We wish to thank Hitomi Sawada and Elizabeth Garcia for animal care. This work was supported by KAKENHI (15K20134, 17K11222, 16H06276 and 16K01946) and Hokugin Research Grant (to H.N.), and Jichi Medical University Young Investigator Award (to H.U.).&#160;The Otsuka Toshimi Scholarship Foundation supported M.D.

All animal care and procedures performed in this study were undertaken according to the rules and regulations of the Guide for the Care and Use of Laboratory Animals. The experimental protocol was approved by the Animal Care Committee of Laboratory Animals of University of Toyama, University of Tokyo, Jichi University, and Max Planck Florida Institute for Neuroscience. Information about all reagents is showed in the Table of Materials.
1. CRISPR reagents design
<ol>
	<li>crRNA design
	<ol>
		<li>Visit CRISPR direct19 (https://crispr.dbcls.jp/) to design specific crRNAs with reduced off-target sites. 
		NOTE: There are many other useful tools to design the crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).</li>
		<li>Insert the target nucleotide sequence and make the following changes: 
		PAM sequence requirement = NGG 
		Specificity check = Mouse (Mus musculus) genome, GRCm38/mm10 (Dec, 2011) 
		NOTE: As an example, to generate Tyrosinase (Tyr) knockout mice, exon 2 (nucleotide sequence from 9476&#8211;9692) was targeted.</li>
		<li>Click Design, and for highly specific hits, mark Show Highly Specific Target Only.</li>
		<li>To reduce potential off-target effects, choose the target sequence with the lowest value in the columns of &#34;12 mer+PAM&#34; and &#34;8 mer+PAM&#34;. 
		NOTE: In these columns, (&#34;1&#34;) indicates that the sequence has only one perfect match with the intended target site and numbers greater than one indicate the presence of potential off-target sites.</li>
		<li>Order the resulting oligonucleotides from crRNA synthesis companies (Supplimentary Table 1). 
		NOTE: For the exon 2 Tyr gene, the following target sequence was used: GGACCACTATTACGTAATCC, with +TGG as the PAM sequence (Figure 2A).</li>
	</ol>
	</li>
	<li>Single strand oligodeoxynucleotide (ssODN) design for HDR-mediated editing experiments (i.e., knock-in mice generation).
	<ol>
		<li>Design the ssODN length to be around 80&#8211;180 bp including 30&#8211;60 nucleotide (nt) homology arms on both sides. 
		NOTE: An ssODN of 75&#8211;85 nt length, including a 30&#8211;35 nt homology arm and complementary to the gRNA, showed high knock-in editing efficiency21.</li>
		<li>Insert the intended modification and silent mutation at the PAM sequence or, if not possible, at the 5&#8242; neighboring base of PAM to block the recutting after genome editing. 
		NOTE: The crRNA and ssODN used in this study are listed in Supplementary Table 1.</li>
	</ol>
	</li>
</ol>
2. In vitro fertilization, embryo cryopreservation, and freeze-thawing
<ol>
	<li>In vitro fertilization
	<ol>
		<li>Superovulate C57BL/6J female mice (4 or 8-weeks-old) by IP injection with&#160;pregnant mare serum gonadotropin (PMSG) followed by injection with 7.5 IU human chorionic gonadotropin (hCG) after 48 h. 
		NOTE: The number of ovulated oocytes can be increased by about 3x using ultra-superovulation22.</li>
		<li>Remove the cauda epididymides from sexually mature C57BL/6J male mice (3&#8211;5-months-old). 
		NOTE: It is possible to collect spermatozoa without sacrificing the male mice.</li>
		<li>Extract clots of spermatozoa with a dissecting needle and incubate them in a 200 &#181;L drop of human tubal&#160;fluid (HTF) in CO2 incubator for 1.5 h for capacitation.</li>
		<li>Collect cumulus-oocyte complexes (COCs) from the oviducts 16&#8211;18 h after the hCG injection and incubate them in a fresh 200 &#181;L drop of&#160;HTF medium covered with paraffin liquid in a CO2 incubator (5% CO2, 37 &#176;C) for no more than 2 h. 
		NOTE: It is preferable to sacrifice the mice by cervical dislocation under anesthesia because euthanasia via CO2 inhalation affects IVF and embryo development23.</li>
		<li>Add 1&#8211;5 &#181;L of sperm suspension from the boundary of the incubation medium to the 200 &#181;L drop of HTF medium containing COCs and incubate them in a CO2 incubator for 3 h.</li>
		<li>Wash the oocytes with potassium-supplemented simplex optimization medium (KSOM) 3x to remove remaining sperm and cumulus cells.</li>
		<li>Check the pronuclear formation and the grade of one-cell embryos using an inverted microscope.</li>
	</ol>
	</li>
	<li>Cryopreservation of one-cell embryos
	<ol>
		<li>Incubate one-cell embryos in a 200 &#181;L drop of HTF containing 20% FBS (not covered with paraffin liquid) for 10 min in a CO2 incubator.</li>
		<li>Transfer 20&#8211;100 embryos to 50 &#181;L of 1 M dimethyl sulfoxide (DMSO) solution24.</li>
		<li>Transfer 5 &#181;L of a solution containing 100 embryos into the bottom of a cryotube and cool for 5 min at 0 &#176;C using a chiller or on ice.</li>
		<li>Add 45 &#181;L of DAP213 (2 M dimethyl sulfoxide, 1 M acetamide, and 3 M propylene glycol) solution slowly along the tube wall, cap the tubes, and keep for 5 min in a chiller or on ice at 0 &#176;C. 
		NOTE: Do not fasten the caps too tightly to remove them easily during sample thawing.</li>
		<li>Store tubes rapidly in liquid nitrogen.</li>
	</ol>
	</li>
	<li>Embryo thawing
	<ol>
		<li>Open the lid of the cryotube, discard the remaining liquid nitrogen, and add 900 &#181;L of 0.25 M sucrose solution preheated to 37 &#176;C. 
		NOTE: The 0.25 M sucrose solution must be warmed to 37 &#176;C in advance because the use of cold solution decreases embryo viability after thawing.</li>
		<li>Pipet quickly for 10x and transfer the contents of the cryotube into a plastic dish. 
		NOTE: The pipetting should be performed carefully, so that no bubbles are generated and damage the embryos.</li>
		<li>Wash the morphologically normal fertilized oocytes 2x in KSOM medium covered with paraffin liquid and keep them in a CO2 incubator until electroporation.</li>
	</ol>
	</li>
</ol>
3. Assembly and electroporation of CRISPR reagents
NOTE: For electroporation, we used a platinum plate electrode (height: 0.5 mm, length: 10 mm, width: 3 mm, gap: 1 mm) and a one-step type electroporator that were described previously8 (Table of Materials). A two-step type electroporator can be used too (Table of Materials).
<ol>
	<li>Preparation and assembly of CRISPR reagents
	<ol>
		<li>Order CRISPR reagents (i.e., crRNA, tracrRNA, and Cas9 protein) and ssODN if performing HDR-mediated editing experiments (Table of Materials and Supplementary Table 1).</li>
		<li>Prepare the annealing solution as follows.
		<ol>
			<li>Prepare 1 &#956;g/&#181;L crRNA and 1 &#956;g/&#181;L tracrRNA in Reduced-Serum Minimal Essential Medium solution (Table of Materials), and add 6 &#181;L of each solution to 42 &#181;L of the nuclease-free buffer.</li>
			<li>Incubate the mixture in the dry heater at 95 &#176;C for 3 min and cool at RT for 5 min.</li>
			<li>Prepare 1 &#956;g/&#181;L HiFi Cas9 protein diluted in Opti-MEM I and add 6 &#181;L to the previous mixture for a total volume of 60 &#181;L.</li>
			<li>In performing HDR-mediated editing experiments, add 6 &#181;L of 1 &#956;g/&#181;L ssODN. Because the final volume should be 60 &#181;L, use 36 &#181;L of nuclease-free water in step 3.1.2.1. 
			NOTE: The final concentration of crRNA, tracrRNA, Cas9 protein, and ssODN will be 100 ng/&#181;L.</li>
			<li>Transfer up to 100 embryos to 25 &#181;L of the final mixture (RNP complex) in a one hole slide glass and incubate them at 37 &#176;C for 10 min.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Electroporation
	<ol>
		<li>Fill the electrode gap with 6 &#181;L of the new mixture of CRISPR reagents and add 20&#8211;25 embryos to the mixture. 
		NOTE: It is important to avoid any contact between the embryos and the electroporation electrode, which can damage embryos during electrical pulses.</li>
		<li>Perform the electroporation at the following conditions for an one-step type electroporator: 
		Voltage: 25 V, Pulse direction (Pd) + 
		ON: 3 ms, OFF: 97 ms 
		Repeats: 5x 
		NOTE: Electroporation should be performed no more than 1 h after thawing to ensure genome editing occurs before the first DNA replication to prevent mosaicism.</li>
		<li>For a two-step type electroporator, set the conditions as follows: 
		Poring Pulse = 40V, Pd + 
		ON = 1 or 2.5 ms; Pulse interval = 50 ms 
		Repeats: 4x, Decay 10% 
		 
		Transfer Pulse = 5 or 7V; Pd +/-. 
		ON: 50 ms; Pulse interval = 50 ms. 
		Repeats = 5x; Decay = 40%. 
		NOTE: It is important to adjust the volume in order to maintain impedance within the specific range specified by the manufacturer.</li>
		<li>Wash the embryos 3x with modified Krebs-Ringer Bicarbonate Buffer 2 (M2) medium followed by two washes with a drop of KSOM medium covered with paraffin liquid.</li>
		<li>Incubate the washed embryos (in KSOM medium) in a CO2 incubator overnight for further transplantation.</li>
	</ol>
	</li>
</ol>
4. Embryo transfer
<ol>
	<li>Prepare pseudopregnant female mice. Mate ICR female mice (3&#8211;6 months) with vasectomized male mice 1 day before the embryo transfer (ET). 
	NOTE: Mice should be checked the next morning for a copulatory plug. The mice with a plug are considered pseudopregnant and can be used for ET.</li>
	<li>Aspirate air and KSOM (without paraffin liquid) in alternate intervals of 2&#8211;3 mm into a glass capillary as a marker for successful implantation.</li>
	<li>Introduce 20&#8211;24 embryos into a 200 &#956;L drop of KSOM (without paraffin liquid) and draw 10&#8211;12 embryos into the glass capillary for implantation in each oviduct.</li>
	<li>Anesthetize the female mice by isoflurane (inhalation) or an IP injection of a solution combining medetomidine/midazolam/butorphanol (0.3 mg/kg, 4.0 mg/kg, and 5.0 mg/kg respectively). Position the anesthetized mouse on its ventral side on a heating pad. Protect the eyes of the anesthetized mouse with a moisturizing gel.</li>
	<li>Shave along the lower part of the dorsal midline and disinfect the area with povidone iodine followed by with 70% ethanol.</li>
	<li>Make a long ~1 cm incision parallel to the dorsal midline.</li>
	<li>Take out the oviduct and place on a sterile plastic drape. Keep it moist using warm sterile saline.</li>
	<li>Place the oviduct under the stereoscopic microscope.</li>
	<li>Make a hole into the wall of the oviduct between the infundibulum and ampulla a few millimeters upstream of the ampulla by microspring scissors.</li>
	<li>Insert the tip of the glass capillary containing the embryos into the hole and blow gently into the mouthpiece of the capillary holder to expel the embryos until an air bubble is visible in the ampulla. 
	NOTE: Transfer between 10&#8211;12 embryos per oviduct.</li>
	<li>Withdraw the glass capillary from the oviduct wall and push the reproductive organ gently back into the body cavity.</li>
	<li>Repeat the previous process to introduce the embryos into the other oviduct.</li>
	<li>Upon completing the ET procedure, suture the peritoneum with a simple interrupted suture pattern (5&#173;0, absorbable, braided synthetic sutures) and then the skin with a simple interrupted pattern or a buried subcuticular interrupted stitch pattern (6&#173;0 non&#173;absorbable, monosynthetic sutures).</li>
	<li>Keep the mouse warm on a 37 &#176;C warming plate until it recovers from anesthesia.</li>
	<li>Monitor the health of the animal daily for 7 days after surgery.</li>
</ol>
5. Genotyping and sequence analysis
<ol>
	<li>Genomic DNA extraction 
	NOTE: We used NucleoSpin tissue DNA extraction kits to extract the genomic DNA from mice ear tissue following the manufacturer&#8217;s recommendations.
	<ol>
		<li>Add 180 &#181;L of Buffer T1 and 25 &#181;L of Proteinase K solution to the sample and mix by vortexing for 10 s.</li>
		<li>Incubate at 56 &#176;C for 2 h or until complete lysis is obtained. Vortex for 10 s every 30 min of the incubation.</li>
		<li>Add 200 &#181;L of Buffer B3, vortex vigorously for 30 s, and incubate at 70 &#176;C for 10 min.</li>
		<li>Add 210 &#181;L of 100% ethanol to the sample and vortex vigorously.</li>
		<li>For each sample, place one tissue column into a collection tube and apply the sample to the column.</li>
		<li>Centrifuge for 1 min at 11,000 x g, discard the flowthrough, and place the column back into the collection tube.</li>
		<li>Add 500 &#181;L of Buffer BW to wash the sample (1st wash), centrifuge for 1 min at 11,000 x g, discard the flowthrough and place the column back into the collection tube.</li>
		<li>Add 600 &#181;L of Buffer B5 to the column (2nd wash), centrifuge for 1 min at 11,000 x g, discard the flowthrough, and place the column back into the collection tube.</li>
		<li>Centrifuge the column for 1 min at 11,000 x g to dry the silica membrane and place the NucleoSpin tissue column into a 1.5 mL microcentrifuge tube.</li>
		<li>Add 100 &#181;L of Buffer BE, incubate at room temperature for 1 min, then centrifuge 1 min at 11,000 x g.</li>
	</ol>
	</li>
	<li>PCR amplification and purification
	<ol>
		<li>Design the primers using the primer3 plus website (https://primer3plus.com/) in order to amplify a 400&#8211;500 bp sequence surrounding the targeted locus.</li>
		<li>Design a new PCR protocol and test it empirically.</li>
		<li>Purify the PCR product to remove the unwanted enzymes, nucleotides, primers, and buffer components. A standard purification method can be used as follows.
		<ol>
			<li>Add 50 &#181;L of phenol to 50 &#181;L of the PCR products and mix by vortexing.</li>
			<li>Centrifuge for 1 min at 11,000 x g and transfer the upper transparent layer to a new tube.</li>
			<li>Add 120 &#181;L of 99.5% ethanol and 20 &#181;L of 5 M ammonium acetate and vortex for 30 s.</li>
			<li>Keep at RT for 10 min and centrifuge at 11,000 x g for 10 min.</li>
			<li>Discard the supernatant and wash the DNA pellet with 1 mL of 70% ethanol.</li>
			<li>Dry the pellet at RT for 10 min and dissolve in 10 &#181;L of RNase free water. 
			NOTE: PCR column-based purification kits are recommented because phenol is toxic to humans.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Sanger sequencing
	<ol>
		<li>Run DNA quantification analysis (see Table of Materials) to quantify the purified PCR amplicon.</li>
		<li>Send PCR product(s) and sequencing primer(s) to a sequencing service provider.</li>
		<li>Analyze the sequence using the available online websites. 
		NOTE: In this study, CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) was used for sequence analysis.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/cas-mediated+genome+engineering.">One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering.</a> Cell. 153 (4), 910-918 (2013).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA+-+guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-822 (2012).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/VCas+systems.">Multiplex genome engineering using CRISPR/VCas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), 1258096 (2014).</li><li>Mashiko, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+mutant+mice+by+pronuclear+injection+of+circular+plasmid+expressing+Cas9+and+single+guided+RNA.">Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA.</a> Scientific Reports. 3, 3355 (2013).</li><li>Yen, S. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mosaicism+and+allele+complexity+induced+by+CRISPR/Cas9+RNA+injections+in+mouse+zygotes.">Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes.</a> Developmental Biology. 393 (1), 3-9 (2014).</li><li>Kaneko, T., Mashimo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+genome+editing+of+rodent+intact+embryos+by+electroporation.">Simple genome editing of rodent intact embryos by electroporation.</a> PLoS ONE. 10 (11), 1-7 (2015).</li><li>Qin, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+CRISPR/cas9-mediated+genome+editing+in+mice+by+zygote+electroporation+of+nuclease.">Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease.</a> Genetics. 200 (2), 423-430 (2015).</li><li>Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+knockout+by+electroporation+of+engineered+endonucleases+into+intact+rat+embryos.">Simple knockout by electroporation of engineered endonucleases into intact rat embryos.</a> Scientific Reports. 4, 6382 (2014).</li><li>Hashimoto, M., Takemoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+enables+the+efficient+mRNA+delivery+into+the+mouse+zygotes+and+facilitates+CRISPR/Cas9-based+genome+editing.">Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing.</a> Scientific Reports. 5, 11315 (2015).</li><li>Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+mouse+genome+editing+by+CRISPR+ribonucleoprotein+electroporation+of+zygotes.">Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes.</a> Journal of Biological Chemistry. 291 (28), 14457-14467 (2016).</li><li>Modzelewski, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+mouse+genome+engineering+by+CRISPR-EZ+technology.">Efficient mouse genome engineering by CRISPR-EZ technology.</a> Nature Protocols. 13 (6), 1253-1274 (2018).</li><li>Teixeira, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+mice+zygotes+with+dual+guide+RNA/Cas9+complexes+for+simple+and+efficient+cloning-free+genome+editing.">Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing.</a> Scientific Reports. 8, 474 (2018).</li><li>Nakagawa, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+knockout+mice+by+DNA+microinjection+of+various+CRISPR/Cas9+vectors+into+freeze-thawed+fertilized+oocytes.">Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes.</a> BMC Biotechnology. 15 (1), 1-10 (2015).</li><li>Darwish, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+high-efficient+generation+of+mutant+mice+using+freeze-thawed+embryos+of+the+C57BL/6J+strain.">Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain.</a> Journal of Neuroscience Methods. 317, 149-156 (2019).</li><li>Hashimoto, M., Yamashita, Y., Takemoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+Cas9+protein/sgRNA+into+early+pronuclear+zygotes+generates+non-mosaic+mutants+in+the+mouse.">Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse.</a> Developmental Biology. 418 (1), 1-9 (2016).</li><li>Sakamoto, W., Kaneko, T., Nakagata, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+frozen-thawed+oocytes+for+efficient+production+of+normal+offspring+from+cryopreserved+mouse+spermatozoa+showing+low+fertility.">Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility.</a> Comparative Medicine. 55 (2), 136-139 (2005).</li><li>Naito, Y., Hino, K., Bono, H., Ui-Tei, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRdirect:+Software+for+designing+CRISPR/Cas+guide+RNA+with+reduced+off-target+sites.">CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites.</a> Bioinformatics. 31 (7), 1120-1123 (2015).</li><li>Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=WeReview:+CRISPR+Tools-Live+Repository+of+Computational+Tools+for+Assisting+CRISPR/Cas+Experiments.">WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments.</a> Bioengineering. 6 (3), 63 (2019).</li><li>Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+genome+editing+for+single-base+substitutions+using+optimized+ssODNs+with+Cas9-RNPs.">Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs.</a> Scientific Reports. 9, 4811 (2019).</li><li>Takeo, T., Nakagata, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+using+the+combined+administration+of+inhibin+antiserum+and+equine+chorionic+gonadotropin+increases+the+number+of+ovulated+oocytes+in+C57BL/6+female+mice.">Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice.</a> PLoS ONE. 10 (5), 1-11 (2015).</li><li>Wuri, L., Agca, C., Agca, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Euthanasia+via+CO2+inhalation+causes+premature+cortical+granule+exocytosis+in+mouse+oocytes+and+influences+in+vitro+fertilization+and+embryo+development.">Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development.</a> Molecular Reproduction and Development. 86 (7), 825-834 (2019).</li><li>Nakagata, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+survival+rate+of+unfertilized+mouse+oocytes+after+vitrification.">High survival rate of unfertilized mouse oocytes after vitrification.</a> Journal of Reproduction and Fertility. 87 (2), 479-483 (1989).</li><li>Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISP-ID:+Decoding+CRISPR+mediated+indels+by+Sanger+sequencing.">CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing.</a> Scientific Reports. 6, 28973 (2016).</li><li>Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation-mediated+genome+editing+in+vitrified/warmed+mouse+zygotes+created+by+ivf+via+ultra-superovulation.">Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation.</a> Experimental Animals. 67 (4), 535-543 (2018).</li><li>Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+albino+Xenopus+tropicalis+using+zinc-finger+nucleases.">Generation of albino Xenopus tropicalis using zinc-finger nucleases.</a> Development Growth and Differentiation. 54 (9), 777-784 (2012).</li><li>Hur, J. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+mutagenesis+in+mice+by+electroporation+of+Cpf1+ribonucleoproteins.">Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins.</a> Nature Biotechnology. 34, 807-808 (2016).</li><li>Dumeau, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introducing+gene+deletions+by+mouse+zygote+electroporation+of+Cas12a/Cpf1.">Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1.</a> Transgenic Research. 28 (5-6), 525-535 (2019).</li><li>Chen, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-READI:+Efficient+Generation+of+Knockin+Mice+by+CRISPR+RNP+Electroporation+and+AAV+Donor+Infection.">CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection.</a> Cell Reports. 27 (13), 3780-3789 (2019).</li><li>Mizuno, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intra-embryo+Gene+Cassette+Knockin+by+CRISPR/Cas9-Mediated+Genome+Editing+with+Adeno-Associated+Viral+Vector.">Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector.</a> iScience. 9, 286-297 (2018).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Efficient+RNA-guide+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Research. 24 (6), 1012-1019 (2014).</li><li>Vakulskas, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-fidelity+Cas9+mutant+delivered+as+a+ribonucleoprotein+complex+enables+efficient+gene+editing+in+human+hematopoietic+stem+and+progenitor+cells.">A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells.</a> Nature Medicine. 24 (8), 1216-1224 (2018).</li><li>Rodriguez-Rodriguez, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+Roles+of+RZZ+and+Bub1-KNL1+in+Mitotic+Checkpoint+Signaling+and+Kinetochore+Expansion.">Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion.</a> Current Biology. 28 (21), 3422-3429 (2018).</li><li>Smits, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+Plasticity+Rescues+Target+Activity+in+CRISPR+Knockouts.">Biological Plasticity Rescues Target Activity in CRISPR Knockouts.</a> Nature Methods. 16, 1087-1093 (2019).</li></ol>

The authors have no relevant financial disclosures.

The described protocol allows for the generation of GM mice with high efficiency and low mosaic rates (Table 1). It enables researchers without advanced embryo manipulation skills to create mutant mice easily because it takes advantage of the latest and most useful advances in both reproductive engineering and genome editing technologies: CRISPR/Cas9 ribonucleoprotein (RNP) and electroporation into freeze-thawed embryos. These advances facilitated and expedited the generation of the GM mice. As described...

The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system is a scientific breakthrough that provides unprecedented targeted modification in the genome1. The CRISPR/Cas9 system is comprised of Cas9 protein and guide RNA (gRNA) with two molecular components: a target-specific CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA)2 . A gRNA directs the Cas9 protein to the specific locus in the genome, 20 nucleotides complementary to crRNA, and adjacent to the protospacer adjacent motif (PAM). The Cas9 protein binds to the target sequence and induces double-strand breaks (DSBs) that are repaired by either error-prone nonhomologous end joining (NHEJ) or high fidelity homology-directed repair (HDR)3,4,5. The NHEJ leads to insertions or/and deletions (indels), and hence to gene loss of function when a coding sequence is targeted. The HDR leads to precise genome editing in the presence of a repair template containing homology sequences3,4,5. The NHEJ and HDR have been harnessed to generate knockout and knock-in mice, respectively.
While the CRISPR/Cas9 system has markedly accelerated the generation of GM mice with outstanding efficacy and fidelity, scientists who apply these methods often encounter technical challenges. First, conventional protocols require microinjection for introducing the CRISPR editing tools into the pronucleus of fertilized eggs6,7. This technique is time-consuming and usually requires extensive training. Thus, several groups replaced microinjection with electroporation8,9,10,11,12,13. However, in the early electroporation protocols fresh embryos were used for electroporation. This caused another problem, because preparing fresh embryos before each experiment is difficult14.
Recently we and others have combined the use of freeze-thawed embryos and electroporation for genome editing, which facilitates the generation of GM mice15,16. This protocol enables researchers without advanced embryo manipulation skills to rapidly generate animal models of human diseases with high efficiency. The protocol also significantly reduces practical challenges in generating GM mice, such as genetic heterogeneity in the founders16. To overcome mosaicism, we perform the electroporation of CRISPR reagents within 1 h after embryo thawing to ensure that editing occurs before the first replication of the genome. Another improvement includes the use of Cas9 protein instead of Cas9 mRNA to reduce undesirable mosaicism17. Furthermore, we developed an optimal method for one-cell embryo cryopreservation that increases the developmental rate to the two-cell stage16: use of fetal bovine serum (FBS) dramatically improves the survival of freeze-thawed oocytes after fertilization, perhaps by the same mechanism that makes freeze-thawed unfertilized oocytes more resilient18.
Here we present a comprehensive protocol for the generation of GM mice using freeze-thawed embryos, including the modified method for cryopreservation of one-cell C57BL/6J embryos. It includes 1) gRNA design, CRISPR reagent preparation and assembly; 2) IVF, cryopreservation, and thawing of one-cell embryos; 3) Electroporation of CRISPR reagents into freeze-thawed embryos; 4) Embryo transfer into the oviduct of pseudopregnant female mice; and 5) Genotyping and sequence analysis of the F0 founder animals.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.25 M Sucrose</td>
			<td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td>
			<td>SUCROSE</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M DMSO</td>
			<td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td>
			<td>1M DMSO</td>
			<td></td>
		</tr>
		<tr>
			<td>Butorphanol</td>
			<td>Meiji Seika Pharma Co., Ltd. (Tokyo, Japan)</td>
			<td>Vetorphale 5mg</td>
			<td></td>
		</tr>
		<tr>
			<td>Cas9 protein: Alt-R&#174; S.p. HiFi Cas9 Nuclease 3NLS</td>
			<td>Integrated DNA Technologies, Inc. (Coralville, IA)</td>
			<td>1081060</td>
			<td></td>
		</tr>
		<tr>
			<td>C57BL/6J mice</td>
			<td>Japan SLC (Hamamatsu, Japan)</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>DAP213</td>
			<td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td>
			<td>DAP213</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Sigma-Aldrich, Inc. (St. Louis, MO)</td>
			<td>ES-009-C</td>
			<td></td>
		</tr>
		<tr>
			<td>hCG</td>
			<td>MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan)</td>
			<td>HCG Mochida 3000</td>
			<td></td>
		</tr>
		<tr>
			<td>HTF</td>
			<td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td>
			<td>HTF</td>
			<td></td>
		</tr>
		<tr>
			<td>ICR mice</td>
			<td>Japan SLC (Hamamatsu, Japan)</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Isoflurane</td>
			<td>Petterson Vet Supply, Inc. (Greeley, CO)</td>
			<td>07-893-1389</td>
			<td></td>
		</tr>
		<tr>
			<td>KSOM</td>
			<td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td>
			<td>KSOM</td>
			<td></td>
		</tr>
		<tr>
			<td>LN2 Tank</td>
			<td>Chart Industries (Ball Ground, GA)</td>
			<td>XC 34/18</td>
			<td></td>
		</tr>
		<tr>
			<td>M2</td>
			<td>ARK Resource Co., Ltd. (Kumamoto, Japan)</td>
			<td>M2</td>
			<td></td>
		</tr>
		<tr>
			<td>Medetomidine</td>
			<td>Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan)</td>
			<td>1124401A1060</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Nikon Co. (Tokyo, Japan)</td>
			<td>SMZ745T</td>
			<td></td>
		</tr>
		<tr>
			<td>Midazolam</td>
			<td>Sandoz K.K. (Tokyo, Japan)</td>
			<td>1124401A1060</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease free buffer</td>
			<td>Integrated DNA Technologies, Inc. (Coralville, IA)</td>
			<td>1072570</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleospin DNA extraction kit</td>
			<td>Takara Bio Inc (Kusatsu, Japan)</td>
			<td>740952 .5</td>
			<td></td>
		</tr>
		<tr>
			<td>One-hole slide glass</td>
			<td>Matsunami Glass Ind., Ltd. (Kishiwada, Japan)</td>
			<td>S339929</td>
			<td></td>
		</tr>
		<tr>
			<td>One-step type Electroporator</td>
			<td>BEX Co., Ltd. (Tokyo, Japan)</td>
			<td>CUY21EDIT II</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin Liquid</td>
			<td>NACALAI TESQUE Inc. (Kyoto, Japan)</td>
			<td>SP 26137-85</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum plate electrode</td>
			<td>BEX Co., Ltd. (Tokyo, Japan)</td>
			<td>LF501PT1-10, GE-101</td>
			<td></td>
		</tr>
		<tr>
			<td>PMSG</td>
			<td>ASKA Animal Health Co., Ltd (Tokyo, Japan)</td>
			<td>SEROTROPIN 1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Povidone iodide</td>
			<td>Professional Disposables International, Inc. (Orangeburg, NY)</td>
			<td>C12400</td>
			<td></td>
		</tr>
		<tr>
			<td>Reduced-Serum Minimal Essential Medium: OptiMEM I</td>
			<td>Sigma-Aldrich, Inc. (St. Louis, MO)</td>
			<td>22600134</td>
			<td></td>
		</tr>
		<tr>
			<td>Two-step type Electroporator</td>
			<td>Nepa Gene Co., Ltd. (Ichikawa, Japan)</td>
			<td>NEPA21</td>
			<td></td>
		</tr>
	</tbody>
</table>

use of freeze-thawed embryos for high-efficiency production of genetically modified mice

The use of genetically modified (GM) mice has become crucial for understanding gene function and deciphering the underlying mechanisms of human diseases. The CRISPR/Cas9 system allows researchers to modify the genome with unprecedented efficiency, fidelity, and simplicity. Harnessing this technology, researchers are seeking a rapid, efficient, and easy protocol for generating GM mice. Here we introduce an improved method for cryopreservation of one-cell embryos that leads to a higher developmental rate of the freeze-thawed embryos. By combining it with optimized electroporation conditions, this protocol allows for the generation of knockout and knock-in mice with high efficiency and low mosaic rates within a short time. Furthermore, we show a step-by-step explanation of our optimized protocol, covering CRISPR reagent preparation, in vitro fertilization, cryopreservation and thawing of one-cell embryos, electroporation of CRISPR reagents, mouse generation, and genotyping of the founders. Using this protocol, researchers should be able to prepare GM mice with unparalleled ease, speed, and efficiency.

Our modified method for cryopreservation of one-cell embryos, including incubation in HTF containing 20% FBS for 10 min followed by cryopreservation in 1 M DMSO and DAP213 solution, improved the developmental rate of the freeze-thawed embryos into the two-cell stage (Figure 1, p = 0.009, Student&#8217;s t-test).The freeze-thawed embryos were used for the production of GM mice and electroporation conditions were optimized: five repeats of 25 V with 3 ms pulses and 97 ms intervals using an ele...

Watch this Scientific Journal Video about Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice at JoVE.com

Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice

Here, we present a modified method for cryopreservation of one-cell embryos as well as a protocol that couples the use of freeze-thawed embryos and electroporation for the efficient generation of genetically modified mice.

The use of genetically modified (GM) mice has become crucial for understanding gene function and deciphering the underlying mechanisms of human diseases. ...

use-freeze-thawed-embryos-for-high-efficiency-production-genetically

Research

JoVE Journal

Genetics

9.5K Views.  Max Planck Florida Institute for Neuroscience. Here, we present a modified method for cryopreservation of one-cell embryos as well as a protocol that couples the use of freeze-thawed embryos and electroporation for the efficient generation of genetically modified mice.

Video: Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice

Genetic Engineering of an Unconventional Yeast for Renewable Biofuel and Biochemical Production

Yarrowia lipolytica is a non-pathogenic, dimorphic and strictly aerobic yeast species. Owing to its distinctive physiological features and metabolic characteristics, this unconventional yeast is not only a good model for the study of the fundamental nature of fungal differentiation but is also a promising microbial platform for biochemical production and various biotechnological applications, which require extensive genetic manipulations. However, genetic manipulations of Y. lipolytica have been limited due to the lack of an efficient and stable genetic transformation system as well as very high rates of non-homologous recombination that can be mainly attributed to the KU70 gene. Here, we report an easy and rapid protocol for the efficient genetic transformation and for gene deletion in Y. lipolytica Po1g. First, a protocol for the efficient transformation of exogenous DNA into Y. lipolytica Po1g was established. Second, to achieve the enhanced double-crossover homologous recombination rate for further deletion of target genes, the KU70 gene was deleted by transforming a disruption cassette carrying 1 kb homology arms. Third, to demonstrate the enhanced gene deletion efficiency after deletion of the KU70 gene, we individually deleted 11 target genes encoding alcohol dehydrogenase and alcohol oxidase using the same procedures on the KU70 knockout platform strain. It was observed that the rate of precise homologous recombination increased substantially from less than 0.5% for deletion of the KU70 gene in Po1g to 33%-71% for the single gene deletion of the 11 target genes in Po1g KU70&#916;. A replicative plasmid carrying the hygromycin B resistance marker and the Cre/LoxP system was constructed, and the selection marker gene in the yeast knockout strains was eventually removed by expression of Cre recombinase to facilitate multiple rounds of targeted genetic manipulations. The resulting single-gene deletion mutants have potential applications in biofuel and biochemical production.

We herein report methods on the molecular genetic manipulation of the Yarrowia lipolytica Po1g strain for improved gene deletion efficiency. The resulting engineered Y. lipolytica strains have potential applications in biofuel and biochemical production.

Yarrowia lipolytica is a non-pathogenic, dimorphic and strictly aerobic yeast species. Owing to its distinctive physiological features and metabolic ...

Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos

Investigating the three-dimensional architecture of chromatin offers invaluable insight into the mechanisms of gene regulation. Here, we describe a protocol for performing the chromatin conformation capture technique in situ Hi-C on staged Drosophila melanogaster embryo populations. The result is a sequencing library that allows the mapping of all chromatin interactions that occur in the nucleus in a single experiment. Embryo sorting is done manually using a fluorescent stereo microscope and a transgenic fly line containing a nuclear marker. Using this technique, embryo populations from each nuclear division cycle, and with defined cell cycle status, can be obtained with very high purity. The protocol may also be adapted to sort older embryos beyond gastrulation. Sorted embryos are used as inputs for in situ Hi-C. All experiments, including sequencing library preparation, can be completed in five days. The protocol has low input requirements and works reliably using 20 blastoderm stage embryos as input material. The end result is a sequencing library for next generation sequencing. After sequencing, the data can be processed into genome-wide chromatin interaction maps that can be analyzed using a wide range of available tools to gain information about topologically associating domain (TAD) structure, chromatin loops, and chromatin compartments during Drosophila development.

Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos

This work describes a protocol for the generation of high resolution in situ Hi-C libraries from tightly staged pre-gastrulation Drosophila melanogaster embryos.

Investigating the three-dimensional architecture of chromatin offers invaluable insight into the mechanisms of gene regulation. Here, we describe a ...

Production and Purification of Baculovirus for Gene Therapy Application

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a promising vector for gene therapy application. Here, baculovirus is produced by transient transfection of the baculovirus plasmid DNA (bacmid) in an adherent culture of Sf9 cells. Baculovirus is subsequently expanded in Sf9 cells in a serum-free suspension culture until the desired volume is obtained. It is then purified from the culture supernatant using heparin affinity chromatography. Virus supernatant is loaded onto the heparin column which binds baculovirus particles in the supernatant due to the affinity of heparin for baculovirus envelop glycoprotein. The column is washed with a buffer to remove contaminants and baculovirus is eluted from the column with a high-salt buffer. The eluate is diluted to an isotonic salt concentration and baculovirus particles are further concentrated using ultracentrifugation. Using this method, baculovirus can be concentrated up to 500-fold with a 25% recovery of infectious particles. Although the protocol described here demonstrates the production and purification of the baculovirus from cultures up to 1 L, the method can be scaled-up in a closed-system suspension culture to produce a clinical-grade vector for gene therapy application.

In this protocol, baculovirus is produced by transient transfection of baculovirus plasmid into Sf9 cells and amplified in a serum-free suspension culture. The supernatant is purified by heparin affinity chromatography and further concentrated by ultracentrifugation. This protocol is useful for the production and purification of baculovirus for gene therapy application.

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a ...

Lentiviral Mediated Production of Transgenic Mice: A Simple and Highly Efficient Method for Direct Study of Founders

For almost 40 years, pronuclear DNA injection represents the standard method to generate transgenic mice with random integration of transgenes. Such a routine procedure is widely utilized throughout the world and its main limitation resides in the poor efficacy of transgene integration, resulting in a low yield of founder animals. Only few percent of animals born after implantation of injected fertilized oocytes have integrated the transgene. In contrast, lentiviral vectors are powerful tools for integrative gene transfer and their use to transduce fertilized oocytes allows highly efficient production of founder transgenic mice with an average yield above 70%. Furthermore, any mouse strain can be used to produce transgenic animal and the penetrance of transgene expression is extremely high, above 80% with lentiviral mediated transgenesis compared to DNA microinjection. The size of the DNA fragment that can be cargo by the lentiviral vector is restricted to 10 kb and represents the major limitation of this method. Using a simple and easy to perform injection procedure beneath the zona pellucida of fertilized oocytes, more than 50 founder animals can be produced in a single session of microinjection. Such a method is highly adapted to perform, directly in founder animals, rapid gain and loss of function studies or to screen genomic DNA regions for their ability to control and regulate gene expression in vivo.

Here, we present a protocol to promote transgene integration and production of founder transgenic mice with high efficacy by a simple injection of a lentiviral vector in the perivitelline space of a fertilized oocyte.

For almost 40 years, pronuclear DNA injection represents the standard method to generate transgenic mice with random integration of transgenes. Such a ...

Generation of Tumor Organoids from Genetically Engineered Mouse Models of Prostate Cancer

Methods based on homologous recombination to modify genes have significantly furthered biological research. Genetically engineered mouse models (GEMMs) are a rigorous method for studying mammalian development and disease. Our laboratory has developed several GEMMs of prostate cancer (PCa) that lack expression of one or multiple tumor suppressor genes using the site-specific Cre-loxP recombinase system and a prostate-specific promoter. In this article, we describe our method for necropsy of these PCa GEMMs, primarily focusing on dissection of mouse prostate tumors. New methods developed over the last decade have facilitated the culture of epithelial-derived cells to model organ systems in vitro in three dimensions. We also detail a 3D cell culture method to generate tumor organoids from mouse PCa GEMMs. Pre-clinical cancer research has been dominated by 2D cell culture and cell line-derived or patient-derived xenograft models. These methods lack tumor microenvironment, a limitation of using these techniques in pre-clinical studies. GEMMs are more physiologically-relevant for understanding tumorigenesis and cancer progression. Tumor organoid culture is an in vitro model system that recapitulates tumor architecture and cell lineage characteristics. In addition, 3D cell culture methods allow for growth of normal cells for comparison to tumor cell cultures, rarely possible using 2D cell culture techniques. In combination, use of GEMMs and 3D cell culture in pre-clinical studies has the potential to improve our understanding of cancer biology.&#160;

We show a method for necropsy and dissection of mouse prostate cancer models, focusing on prostate tumor dissection. A step-by-step protocol for generation of mouse prostate tumor organoids is also presented.

Methods based on homologous recombination to modify genes have significantly furthered biological research. Genetically engineered mouse models (GEMMs) ...

Use of Frozen Tissue in the Comet Assay for the Evaluation of DNA Damage

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other environmental stressors. Use of the comet assay in regulatory testing for genotoxic potential in rodents has been driven by adoption of an Organisation for Economic Co-operation and Development (OECD) test guideline in 2014. Comet assay slides are typically prepared from fresh tissue at the time of necropsy; however, freezing tissue samples can avoid logistical challenges associated with simultaneous preparation of slides from multiple organs per animal and from many animals per study. Freezing also enables shipping samples from the exposure facility to a different laboratory for analysis, and storage of frozen tissue facilitates deferring a decision to generate DNA damage data for a given organ. The alkaline comet assay is useful for detecting exposure-related DNA double- and single-strand breaks, alkali-labile lesions, and strand breaks associated with incomplete DNA excision repair. However, DNA damage can also result from mechanical shearing or improper sample processing procedures, confounding the results of the assay. Reproducibility in collection and processing of tissue samples during necropsies may be difficult to control due to fluctuating laboratory personnel with varying levels of experience in harvesting tissues for the comet assay. Enhancing consistency through refresher training or deployment of mobile units staffed with experienced laboratory personnel is costly and may not always be feasible. To optimize consistent generation of high quality samples for comet assay analysis, a method for homogenizing flash frozen cubes of tissue using a customized tissue mincing device was evaluated. Samples prepared for the comet assay by this method compared favorably in quality to fresh and frozen tissue samples prepared by mincing during necropsy. Moreover, low baseline DNA damage was measured in cells from frozen cubes of tissue following prolonged storage.

This protocol describes several procedures for preparing high quality frozen tissue samples at the time of necropsy for use in the comet assay to assess DNA damage: 1) minced tissue, 2) scraped epithelial cells from the gastrointestinal tract, and 3) cubed tissue samples, requiring homogenization using a tissue mincing device.

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other ...

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a rapid and high-throughput manner. S2 cells have proven amenable to both fixed- and live-cell imaging applications. Notably, live-cell imaging can yield valuable information about how loss or knockdown of a gene can affect the kinetics and dynamics of key events during cell division, including mitotic spindle assembly, chromosome congression, and segregation, as well as overall cell cycle timing. Here we utilize S2 cells stably transfected with fluorescently tagged mCherry:&#945;-tubulin to mark the mitotic spindle and GFP:CENP-A (referred to as &#8216;CID&#8217; gene in Drosophila) to mark the centromere to analyze the effects of key mitotic genes on the timing of cell divisions, from prophase (specifically at Nuclear Envelope Breakdown; NEBD) to the onset of anaphase. This imaging protocol also allows for the visualization of the spindle microtubule and chromosome dynamics throughout mitosis. Herein, we aim to provide a simple yet comprehensive protocol that will allow readers to easily adapt S2 cells for live imaging experiments. Results obtained from such experiments should expand our understanding of genes involved in the cell division by defining their role in several simultaneous and dynamic events. Observations made in this cell culture system can be validated and further investigated in vivo using the impressive toolkit of genetic approaches in flies.

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Cell divisions can be visualized in real time using fluorescently tagged proteins and time-lapse microscopy. Using the protocol presented here, users can analyze cell division timing dynamics, mitotic spindle assembly, and chromosome congression and segregation. Defects in these events following RNA interference (RNAi)-mediated gene knockdown can be assessed and quantified.

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a ...

Genome-wide Analysis of Histone Modifications Distribution using the Chromatin Immunoprecipitation Sequencing Method in Magnaporthe oryzae

Chromatin immunoprecipitation sequencing (ChIP-seq) is a powerful and widely used molecular technique for mapping whole genome locations of transcription factors (TFs), chromatin regulators, and histone modifications, as well as detecting entire genomes for uncovering TF binding patterns and histone posttranslational modifications. Chromatin-modifying activities, such as histone methylation, are often recruited to specific gene regulatory sequences, causing localized changes in chromatin structures and resulting in specific transcriptional effects. The rice blast is a devastating fungal disease on rice throughout the world and is a model system for studying fungus-plant interaction. However, the molecular mechanisms in how the histone modifications regulate their virulence genes in Magnaporthe oryzae remain elusive. More researchers need to use ChIP-seq to study how histone epigenetic modification regulates their target genes. ChIP-seq is also widely used to study the interaction between protein and DNA in animals and plants, but it is less used in the field of plant pathology and has not been well developed. In this paper, we describe the experimental process and operation method of ChIP-seq to identify the genome-wide distribution of histone methylation (such as H3K4me3) that binds to the functional target genes in M. oryzae. Here, we present a protocol to analyze the genome-wide distribution of histone modifications, which can identify new target genes in the pathogenesis of M. oryzae and other filamentous fungi.

Genome-wide Analysis of Histone Modifications Distribution using the Chromatin Immunoprecipitation Sequencing Method in Magnaporthe oryzae

Here, we present a protocol to analyze the genome-wide distribution of histone modifications, which can identify new target genes in the pathogenesis of M. oryzae and other filamentous fungi.

Chromatin immunoprecipitation sequencing (ChIP-seq) is a powerful and widely used molecular technique for mapping whole genome locations of transcription ...

Small-Cage Laboratory Trials of Genetically-Engineered Anopheline Mosquitoes

Control of mosquito-borne pathogens using genetically-modified vectors has been proposed as a promising tool to complement conventional control strategies. CRISPR-based homing gene drive systems have made transgenic technologies more accessible within the scientific community. Evaluation of transgenic mosquito performance and comparisons with wild-type counterparts in small laboratory cage trials provide valuable data for the design of subsequent field cage experiments and experimental assessments to refine the strategies for disease prevention. Here, we present three different protocols used in laboratory settings to evaluate transgene spread in anopheline mosquito vectors of malaria. These include inundative releases (no gene-drive system), and gene-drive overlapping and non-overlapping generation trials. The three trials vary in a number of parameters and can be adapted to desired experimental settings. Moreover, insectary studies in small cages are part of the progressive transition of engineered insects from the laboratory to open field releases. Therefore, the protocols described here represent invaluable tools to provide empirical values that will ultimately aid field implementation of new technologies for malaria elimination.

The protocols reported here illustrate three alternative ways to assess the performance of genetically-engineered mosquitoes destined for vector control in laboratory-contained small cage trials. Each protocol is tailored to the specific modification the mosquito strain bears (gene drive or non-gene drive) and the types of parameters measured.

Control of mosquito-borne pathogens using genetically-modified vectors has been proposed as a promising tool to complement conventional control ...

Microinjection Method for Anopheles gambiae Embryos

Embryo microinjection techniques are essential for many molecular and genetic studies of insect species. They provide a means to introduce exogenous DNA fragments encoding genes of interest as well as favorable traits into the insect germline in a stable and heritable manner. The resulting transgenic strains can be studied for phenotypic changes resulting from the expression of the integrated DNA to answer basic questions or used in practical applications. Although the technology is straightforward, it requires of the investigator patience and practice to achieve a level of skill that maximizes efficiency. Shown here is a method for microinjection of embryos of the African malaria mosquito, Anopheles gambiae. The objective is to deliver by microinjection exogenous DNA to the embryo so that it can be taken up in the developing germline (pole) cells. Expression from the injected DNA of transposases, integrases, recombinases, or other nucleases (for example CRISPR-associated proteins, Cas) can trigger events that lead to its covalent insertion into chromosomes. Transgenic An. gambiae generated from these technologies have been used for basic studies of immune system components, genes involved in blood-feeding, and elements of the olfactory system. In addition, these techniques have been used to produce An. gambiae strains with traits that may help control the transmission of malaria parasites.

Microinjection Method for Anopheles gambiae Embryos

Microinjection techniques are essential to introduce exogenous genes into the genomes of mosquitoes. This protocol explains a method used by the James laboratory to microinject DNA constructs into Anopheles gambiae embryos to generate transformed mosquitoes.

Embryo microinjection techniques are essential for many molecular and genetic studies of insect species. They provide a means to introduce exogenous DNA ...