co., Ltd. (Tokyo, Japan)</td><td>LF501PT1-10, GE-101</td><td></td></tr><tr><td>PMSG</td><td>ASKA Animal Health Co., Ltd (Tokyo, Japan)</td><td>SEROTROPIN 1000</td><td></td></tr><tr><td>Povidone iodide</td><td>Professional Disposables International, Inc. (Orangeburg, NY)</td><td>C12400</td><td></td></tr><tr><td>Reduced-Serum Minimal Essential Medium: OptiMEM I</td><td>Sigma-Aldrich, Inc. (St. Louis, MO)</td><td>22600134</td><td></td></tr><tr><td>Two-step type Electroporator</td><td>Nepa Gene Co., Ltd. (Ichikawa, Japan)</td><td>NEPA21</td><td></td></tr></tbody></table>

use of freeze-thawed embryos for high-efficiency production of genetically modified mice

The use of genetically modified (GM) mice has become crucial for understanding gene function and deciphering the underlying mechanisms of human diseases. The CRISPR/Cas9 system allows researchers to modify the genome with unprecedented efficiency, fidelity, and simplicity. Harnessing this technology, researchers are seeking a rapid, efficient, and easy protocol for generating GM mice. Here we introduce an improved method for cryopreservation of one-cell embryos that leads to a higher developmental rate of the freeze-thawed embryos. By combining it with optimized electroporation conditions, this protocol allows for the generation of knockout and knock-in mice with high efficiency and low mosaic rates within a short time. Furthermore, we show a step-by-step explanation of our optimized protocol, covering CRISPR reagent preparation, in vitro fertilization, cryopreservation and thawing of one-cell embryos, electroporation of CRISPR reagents, mouse generation, and genotyping of the founders. Using this protocol, researchers should be able to prepare GM mice with unparalleled ease, speed, and efficiency.

Our modified method for cryopreservation of one-cell embryos, including incubation in HTF containing 20% FBS for 10 min followed by cryopreservation in 1 M DMSO and DAP213 solution, improved the developmental rate of the freeze-thawed embryos into the two-cell stage (Figure 1, p = 0.009, Student&#8217;s t-test).The freeze-thawed embryos were used for the production of GM mice and electroporation conditions were optimized: five repeats of 25 V with 3 ms pulses and 97 ms intervals using an ele...

Watch this Scientific Journal Video about Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice at JoVE.com

Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice

Here, we present a modified method for cryopreservation of one-cell embryos as well as a protocol that couples the use of freeze-thawed embryos and electroporation for the efficient generation of genetically modified mice.

The use of genetically modified (GM) mice has become crucial for understanding gene function and deciphering the underlying mechanisms of human diseases. ...

use-freeze-thawed-embryos-for-high-efficiency-production-genetically

Research

JoVE Journal

Genetics

9.6K Views.  Max Planck Florida Institute for Neuroscience. Ons protocol vergemakkelijkt de bereiding van genetisch gemodificeerde muizen gemakkelijk, efficiënt en snel uit eencellige muisembryo's. Ons protocol combineert het gebruik van bevroren eencellige embryo's en elektroporatie waardoor de snelle generatie van genetisch gemodificeerde muizen, waaronder de gemuteerde muizen met een hoge efficiëntie en lage mozaïeksnelheden. Voor in vitro fertilisatie, beginnen met super ovuleren vier of acht weken oude vrouwelijke C57BL/6J muizen via intraperi...

Video: Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice

Lentiviral Mediated Production of Transgenic Mice: A Simple and Highly Efficient Method for Direct Study of Founders

For almost 40 years, pronuclear DNA injection represents the standard method to generate transgenic mice with random integration of transgenes. Such a routine procedure is widely utilized throughout the world and its main limitation resides in the poor efficacy of transgene integration, resulting in a low yield of founder animals. Only few percent of animals born after implantation of injected fertilized oocytes have integrated the transgene. In contrast, lentiviral vectors are powerful tools for integrative gene transfer and their use to transduce fertilized oocytes allows highly efficient production of founder transgenic mice with an average yield above 70%. Furthermore, any mouse strain can be used to produce transgenic animal and the penetrance of transgene expression is extremely high, above 80% with lentiviral mediated transgenesis compared to DNA microinjection. The size of the DNA fragment that can be cargo by the lentiviral vector is restricted to 10 kb and represents the major limitation of this method. Using a simple and easy to perform injection procedure beneath the zona pellucida of fertilized oocytes, more than 50 founder animals can be produced in a single session of microinjection. Such a method is highly adapted to perform, directly in founder animals, rapid gain and loss of function studies or to screen genomic DNA regions for their ability to control and regulate gene expression in vivo.

Here, we present a protocol to promote transgene integration and production of founder transgenic mice with high efficacy by a simple injection of a lentiviral vector in the perivitelline space of a fertilized oocyte.

For almost 40 years, pronuclear DNA injection represents the standard method to generate transgenic mice with random integration of transgenes. Such a ...

Generation of Genetically Modified Mice through the Microinjection of Oocytes

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear injection of DNA expression constructs into fertilized oocytes remains the most commonly used technique to generate transgenic mice for overexpression. With the introduction of CRISPR technology for gene targeting, pronuclear injection into fertilized oocytes has been extended to the generation of both knockout and knockin mice. This work describes the preparation of DNA for injection and the generation of CRISPR guides for gene targeting, with a particular emphasis on quality control. The genotyping procedures required for the identification of potential founders are critical. Innovative genotyping strategies that take advantage of the "multiplexing" capabilities of CRISPR are presented herein. Surgical procedures are also outlined. Together, the steps of the protocol will allow for the generation of genetically modified mice and for the subsequent establishment of mouse colonies for a plethora of research fields, including immunology, neuroscience, cancer, physiology, development, and others.

The microinjection of mouse oocytes is commonly used for both classic transgenesis (i.e., the random integration of transgenes) and CRISPR-mediated gene targeting. This protocol reviews the latest developments in microinjection, with a particular emphasis on quality control and genotyping strategies.

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear ...

Developmental Biology

Zygote Microinjection for Creating Gene Cassette Knock-in and Flox Alleles in Mice

CRISPR-Cas technology has enabled the rapid and effortless generation of genetically modified mice. Specifically, mice and point mutant mice are readily produced by electroporation of CRISPR factors (and single-stranded oligo DNA donors) into the zygote. In contrast, gene cassette (&#62;1 kb) knock-in and floxed mice are mainly generated by microinjection of CRISPR factors and double-stranded DNA donors into zygotes. Genome editing technologies have also increased the flexibility of genetically modified mice production. It is now possible to introduce the intended mutations in the target genomic regions in a number of beneficial inbred mouse strains. Our team has produced over 200 gene cassette knock-in mouse lines, and over 110 floxed mouse lines by zygote microinjection of CRISPR-Cas9 following requests from several countries, including Japan. Some of these genome editing used BALB/c, C3H/HeJ, and C57BL/6N inbred strains, however most used C57BL/6J. Unlike the electroporation method, genome editing by zygote microinjection in various inbred strains of mice is not that easy. However, gene cassette knock-in and floxed mice on single inbred genetic backgrounds are as critical as genetic humanized, fluorescent reporter, and conditional knockout mouse models. Therefore, this article presents the protocol for the zygote microinjection of CRISPR factors and double-stranded DNA donors in C57BL/6J mice for generating gene cassette knock-in and floxed mice. This article exclusively focuses on nuclear injection rather than cytoplasmic injection. In addition to zygote microinjection, we outline the timeline for the production process and peripheral techniques such as induction of superovulation and embryo transfer.

The present protocol describes zygote microinjection of CRISPR-Cas9 and donor DNA to efficiently produce gene cassette knock-in and floxed mice.

CRISPR-Cas technology has enabled the rapid and effortless generation of genetically modified mice. Specifically, mice and point mutant mice are readily ...

CRISPR/Cas9-Mediated Highly Efficient Gene Targeting in Embryonic Stem Cells for Developing Gene-Manipulated Mouse Models

The CRISPR/Cas9 system has made it possible to develop genetically modified mice by direct genome editing using fertilized zygotes. However, although the efficiency in developing gene-knockout mice by inducing small indel mutation would be sufficient enough, the efficiency of embryo genome editing for making large-size DNA knock-in (KI) is still low. Therefore, in contrast to the direct KI method in embryos, gene targeting using embryonic stem cells (ESCs) followed by embryo injection to develop chimera mice still has several advantages (e.g., high throughput targeting in vitro, multi-allele manipulation, and Cre and flox gene manipulation can be carried out in a short period). In addition, strains with difficult-to-handle embryos in vitro, such as BALB/c, can also be used for ESC targeting. This protocol describes the optimized method for large-size DNA (several kb) KI in ESCs by applying CRISPR/Cas9-mediated genome editing followed by chimera mice production to develop gene-manipulated mouse models.

Here we present a protocol for developing genetically modified mouse models using embryonic stem cells, especially for large DNA knock-in (KI). This protocol is tuned up using CRISPR/Cas9 genome editing, resulting in significantly improved KI efficiency compared with the conventional homologous recombination-mediated linearized DNA targeting method.

The CRISPR/Cas9 system has made it possible to develop genetically modified mice by direct genome editing using fertilized zygotes. However, although the ...

Efficient Genome Editing of Mice by CRISPR Electroporation of Zygotes

With exceptional efficiency, accuracy, and ease, the CRISPR/Cas9 system has significantly improved genome editing in cell culture and lab animal experiments. When generating animal models, the electroporation of zygotes offers higher efficiency, simplicity, cost, and throughput as an alternative to the gold standard method of microinjection. Electroporation is also gentler, with higher viability, and reliably delivers Cas9/single-guide RNA (sgRNA) ribonucleoproteins (RNPs) into the zygotes of common laboratory mouse strains (e.g., C57BL/6J and C57BL/6N) that approaches 100% delivery efficiency. This technique enables insertion/deletion (indels) mutations, point mutations, the deletion of whole genes or exons, and small insertions in the range of 100-200 bp to insert LoxP or short tags like FLAG, HA, or V5. While constantly being improved, here we present the current state of CRISPR-EZ in a protocol that includes sgRNA production through in vitro transcription, embryo processing, RNP assembly, electroporation, and the genotyping of preimplantation embryos. A graduate-level researcher with minimal experience manipulating embryos can obtain genetically edited embryos in less than 1 week using this protocol. Here, we offer a straightforward, low-cost, efficient, high-capacity method that could be used with mouse embryos.

Here, we describe a simple technique intended for the efficient generation of genetically modified mice called CRISPR RNP Electroporation of Zygotes (CRISPR-EZ). This method delivers editing reagents by electroporation into embryos at an efficiency approaching 100%. This protocol is effective for point mutations, small genomic insertions, and deletions in mammalian embryos.

With exceptional efficiency, accuracy, and ease, the CRISPR/Cas9 system has significantly improved genome editing in cell culture and lab animal ...

Murine Round Spermatid Injection Procedure to Study Embryonic Development

Mouse Round Spermatid Injection

Round spermatids, characterized by their haploid genetic content, represent the precursor cells to mature spermatozoa. Through the innovative technique of round spermatid injection (ROSI), oocytes can be successfully fertilized and developed into viable fetuses. In a groundbreaking milestone achieved in 1995, the first mouse fetus was born through ROSI technology. ROSI has since emerged as a pivotal tool for unraveling the intricate mechanisms governing embryonic development and holds significant potential in various applications, including the acceleration of mouse generation and the production of genetically modified mice. In 1996, a milestone was reached when the first human fetus was born through ROSI technology. However, the clinical applications of this method have shown a fluctuating pattern of success and failure. To date, ROSI technology has not found widespread application in clinical practice, primarily due to its low birth efficiency and insufficient validation of fetal safety. This article provides a comprehensive account of the precise methods of performing ROSI in mice, aiming to shed new light on basic research and its potential clinical applications.

Here, we introduce a method for performing round spermatid injection (ROSI) in mice, a technique with promising clinical applications and utility for investigating the mechanisms underlying embryonic development.

Round spermatids, characterized by their haploid genetic content, represent the precursor cells to mature spermatozoa. Through the innovative technique of ...

Cryopreservation of Mouse Embryos by Ethylene Glycol-Based Vitrification

Cryopreservation of mouse embryos is a technological basis that supports biomedical sciences, because many strains of mice have been produced by genetic modifications and the number is consistently increasing year by year. Its technical development started with slow freezing methods in the 1970s1, then followed by vitrification methods developed in the late 1980s2. Generally, the latter technique is advantageous in its quickness, simplicity, and high survivability of recovered embryos. However, the cryoprotectants contained are highly toxic and may affect subsequent embryo development. Therefore, the technique was not applicable to certain strains of mice, even when the solutions are cooled to 4&deg;C to mitigate the toxic effect during embryo handling. At the RIKEN BioResource Center, more than 5000 mouse strains with different genetic backgrounds and phenotypes are maintained3, and therefore we have optimized a vitrification technique with which we can cryopreserve embryos from many different strains of mice, with the benefits of high embryo survival after vitrifying and thawing (or liquefying, more precisely) at the ambient temperature4.
Here, we present a vitrification method for mouse embryos that has been successfully used at our center. The cryopreservation solution contains ethylene glycol instead of DMSO to minimize the toxicity to embryos5. It also contains Ficoll and sucrose for prevention of devitrification and osmotic adjustment, respectively. Embryos can be handled at room temperature and transferred into liquid nitrogen within 5 min. Because the original method was optimized for plastic straws as containers, we have slightly modified the protocol for cryotubes, which are more easily accessible in laboratories and more resistant to physical damages. We also describe the procedure of thawing vitrified embryos in detail because it is a critical step for efficient recovery of live mice. These methodologies would be helpful to researchers and technicians who need preservation of mouse strains for later use in a safe and cost-effective manner.

An ethylene glycol-based vitrification method for mouse embryos is described. It is advantageous to other methods in its simplicity and low embryonic toxicity, and therefore can be broadly applicable to many strains of mice, including inbred and gene-modified mice.

Cryopreservation of mouse embryos is a technological basis that supports biomedical sciences, because many strains of mice have been produced by genetic ...

Biology

Mouse Sperm Cryopreservation and Recovery using the I&middot;Cryo Kit

Thousands of new genetically modified (GM) strains of mice have been created since the advent of transgenesis and knockout technologies. Many of these valuable animals exist only as live animals, with no backup plan in case of emergency. Cryopreservation of embryos can provide this backup, but is costly, can be a lengthy procedure, and generally requires a large number of animals for success. Since the discovery that mouse sperm can be successfully cryopreserved with a basic cryoprotective agent (CPA) consisting of 18&#37; raffinose and 3&#37; skim milk, sperm cryopreservation has become an acceptable and cost-effective procedure for archiving, distributing and recovery of these valuable strains.
 Here we demonstrate a newly developed I&bull;Cryo kit for mouse sperm cryopreservation. Sperm from five commonly-used strains of inbred mice were frozen using this kit and then recovered. Higher protection ratios of sperm motility (&gt; 60&#37;) and rapid progressive motility (&gt; 45&#37;) compared to the control (basic CPA) were seen for sperm frozen with this kit in 5 inbred mouse strains. Two cell stage embryo development after IVF with the recovered sperm was improved consistently in all 5 mouse strains examined. Over a 1.5 year period, 49 GM mouse lines were archived by sperm cryopreservation with the I&bull;Cryo kit and later recovered by IVF.

Here we demonstrate the newly developed I&#x2022;Cryo kit for mouse sperm cryopreservation. Two-cell stage embryo development with frozen-thawed sperm was improved consistently in 5 mouse strains with the use of this kit. Over a 1.5 year period, 49 genetically modified mouse lines were archived by sperm cryopreservation with the I&#x2022;Cryo kit and later successfully recovered by IVF.

Thousands of new genetically modified (GM) strains of mice have been created since the advent of transgenesis and knockout technologies.  Many of these ...

Mouse Genome Engineering Using Designer Nucleases

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well as for modeling human diseases and testing therapeutic strategies. Recent advances in the use of designer nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system for site-specific genome engineering open the possibility to perform rapid targeted genome modification in virtually any laboratory species without the need to rely on embryonic stem (ES) cell technology. A genome editing experiment typically starts with identification of designer nuclease target sites within a gene of interest followed by construction of custom DNA-binding domains to direct nuclease activity to the investigator-defined genomic locus. Designer nuclease plasmids are in vitro transcribed to generate mRNA for microinjection of fertilized mouse oocytes. Here, we provide a protocol for achieving targeted genome modification by direct injection of TALEN mRNA into fertilized mouse oocytes.

Designer nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can be used to modify the genome of mouse preimplantation embryos by triggering both the nonhomologous end joining (NHEJ) and homologous recombination (HR) pathways. These advances enable the rapid generation of mice with precise genetic modifications.

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

Trans-inner Cell Mass Injection of Embryonic Stem Cells Leads to Higher Chimerism Rates

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current blastocyst injection protocol. Here we report that a simple rotation of the embryo, and injection through Trans-Inner cell mass (TICM) increased the percentage of chimeric mice from 31% to 50%, with no additional equipment or further specialized training. 26 different inbred clones, and 35 total clones were injected over a period of 9 months. There was no significant difference in either pregnancy rate or recovery rate of embryos between traditional injection techniques and TICM. Therefore, without any major alteration in the injection process and a simple positioning of the blastocyst and injecting through the ICM, releasing the ES cells into the blastocoel cavity can potentially improve the quantity of chimeric production and subsequent germline transmission.

Here we present a protocol to increase chimera production without the use of new equipment. A simple orientation change of the embryo for injection can increase the number of embryos produced, and potentially reduce the timeline to germline transmission.

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current ...

Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice

Samenvatting

Meer video's verkennen