The authors would like to acknowledge Xiaofei Chen for providing the young rice inflorescences and assistance in making the rice tissue culture medium. This work was supported by the National Natural Science Foundation of China (31900611).

1. sgRNA-CAS9 plant expression vector construction and Agrobacterium-mediated transformation
<ol>
	<li>Target a male sterile gene OsABCG15 in rice according to the published literature28.</li>
	<li>Design sgRNA for the targeted site located between 106&#8211;125 bp in the second exon of OsABCG15 (Figure 1).</li>
	<li>Use T4 polynucleotide kinase to synthesize the sgRNA oligos (sgR-OsABCG15-F: 5&#8217;TGGCAAGCACATCCTCAAGGGGAT3&#8217; and 5&#8217;sgR-OsABCG15-R: AAACATCCCCTTGAGGATGTGCTT&#8217;).</li>
	<li>Use endonuclease BbsI to digest the psgR-Cas9 backbone vector29.</li>
	<li>Ligate the synthesized sgRNA oligos with linearized psgR-Cas9 backbone using T4 ligase following the manufacturer&#8217;s protocol.</li>
	<li>Using HindIII/EcoRI, digest the sgRNA cassette from step 1.5 and subclone into the HindIII/EcoRI site of the pCAMBIA1300 binary vector for stable transformation29.</li>
	<li>Confirm the constructed plasmid by enzyme digestion and sequencing. Later, transform the binary construct into the Agrobacterium tumefaciens strain EHA105 and grow them on Kan/Rif selection plates at 28 &#176;C for 2&#8211;3 days.</li>
</ol>
2. Rice genetic transformation and plant tissue culture
<ol>
	<li>Callus induction and regeneration 
	NOTE: Use fresh young rice inflorescences as the starting material to induce callus (Figure 2).
	<ol>
		<li>Collect the young inflorescences from the paddy field or green house at meiosis stage, determined by floret length of 1.6-4.8 mm (Figure 2A)29. Ensure that the rice inflorescences are covered with leaf sheath. Wipe each inflorescence with a 70% alcohol swab and let it dry before cutting.</li>
		<li>Bring the inflorescence to a clean sterile bench. Cut it into small pieces (the smaller the better) with sterilized scissors and then transfer cuttings to a Petri plate containing NBD2 medium (Figure 2B, Table 1).</li>
		<li>Incubate the plate in the dark at 26 &#176;C for about 10-14 days to induce callus (Figure 3A). 
		NOTE: Use the newly formed callus for Agrobacterium infiltration (step 2.2.7) directly or recondition one more time in fresh NBD2 medium to obtain more callus. Transfer the callus into the new NBD2 medium every 8&#8211;10 days.</li>
	</ol>
	</li>
	<li>Transformation and co-cultivation
	<ol>
		<li>Use A. tumefaciens bacteria containing the binary plasmid from step 1.6 for transformation. Store the A. tumefaciens strains in YEB medium (Table 1) with 50% glycerol at -80 &#176;C for further use.</li>
		<li>Streak A. tumefaciens from a -80 &#176;C glycerol stock to YEB agar medium containing selective antibiotics (Table 1) and grow at 25&#8211;28 &#730;C for 48&#8211;72 h, to allow colonies to appear.</li>
		<li>Inoculate a single colony from the YEB plate with selective antibiotics to 5 mL of liquid YEB medium containing the same selective antibiotics (Table 1), in a 50 mL conical sterile test tube. Shake on an orbital shaker at 250 x g, at 25&#8211;28 &#176;C until bacteria grow to an OD600 of 0.5.</li>
		<li>Add 1 mL of bacterial suspension to 100 mL of YEB medium (Table 1) with the same selective antibiotics in a 250 mL conical flask and shake on an orbital shaker at 250 x g, at 28 &#176;C for 4 h.</li>
		<li>Centrifuge at 4,000 x g for 10 min at room temperature to collect bacteria. Discard the supernatant.</li>
		<li>Resuspend the bacterial pellet with AAM-AS medium (Table 1) and dilute the suspension to an OD600 = 0.4. 
		NOTE: The perfect OD of bacterial suspension is critical for efficient transformation. It helps in eliminating excess bacterial growth on the callus.</li>
		<li>Collect around 150 healthy growing light-yellow fragile embryogenic calli from step 2.1.3 into a 150 mL sterile flask. Add 50&#8211;75 mL bacterial cell suspension from step 2.2.6 into the sterile flask, and then add some 10&#8211;25 mL fresh AAM-AS medium to immerse the calli for 10&#8211;20 min, shaking occasionally.</li>
		<li>Pour out the bacterial suspension from the flask carefully and dry the excess bacterial suspension from the callus using sterile filter paper #1 or tissue paper. Then place them on a Petri dish with NBD-AS medium (Table 1) covered with a sterile filter paper #1. Incubate at 25&#8211;28 &#176;C in the dark for 3 days and check for bacterial overgrowth.</li>
	</ol>
	</li>
	<li>Selection for resistant callus
	<ol>
		<li>After 3 days of co-cultivation, transfer the calli to a sterile Petri dish with a sterile filter paper.</li>
		<li>Air-dry the calli for 2 h on a clean bench. Ensure that the callus is not adhered to the filter paper.</li>
		<li>Transfer the calli evenly using sterile tweezer to the primary selection medium NBD2 (with 40 mg/L hygromycin and 250 mg/L timentin) (Table 1). Culture calli for 2 weeks at 25&#8211;28 &#176;C in the dark.</li>
		<li>After 2 weeks, transfer calli evenly to a new plate containing fresh selection medium NBD2 (with 40 mg/L hygromycin and 250 mg/L timentin) (Table 1). Culture the calli for another 2 weeks at 25&#8211;28 &#176;C in the dark.</li>
	</ol>
	</li>
	<li>Callus differentiation
	<ol>
		<li>Transfer callus to fresh MS Medium (with 25 mg/L hygromycin and 150 mg/L timentin) (Table 1). Culture under the light at 25&#8211;28 &#176;C for around 2 weeks.</li>
		<li>Repeat step 2.4.1 one more time.</li>
		<li>Transfer the shoot buds to the new MS medium (with 10 mg/L hygromycin) to proliferate more shoots.</li>
	</ol>
	</li>
	<li>Root induction
	<ol>
		<li>Transfer the new shoots into &#189; MS medium (Table 1). Culture under the light at 25 &#176;C - 28 &#176;C. The transformed plants produce roots within 2 weeks.</li>
		<li>After 1 week, transfer the plants to clean pots covering the plant to prevent dehydration.</li>
	</ol>
	</li>
</ol>
3. Genotype identification
<ol>
	<li>Collect young leaves from newly generated plants for total DNA extraction using the cetyltrimethyl ammonium bromide (CTAB) method31.</li>
	<li>Using the genomic DNA as template, choose the primers (Hygromycin-F: 5&#8217; GATGTTGGCGACCTCGTATT 3&#8217; and Hygromycin-R: 5&#8217; CGAAGAATCTCGTGCTTTCA 3&#8217; located in the Hygromycin region) to perform polymerase chain reaction (PCR) to validate the transgene integration and frequencies (Figure 4). The following PCR conditions: 94 &#176;C for 5 min; 36 cycles (94 &#176;C for 30 s; 56 &#176;C for 30 s; 72 &#176;C for 1 min ); 72 &#176;C for 7 min. Successful PCR reactions yield a 604 bp amplicon.</li>
	<li>Perform another PCR to amplify the genomic region surrounding the CRISPR target sites using specific primers (OsABCG15-ID-F: 5&#8217; GTCTCATTGCTCAACAGTTTCT 3&#8217; and OsABCG15-ID-R: 5&#8217; TTGGTGTTTAAAACATTGCTAT 3&#8217;) to identify the genotype of the transformants. The PCR conditions are the same as in step 3.2.</li>
	<li>Use PCR fragments from step 3.3 directly for Sanger sequencing to identify mutations.</li>
</ol>
4. Observe the basic phenotype of the mutant
<ol>
	<li>Prepare the I2-KI solution: dissolve 2 g of KI (potassium iodide) in 10 mL of distilled water and then add 0.2 g of I2 (resublimed iodine) in it. After mixing, bring the total volume to 100 mL with distilled water.</li>
	<li>Prepare the FAA solution (63% anhydrous ethanol, 5% glacial acetic acid, 5% formaldehyde and 27% water) and mix before using.</li>
	<li>Prepare the 0.5% Toluidine blue staining solution: dissolve 0.5 g of Toluidine blue in 100 mL of distilled water.</li>
	<li>Perform vegetative phenotypic observation, by imaging the whole plants with a digital camera.</li>
	<li>Perform reproductive phenotype observation, remove the palea and lemma from the floret. Take photos of whole anthers under a stereomicroscope.</li>
	<li>Observe the pollen viability by iodine staining.
	<ol>
		<li>Pick mature rice spikelets before the flower anthesis, remove the palea and lemma to release the anthers.</li>
		<li>Take 6 anthers and place them on a glass slide. Add 1 drop of distilled water, crush the anther well with tweezers to release the pollen grains, and then add 2&#8211;3 drops of I2-KI solution. Cover with the coverslip.</li>
		<li>Observe under a low magnification microscope. Pollen grains dyed black show more vigorous viability, no color or yellow-brown dyed are stunted or degenerated.</li>
	</ol>
	</li>
	<li>Perform a semi-thin section of rice anther
	<ol>
		<li>Fix the rice flowers from different developmental stages into an FAA solution. Vacuum the materials at 4 &#176;C (generally 15 min) to allow the fixative to penetrate to the tissues until the material sinks to the bottom of the collection bottle.</li>
		<li>Replace with a new FAA solution the next day. Once the material sinks to the bottom, replace with 70% ethanol and store at 4 &#176;C for long-term use.</li>
		<li>Dehydrate the materials with different gradients of ethanol (70%, 80%, 95% each time for 30 min, 100% ethanol for 2 h, 100% ethanol containing a little of Safranin dye for 2 h). 
		NOTE: Add a little of Safranin dye into the second 100% ethanol to color the anthers for easier sectioning afterwards.</li>
		<li>Perform embedding by following the manufacturer&#8217;s instruction (Table of Materials). Then, bake in an oven at 60 &#176;C for 48 h before sectioning.</li>
		<li>Section the sample to a thickness of 2 &#956;m using a microtome. Add a drop of water on the glass slide. Then, pick up the thin sections containing anther blocks by forceps and put them onto the surface of the water drop on the slides.</li>
		<li>Place the slides on the water bath at 50 &#176;C to completely spread the sections to let it firmly adhere to the slide.</li>
		<li>Use 0.5% toluidine blue solution stain the slides for 30 min. Then, rinse with water and dry in the fume hood. Seal with neutral tree glue. Gently place a coverslip on the slide and dry in the fume hood.</li>
		<li>Observe and photograph the sample under a microscope.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Izawa, T., Shimamoto, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Becoming+a+model+plant:+The+importance+of+rice+to+plant+science.">Becoming a model plant: The importance of rice to plant science.</a> Trends in Plant Science. 1 (3), 95-99 (1996).</li><li>Shimamoto, K., Kyozuka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+as+a+model+for+comparative+genomics+of+plants.">Rice as a model for comparative genomics of plants.</a> Annual Review of Plant Biology. 53 (1), 399-419 (2002).</li><li>Selva, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybrid+breeding+in+wheat:+how+shaping+floral+biology+can+offer+new+perspectives.">Hybrid breeding in wheat: how shaping floral biology can offer new perspectives.</a> Functional Plant Biology. 47 (8), 675-694 (2020).</li><li>Lippman, Z. B., Zamir, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterosis:+revisiting+the+magic.">Heterosis: revisiting the magic.</a> Trends in Genetics. 23 (2), 60-66 (2007).</li><li>Zhang, D., Liang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+food+security:+using+male+fertility+for+hybrid+seed+breeding.">Improving food security: using male fertility for hybrid seed breeding.</a> Science. , 45-48 (2016).</li><li>Masters, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-Mediated+Immature+Embryo+Transformation+of+Recalcitrant+Maize+Inbred+Lines+Using+Morphogenic+Genes.">Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes.</a> Journal of Visualized Experiments. (156), e60782 (2020).</li><li>Laurenceau, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+type+IV+pilus+mediates+DNA+binding+during+natural+transformation+in+Streptococcus+pneumoniae.">A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.</a> PLoS Pathogens. 9 (6), 1003473 (2013).</li><li>Tzfira, T., Citovsky, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+genetic+transformation+of+plants:+biology+and+biotechnology.">Agrobacterium-mediated genetic transformation of plants: biology and biotechnology.</a> Current Opinion in Biotechnology. 17 (2), 147-154 (2006).</li><li>Gelvin, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+in+the+genomics+age.">Agrobacterium in the genomics age.</a> Plant Physiology. 150 (4), 1665-1676 (2009).</li><li>Lacroix, B., Citovsky, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+roles+of+bacterial+and+host+plant+factors+in+Agrobacterium-mediated+genetic+transformation.">The roles of bacterial and host plant factors in Agrobacterium-mediated genetic transformation.</a> International Journal of Developmental Biology. 57, 467-481 (2013).</li><li>Hiei, Y., Komari, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+rice+using+immature+embryos+or+calli+induced+from+mature+seed.">Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed.</a> Nature Protocols. 3 (5), 824 (2008).</li><li>Hiei, Y., Ohta, S., Komari, T., Kumashiro, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+rice+(Oryza+sativa+L.)+mediated+by+Agrobacterium+and+sequence+analysis+of+the+boundaries+of+the+T-DNA.">Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.</a> The Plant Journal. 6 (2), 271-282 (1994).</li><li>Hiei, Y., Komari, T., Kubo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+rice+mediated+by+Agrobacterium+tumefaciens.">Transformation of rice mediated by Agrobacterium tumefaciens.</a> Plant Molecular Biology. 35 (1-2), 205-218 (1997).</li><li>Nishimura, A., Aichi, I., Matsuoka, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+Agrobacterium-mediated+transformation+in+rice.">A protocol for Agrobacterium-mediated transformation in rice.</a> Nature Protocols. 1 (6), 2796 (2006).</li><li>Yara, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+transgenic+japonica+rice+(Oryza+sativa)+cultivar,+Taichung+65,+by+the+Agrobacterium-mediated+method.">Production of transgenic japonica rice (Oryza sativa) cultivar, Taichung 65, by the Agrobacterium-mediated method.</a> Plant Biotechnology. 18 (4), 305-310 (2001).</li><li>Cho, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+Korean+rice+cultivars+(Oryza+sativa+L.)+mediated+by+Agrobacterium+tumefaciens.">Efficient transformation of Korean rice cultivars (Oryza sativa L.) mediated by Agrobacterium tumefaciens.</a> Journal of Plant Biology. 41 (4), 262-268 (1998).</li><li>Toki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+efficient+Agrobacterium-mediated+transformation+in+rice.">Rapid and efficient Agrobacterium-mediated transformation in rice.</a> Plant Molecular Biology Reporter. 15, 16-21 (1997).</li><li>Zhang, J., Xu, R. j., Elliott, M. C., Chen, D. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+elite+indica+and+japonica+rice+cultivars.">Agrobacterium-mediated transformation of elite indica and japonica rice cultivars.</a> Molecular Biotechnology. 8 (3), 223-231 (1997).</li><li>Aldemita, R. R., Hodges, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+tumefaciens-mediated+transformation+of+japonica+and+indica+rice+varieties.">Agrobacterium tumefaciens-mediated transformation of japonica and indica rice varieties.</a> Planta. 199 (4), 612-617 (1996).</li><li>Rashid, H., Yokoi, S., Toriyama, K., Hinata, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+plant+production+mediated+by+Agrobacterium+in+indica+rice.">Transgenic plant production mediated by Agrobacterium in indica rice.</a> Plant Cell Reports. 15 (10), 727-730 (1996).</li><li>Sahoo, K. K., Tripathi, A. K., Pareek, A., Sopory, S. K., Singla-Pareek, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+protocol+for+efficient+transformation+and+regeneration+of+diverse+indica+rice+cultivars.">An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars.</a> Plant Methods. 7 (1), 49 (2011).</li><li>Rachmawati, D., Hosaka, T., Inoue, E., Anzai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Javanica+rice+cv.+Rojolele.">Agrobacterium-mediated transformation of Javanica rice cv. Rojolele.</a> Bioscience, Biotechnology, and Biochemistry. 68 (6), 1193-1200 (2004).</li><li>Dong, J., Teng, W., Buchholz, W. G., Hall, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Javanica+rice.">Agrobacterium-mediated transformation of Javanica rice.</a> Molecular Breeding. 2 (3), 267-276 (1996).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+japonica+photo-sensitive+genic+male+sterile+rice+lines+by+editing+carbon+starved+anther+using+CRISPR/Cas9.">Development of japonica photo-sensitive genic male sterile rice lines by editing carbon starved anther using CRISPR/Cas9.</a> Journal of Genetics and Genomics. 43 (6), 415 (2016).</li><li>Qin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ABCG15+encodes+an+ABC+transporter+protein,+and+is+essential+for+Post-Meiotic+anther+and+pollen+exine+development+in+rice.">ABCG15 encodes an ABC transporter protein, and is essential for Post-Meiotic anther and pollen exine development in rice.</a> Plant and Cell Physiology. 54, (2013).</li><li>Mao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+CRISPR-Cas+system+for+efficient+genome+engineering+in+plants.">Application of the CRISPR-Cas system for efficient genome engineering in plants.</a> Molecular Plant. 6 (6), 2008-2011 (2013).</li><li>Itoh, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+plant+development:+from+zygote+to+spikelet.">Rice plant development: from zygote to spikelet.</a> Plant and Cell Physiology. 46 (1), 23-47 (2005).</li><li>Gawel, N. J., Jarret, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+CTAB+DNA+extraction+procedure+forMusa+andIpomoea.">A modified CTAB DNA extraction procedure forMusa andIpomoea.</a> Plant Molecular Biology Reporter. 9 (3), 262-266 (1991).</li><li>Wei, F. J., Droc, G., Guiderdoni, E., Hsing, Y. i. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=International+Consortium+of+Rice+Mutagenesis:+resources+and+beyond.">International Consortium of Rice Mutagenesis: resources and beyond.</a> Rice. 6 (1), 39 (2013).</li><li>Feng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+editing+in+plants+using+a+CRISPR/Cas+system.">Efficient genome editing in plants using a CRISPR/Cas system.</a> Cell Research. 23 (10), 1229 (2013).</li></ol>

Artificial genic male sterile mutants are traditionally generated by random physical, chemical, or biological mutagenesis. Although these are powerful techniques, their random nature fails to capitalize on the vast amount of modern genomic knowledge that has the potential to deliver tailored improvements in molecular breeding32. The CRISPR-Cas9 system has been widely used in plants due to its simple and affordable means to manipulate and edit DNA29,<sup class="xr...

Rice is the most important food crop, particularly in developing countries, and represents a staple food for over half of the world&#8217;s population. Overall, the demand for rice grain is growing and is projected to increase 50% by 2030 and 100% by 20501,2. Future improvements in rice yield will need to capitalize on diverse molecular and genetic resources that make rice an excellent model for monocotyledonous plant research. These include an efficient transformation system, advanced molecular map, and publicly accessible database of expressed sequence tags, which have been generated over many years3,4. One strategy to improve crop yield is hybrid seed production5, a central element of which is the ability to manipulate male fertility. Understanding the molecular control of male fertility in cereal crops can help to translate key knowledge into practical techniques to improve hybrid seed production and enhance crop productivity6,7.
Genetic transformation is a key tool for basic research and commercial agriculture since it enables introduction of foreign genes or manipulation of endogenous genes in crop plants, and results in the generation of genetically modified lines. An appropriate transformation protocol can help to accelerate genetic and molecular biology studies for fundamental understanding of gene regulation8. In bacteria, genetic transformation takes place naturally; however, in plants, it is performed artificially using molecular biology techniques9,10. Agrobacterium tumefaciens is a soil-borne, Gram-negative bacterium that causes crown gall disease in plants by transferring T-DNA, a region of its Ti plasmid, into the plant cell via a type IV secretion system11,12. In plants, A. tumefaciens-mediated transformation is considered a widespread method for gene modification because it leads to stable and low copy number integration of T-DNA into the host genome13. Transgenic rice was first generated through Agrobacterium-mediated gene transformation in the mid-1990s in the japonica cultivar14. Using this protocol, several transgenic lines were obtained within a period of 4 months with a transformation efficiency of 10%&#8211;30%. The study indicated that there are two critical steps for the successful transformation: one is the induction of embryogenic callus from mature seeds and another is the addition of acetosyringone, a phenolic compound, to the bacterial culture during co-cultivation, which allows for higher transformation efficiency in plants14,15. This protocol has been extensively used with minor alterations in japonica16,17,18,19 as well as other cultivars such as indica20,21,22,23 and tropical japonica24,25. Indeed, over 80% of the articles describing rice transformation use Agrobacterium-mediated gene transformation as a tool13. To date, several genetic transformation protocols have been developed using rice seed as a starting material for callus induction16,17,18,19. However, very little is known about young inflorescence as explants for callus production. Overall, it is important to establish a rapid, reproducible, and efficient gene transformation and regeneration protocol for functional genomics and studies on crop improvement.
In recent years, the advancement of CRISPR-Cas9 technology has resulted in a precise genome editing mechanism to understand gene function and deliver agronomically important improvements for plant breeding26,27. CRISPR also offers considerable promise for the manipulation of male reproductive development and hybrid production. In this study, we utilized a gene knockout system using CRISPR-Cas9 technology and coupled it to an efficient rice gene transformation protocol using young inflorescences as explants, thereby creating stable male sterile lines for the study of reproductive development.

<table><tbody><tr><td>1-Naphthaleneacetic acid</td><td>Sigma-Aldrich</td><td>N0640</td><td></td></tr><tr><td>2, 4-Dichlorophenoxyacetic Acid</td><td>Sigma-Aldrich</td><td>D7299</td><td></td></tr><tr><td>6-Benzylaminopurine (6-BA)</td><td>Sigma-Aldrich</td><td>B3408</td><td></td></tr><tr><td>Acetosyringone</td><td>Sigma-Aldrich</td><td>D134406</td><td></td></tr><tr><td>Agar</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10000561</td><td></td></tr><tr><td>Ammonium sulfate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10002918</td><td></td></tr><tr><td>Aneurine hydrochloride</td><td>Sigma-Aldrich</td><td>T4625</td><td></td></tr><tr><td>Anhydrous ethanol</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10009218</td><td></td></tr><tr><td>Bacteriological peptone</td><td>Sangon Biotech</td><td>A100636</td><td></td></tr><tr><td>Beef extract</td><td>Sangon Biotech</td><td>A600114</td><td></td></tr><tr><td>Boric acid</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10004808</td><td></td></tr><tr><td>Calcium chloride dihydrate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>20011160</td><td></td></tr><tr><td>Casein acid hydrolysate</td><td>Beijing XMJ Scientific Co., Ltd</td><td>C184</td><td></td></tr><tr><td>Cobalt(II) chloride hexahydrate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10007216</td><td></td></tr><tr><td>Copper(II) sulfate pentahydrate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10008218</td><td></td></tr><tr><td>D(+)-Glucose anhydrous</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>63005518</td><td></td></tr><tr><td>D-sorbitol</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>63011037</td><td></td></tr><tr><td>EDTA, Disodium Salt, Dihydrate</td><td>Sigma-Aldrich</td><td>E5134</td><td></td></tr><tr><td>EOS Digital SLR and Compact System Cameras</td><td>Canon</td><td>EOS 700D</td><td></td></tr><tr><td>Formaldehyde</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10010018</td><td></td></tr><tr><td>Fully Automated Rotary Microtome</td><td>Leica Biosystems</td><td>Leica RM 2265</td><td></td></tr><tr><td>Glacial acetic acid</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10000208</td><td></td></tr><tr><td>Glycine</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>62011516</td><td></td></tr><tr><td>Hygromycin</td><td>Beijing XMJ Scientific Co., Ltd</td><td>H370</td><td></td></tr><tr><td>Inositol</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>63007738</td><td></td></tr><tr><td>Iodine</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10011517</td><td></td></tr><tr><td>Iron(II) sulfate heptahydrate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10012116</td><td></td></tr><tr><td>Kanamycine</td><td>Beijing XMJ Scientific Co., Ltd</td><td>K378</td><td></td></tr><tr><td>Kinetin</td><td>Sigma-Aldrich</td><td>K0753</td><td></td></tr><tr><td>L-Arginine</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>62004034</td><td></td></tr><tr><td>L-Aspartic acid</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>62004736</td><td></td></tr><tr><td>L-Glutamine</td><td>Beijing XMJ Scientific Co., Ltd</td><td>G229</td><td></td></tr><tr><td>L-proline</td><td>Beijing XMJ Scientific Co., Ltd</td><td>P698</td><td></td></tr><tr><td>Magnesium sulfate heptahydrate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10013018</td><td></td></tr><tr><td>Manganese sulfate monohydrate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10013418</td><td></td></tr><tr><td>Microscopes</td><td>NIKON</td><td>Eclipse 80i</td><td></td></tr><tr><td>MS</td><td>Phytotech</td><td>M519</td><td></td></tr><tr><td>Nicotinic acid</td><td>Sigma-Aldrich</td><td>N0765</td><td></td></tr><tr><td>Phytagel</td><td>Sigma-Aldrich</td><td>P8169</td><td></td></tr><tr><td>Potassium chloride</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10016308</td><td></td></tr><tr><td>Potassium dihydrogen phosphate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10017608</td><td></td></tr><tr><td>Potassium iodide</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10017160</td><td></td></tr><tr><td>Potassium nitrate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>1001721933</td><td></td></tr><tr><td>Pyridoxine Hydrochloride (B6)</td><td>Sigma-Aldrich</td><td>47862</td><td></td></tr><tr><td>Rifampicin</td><td>Beijing XMJ Scientific Co., Ltd</td><td>R501</td><td></td></tr><tr><td>Sodium hydroxide</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10019718</td><td></td></tr><tr><td>Sodium molybdate dihydrate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10019816</td><td></td></tr><tr><td>Stereo microscopes</td><td>Leica Microsystems</td><td>Leica M205 A</td><td></td></tr><tr><td>Sucrose</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10021418</td><td></td></tr><tr><td>Technovit embedding Kits 7100</td><td>Heraeus Teknovi, Germany</td><td>14653</td><td></td></tr><tr><td>Timentin</td><td>Beijing XMJ Scientific Co., Ltd</td><td>T869</td><td></td></tr><tr><td>Toluidine Blue O</td><td>Sigma-Aldrich</td><td>T3260</td><td></td></tr><tr><td>Water bath for paraffin sections</td><td>Leica Biosystems</td><td>Leica HI1210</td><td></td></tr><tr><td>Yeast extract</td><td>Sangon Biotech</td><td>A515245</td><td></td></tr><tr><td>Zinc sulfate heptahydrate</td><td>Sinopharm Chemical Reagent Co., Ltd</td><td>10024018</td><td></td></tr></tbody></table>

agrobacterium-mediated genetic transformation, transgenic production, and its application for the study of male reproductive development in rice

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive organs/gametes. Recent advances in CRISPR-Cas9 genome editing technology allow for high editing efficacy and timesaving knockout mutations of endogenous candidate genes at specific sites. Additionally, Agrobacterium-mediated genetic transformation of rice is also a key method for gene modification, which has been widely adopted by many public and private laboratories. In this study, we applied CRISPR-Cas9 genome editing tools and successfully generated three male sterile mutant lines by targeted genome editing of OsABCG15 in a japonica cultivar. We used a modified Agrobacterium-mediated rice transformation method that could provide excellent means of genetic emasculation for hybrid seed production in rice. Transgenic plants can be obtained within 2&#8211;3 months and homozygous transformants were screened by genotyping using PCR amplification and Sanger sequencing. Basic phenotypic characterization of the male sterile homozygous line was performed by microscopic observation of the rice male reproductive organs, pollen viability analysis by iodine potassium iodide (I2-KI) staining semi-thin cross-sectioning of developing anthers.

Demonstrated here is the use of gene editing technology to create a male sterile line for future research by Agrobacterium-mediated genetic transformation in rice. To create the male sterile line of osabcg15, CRISPR-CAS9-mediated mutagenesis was used for binary vector construction. The sgRNA was driven by the OsU3 promoter, whereas the expression cassette of hSpCas9 was driven by the double 35S promoter, and the middle vector was assembled in a single binary vector pCAMBIA1300 designed for ...

Watch this Scientific Journal Video about Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice at JoVE.com

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

This work describes the use of CRISPR-Cas9 genome editing technology to knockout endogenous gene OsABCG15 followed by a modified Agrobacterium-mediated transformation protocol to produce a stable male-sterile line in rice.

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive ...

agrobacterium-mediated-genetic-transformation-transgenic-production

Research

JoVE Journal

Biology

12.3K Views.  Shanghai Jiao Tong University. Jonge bloeiwijzen als explant voor de productie van kalen zijn belangrijk voor het vaststellen van een snelle en efficiënte gentransformatie en een regeneratiemethode voor het onthullen van de genfunctie en voor gewasverbetering. Jonge bloeiwijzen als explant voor de productie van kalen zijn belangrijk voor het vaststellen van een snelle en efficiënte gentransformatie en de regeneratiemethode voor het onthullen van de genfunctie. Video demonstratie van deze techniek zal helpen de kijker beg...

Video: Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Testing Visual Sensitivity to the Speed and Direction of Motion in Lizards

Testing visual sensitivity in any species provides basic information regarding behaviour, evolution, and ecology. However, testing specific features of the visual system provide more empirical evidence for functional applications. Investigation into the sensory system provides information about the sensory capacity, learning and memory ability, and establishes known baseline behaviour in which to gauge deviations (Burghardt, 1977). However, unlike mammalian or avian systems, testing for learning and memory in a reptile species is difficult. Furthermore, using an operant paradigm as a psychophysical measure of sensory ability is likewise as difficult. Historically, reptilian species have responded poorly to conditioning trials because of issues related to motivation, physiology, metabolism, and basic biological characteristics. Here, I demonstrate an operant paradigm used a novel model lizard species, the Jacky dragon (Amphibolurus muricatus) and describe how to test peripheral sensitivity to salient speed and motion characteristics. This method uses an innovative approach to assessing learning and sensory capacity in lizards. I employ the use of random-dot kinematograms (RDKs) to measure sensitivity to speed, and manipulate the level of signal strength by changing the proportion of dots moving in a coherent direction. RDKs do not represent a biologically meaningful stimulus, engages the visual system, and is a classic psychophysical tool used to measure sensitivity in humans and other animals. Here, RDKs are displayed to lizards using three video playback systems. Lizards are to select the direction (left or right) in which they perceive dots to be moving. Selection of the appropriate direction is reinforced by biologically important prey stimuli, simulated by computer-animated invertebrates.

Testing visual sensitivity in lizards using an operant conditioning paradigm that employs video playback of random-dot kinematograms and computer-generated invertebrates.

Testing visual sensitivity in any species provides basic information regarding behaviour, evolution, and ecology. However, testing specific features of ...

Inducible, Cell Type-Specific Expression in Arabidopsis thaliana Through LhGR-Mediated Trans-Activation

Inducible, tissue-specific expression is an important and powerful tool to study the spatio-temporal dynamics of genetic perturbation. Combining the flexible and efficient GreenGate cloning system with the proven and benchmarked LhGR system (here termed GR-LhG4) for the inducible expression, we have generated a set of transgenic Arabidopsis lines that can drive the expression of an effector cassette in a range of specific cell types in the three main plant meristems. To this end, we chose the previously developed GR-LhG4 system based on a chimeric transcription factor and a cognate pOp-type promoter ensuring tight control over a wide range of expression levels. In addition, to visualize the expression domain where the synthetic transcription factor is active, an ER-localized mTurquoise2 fluorescent reporter under control of the pOp4 or pOp6 promoter is encoded in driver lines. Here, we describe the steps necessary to generate a driver or effector line and demonstrate how cell type specific expression can be induced and followed in the shoot apical meristem, the root apical meristem and the cambium of Arabidopsis. By using several or all driver lines, the context specific effect of expressing one or multiple factors (effectors) under control of the synthetic pOp promoter can be assessed rapidly, for example in F1 plants of a cross between one effector and multiple driver lines. This approach is exemplified by the ectopic expression of VND7, a NAC transcription factor capable of inducing ectopic secondary cell wall deposition in a cell autonomous manner.

Inducible, Cell Type-Specific Expression in Arabidopsis thaliana Through LhGR-Mediated Trans-Activation

Here, we describe the generation and application of a set of transgenic Arabidopsis thaliana lines enabling inducible, tissue-specific expression in the three main meristems, the shoot apical meristem, the root apical meristem, and the cambium.

Inducible, tissue-specific expression is an important and powerful tool to study the spatio-temporal dynamics of genetic perturbation. Combining the ...

Genetics

Agrobacterium tumefaciens and Agrobacterium rhizogenes-Mediated Transformation of Potato and the Promoter Activity of a Suberin Gene by GUS Staining

Agrobacterium sp. is one of the most widely used methods to obtain transgenic plants as it has the ability to transfer and integrate its own T-DNA into the plant&#39;s genome. Here, we present two transformation systems to genetically modify potato (Solanum tuberosum) plants. In A. tumefaciens transformation, leaves are infected, the transformed cells are selected and a new complete transformed plant is regenerated using phytohormones in 18 weeks. In A. rhizogenes transformation, stems are infected by injecting the bacteria with a needle, the new emerged transformed hairy roots are detected using a red fluorescent marker and the non-transformed roots are removed. In 5-6 weeks, the resulting plant is a composite of a wild type shoot with fully developed transformed hairy roots. To increase the biomass, the transformed hairy roots can be excised and self-propagated. We applied both Agrobacterium-mediated transformation methods to obtain roots expressing the GUS reporter gene driven by a suberin biosynthetic gene promoter. The GUS staining procedure is provided and allows the cell localization of the promoter induction. In both methods, the transformed potato roots showed GUS staining in the suberized endodermis and exodermis, and additionally, in A. rhizogenes transformed roots the GUS activity was also detected in the emergence of lateral roots. These results suggest that A. rhizogenes can be a fast alternative tool to study the genes that are expressed&#160;in roots.

Agrobacterium tumefaciens and Agrobacterium rhizogenes-Mediated Transformation of Potato and the Promoter Activity of a Suberin Gene by GUS Staining

Here, we present two protocols to transform potato plants. The Agrobacterium tumefaciens transformation leads to a complete transgenic plant while the Agrobacterium rhizogenes produces transgenic hairy roots in a wild type shoot that can be self-propagated. We then detect promoter activity by GUS staining in the transformed roots.

Agrobacterium sp. is one of the most widely used methods to obtain transgenic plants as it has the ability to transfer and integrate its own T-DNA into ...

Environment

The Ladder Rung Walking Task: A Scoring System and its Practical Application.

Progress in the development of animal models for/stroke, spinal cord injury, and other neurodegenerative disease requires tests of high sensitivity to elaborate distinct aspects of motor function and to determine even subtle loss of movement capacity. To enhance efficacy and resolution of testing, tests should permit qualitative and quantitative measures of motor function and be sensitive to changes in performance during recovery periods. The present study describes a new task to assess skilled walking in the rat to measure both forelimb and hindlimb function at the same time. Animals are required to walk along a horizontal ladder on which the spacing of the rungs is variable and is periodically changed. Changes in rung spacing prevent animals from learning the absolute and relative location of the rungs and so minimize the ability of the animals to compensate for impairments through learning. In addition, changing the spacing between the rungs allows the test to be used repeatedly in long-term studies. Methods are described for both quantitative and qualitative description of both fore- and hindlimb performance, including limb placing, stepping, co-ordination. Furthermore, use of compensatory strategies is indicated by missteps or compensatory steps in response to another limb&#x2019;s misplacement. 

The ladder rung walking task is a new test to assess skilled walking and measure both forelimb and hindlimb placing, stepping, and inter-limb co-ordination.

Progress in the development of animal models for/stroke, spinal cord injury, and other neurodegenerative disease requires tests of high sensitivity to ...

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an Agrobacterium rhizogenes mediated transformation system on pigeon pea. The stem is infected with A. rhizogenes carrying a binary vector, which induced callus after 7 days and adventitious roots 14 days later. The generated transgenic hairy root was identified by morphological analysis and a GFP reporter gene.To further illustrate the application range of this system, CcCIPK14 (Calcineurin B-like protein-interacting protein kinases) was transformed into pigeon pea using this transformation method. The transgenic plants were treated with jasmonic acid (JA) and abscisic acid (ABA), respectively, for the purpose of testing whether CcCIPK14 responds to those hormones. The results demonstrated that (1) exogenous hormones could significantly upregulate the expression levelof CcCIPK14, especially in CcCIPK14 over-expression (OE) plants; (2) the content of Genistein in CcCIPK14-OE lines was significantly higher than the control; (3) the expression level of two downstream key flavonoid synthase genes, CcHIDH1 and CcHIDH2, were up-regulated in the CcCIPK14-OE lines; and (4) the hairy root transgenic system can be used to study metabolically functional genes in non-model plants.

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

Here we present an efficient and stable transformation system for the functional analysis of the CcCIPK14 gene as an example, providing a technical basis for studying the metabolism of non-model plants.

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an ...

High-Efficiency Production of Transgenic Soybean Hairy Roots

Soybean Hairy Root Transformation for the Analysis of Gene Function

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with soil-borne microbes that form symbiosis to fix nitrogen and pathogens, which makes research involving soybean root genetics of prime importance to improve its agricultural production. The genetic transformation of soybean hairy roots (HRs) is mediated by the Agrobacterium rhizogenes strain NCPPB2659 (K599) and is an efficient tool for studying gene function in soybean roots, taking only 2 months from start to finish. Here, we provide a detailed protocol that outlines the method for overexpressing and silencing a gene of interest in soybean HRs. This methodology includes soybean seed sterilization, infection of cotyledons with K599, and the selection and harvesting of genetically transformed HRs for RNA isolation and, if warranted, metabolite analyses. The throughput of the approach is sufficient to simultaneously study several genes or networks and could determine the optimal engineering strategies prior to committing to long-term stable transformation approaches.

Author Spotlight: Soybean Hairy Root Transformation for the Analysis of Gene Function  

Here, we present a protocol for the high-efficiency production of transgenic soybean hairy roots.

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with ...

Bioengineering

CRISPR-Based Efficient Genome Editing for Resistant Starch in Rice Breeding

Breeding by Design for Functional Rice with Genome Editing Technologies

The conventional approaches to crop breeding, which rely predominantly on time-consuming and labor-intensive methods such as traditional hybridization and mutation breeding, face challenges in efficiently introducing targeted traits and generating diverse plant populations. Conversely, the emergence of genome editing technologies has ushered in a paradigm shift, enabling the precise and expedited manipulation of plant genomes to intentionally introduce desired characteristics. One of the most widespread editing tools is the CRISPR/Cas system, which has been used by researchers to study important biology-related problems. However, the precise and effective workflow of genome editing has not been well-defined in crop breeding. In this study, we demonstrated the entire process of breeding rice varieties enriched with high levels of resistant starch (RS), a functional trait that plays a crucial role in preventing diseases such as diabetes and obesity. The workflow encompassed several key steps, such as the selection of functional SBEIIb gene, designing the single-guide RNA (sgRNA), selecting an appropriate genome editing vector, determining the vector delivery method, conducting plant tissue culture, genotyping mutation and phenotypic analysis. Additionally, the time frame necessary for each stage of the process has been clearly demonstrated. This protocol not only streamlines the breeding process but also enhances the accuracy and efficiency of trait introduction, thereby accelerating the development of functional rice varieties.

Author Spotlight: Streamlining Rice Breeding with CRISPR/Cas for Obtaining Optimal Phenotypic and Agronomic Traits 

The protocol describes breeding resistant starch rice varieties by design using genome editing technologies in a precise, efficient, and technically simple way.

The conventional approaches to crop breeding, which rely predominantly on time-consuming and labor-intensive methods such as traditional hybridization and ...

Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes

Demonstrated here is a detailed protocol for Agrobacterium-mediated genetic transformation of maize inbred lines using morphogenic genes Baby boom (Bbm) and Wuschel2 (Wus2). Bbm is regulated by the maize phospholipid transferase gene (Pltp) promoter, and Wus2 is under the control of a maize auxin-inducible (Axig1) promoter. An Agrobacterium strain carrying these morphogenic genes on transfer DNA (T-DNA) and extra copies of Agrobacterium virulence (vir) genes are used to infect maize immature embryo explants. Somatic embryos form on the scutella of infected embryos and can be selected by herbicide resistance and germinated into plants. A heat-activated cre/loxP recombination system built into the DNA construct allows for removal of morphogenic genes from the maize genome during an early stage of the transformation process. Transformation frequencies of approximately 14%, 4%, and 4% (numbers of independent transgenic events per 100 infected embryos) can be achieved for W22, B73, and Mo17, respectively, using this protocol.

Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes

Plant morphogenic genes can be used to improve genetic transformation of recalcitrant genotypes. Described here is an Agrobacterium-mediated genetic transformation (QuickCorn) protocol for three important public maize inbred lines.

Demonstrated here is a detailed protocol for Agrobacterium-mediated genetic transformation of maize inbred lines using morphogenic genes Baby boom (Bbm) ...

Agrobacterium tumefaciens-Mediated Genetic Transformation of Narrowleaf Plantain

Species in the genus Plantago have several unique traits that have led to them being adapted as model plants in various fields of study. However, the lack of a genetic manipulation system prevents in-depth investigation of gene function, limiting the versatility of this genus as a model. Here, a transformation protocol is presented for Plantago lanceolata, the most commonly studied Plantago species. Using Agrobacterium tumefaciens-mediated transformation, 3 week-old roots of aseptically grown P. lanceolata plants were infected with bacteria, incubated for 2-3 days, and then transferred to a shoot induction medium with appropriate antibiotic selection. Shoots typically emerged from the medium after 1 month, and roots developed 1-4 weeks after the shoots were transferred to the root induction medium. The plants were then acclimated to a soil environment and tested for the presence of a transgene using the &#946;-glucuronidase (GUS) reporter assay. The transformation efficiency of the current method is ~20%, with two transgenic plants emerging per 10 root tissues transformed. Establishing a transformation protocol for narrowleaf plantain will facilitate the adoption of this plant as a new model species in various areas.

Agrobacterium tumefaciens-Mediated Genetic Transformation of Narrowleaf Plantain

Because of its versatile application as a model species in various fields of study, there is a need for a genetic transformation toolkit in narrowleaf plantain (Plantago lanceolata). Here, using Agrobacterium tumefaciens-mediated transformation, a protocol is presented that results in stable transgenic lines with a transformation efficiency of 20%.

Species in the genus Plantago have several unique traits that have led to them being adapted as model plants in various fields of study. However, the lack ...

Agrobacterium-Mediated Genetic Transformation: A Method to Genetically Transform the Rice Genome via Genetically Engineered Agrobacterium tumefaciens

Source: Xu, D., et al. <a href="https://www.jove.com/v/61665">Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice.</a> J. Vis. Exp. (2020).
In this video, we demonstrate genetic transformation of the rice genome using an Agrobacterium tumefaciens binary vector. This bacterium facilitates the transfer of a foreign DNA plasmid using Agrobacterium virulence proteins.

Agrobacterium-Mediated Genetic Transformation: A Method to Genetically Transform the Rice Genome via Genetically Engineered Agrobacterium tumefaciens

Source: Xu, D., et al. Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive ...

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Samenvatting

Meer video's verkennen