The authors would like to acknowledge Xiaofei Chen for providing the young rice inflorescences and assistance in making the rice tissue culture medium. This work was supported by the National Natural Science Foundation of China (31900611).

1. sgRNA-CAS9 plant expression vector construction and Agrobacterium-mediated transformation
<ol>
	<li>Target a male sterile gene OsABCG15 in rice according to the published literature28.</li>
	<li>Design sgRNA for the targeted site located between 106&#8211;125 bp in the second exon of OsABCG15 (Figure 1).</li>
	<li>Use T4 polynucleotide kinase to synthesize the sgRNA oligos (sgR-OsABCG15-F: 5&#8217;TGGCAAGCACATCCTCAAGGGGAT3&#8217; and 5&#8217;sgR-OsABCG15-R: AAACATCCCCTTGAGGATGTGCTT&#8217;).</li>
	<li>Use endonuclease BbsI to digest the psgR-Cas9 backbone vector29.</li>
	<li>Ligate the synthesized sgRNA oligos with linearized psgR-Cas9 backbone using T4 ligase following the manufacturer&#8217;s protocol.</li>
	<li>Using HindIII/EcoRI, digest the sgRNA cassette from step 1.5 and subclone into the HindIII/EcoRI site of the pCAMBIA1300 binary vector for stable transformation29.</li>
	<li>Confirm the constructed plasmid by enzyme digestion and sequencing. Later, transform the binary construct into the Agrobacterium tumefaciens strain EHA105 and grow them on Kan/Rif selection plates at 28 &#176;C for 2&#8211;3 days.</li>
</ol>
2. Rice genetic transformation and plant tissue culture
<ol>
	<li>Callus induction and regeneration 
	NOTE: Use fresh young rice inflorescences as the starting material to induce callus (Figure 2).
	<ol>
		<li>Collect the young inflorescences from the paddy field or green house at meiosis stage, determined by floret length of 1.6-4.8 mm (Figure 2A)29. Ensure that the rice inflorescences are covered with leaf sheath. Wipe each inflorescence with a 70% alcohol swab and let it dry before cutting.</li>
		<li>Bring the inflorescence to a clean sterile bench. Cut it into small pieces (the smaller the better) with sterilized scissors and then transfer cuttings to a Petri plate containing NBD2 medium (Figure 2B, Table 1).</li>
		<li>Incubate the plate in the dark at 26 &#176;C for about 10-14 days to induce callus (Figure 3A). 
		NOTE: Use the newly formed callus for Agrobacterium infiltration (step 2.2.7) directly or recondition one more time in fresh NBD2 medium to obtain more callus. Transfer the callus into the new NBD2 medium every 8&#8211;10 days.</li>
	</ol>
	</li>
	<li>Transformation and co-cultivation
	<ol>
		<li>Use A. tumefaciens bacteria containing the binary plasmid from step 1.6 for transformation. Store the A. tumefaciens strains in YEB medium (Table 1) with 50% glycerol at -80 &#176;C for further use.</li>
		<li>Streak A. tumefaciens from a -80 &#176;C glycerol stock to YEB agar medium containing selective antibiotics (Table 1) and grow at 25&#8211;28 &#730;C for 48&#8211;72 h, to allow colonies to appear.</li>
		<li>Inoculate a single colony from the YEB plate with selective antibiotics to 5 mL of liquid YEB medium containing the same selective antibiotics (Table 1), in a 50 mL conical sterile test tube. Shake on an orbital shaker at 250 x g, at 25&#8211;28 &#176;C until bacteria grow to an OD600 of 0.5.</li>
		<li>Add 1 mL of bacterial suspension to 100 mL of YEB medium (Table 1) with the same selective antibiotics in a 250 mL conical flask and shake on an orbital shaker at 250 x g, at 28 &#176;C for 4 h.</li>
		<li>Centrifuge at 4,000 x g for 10 min at room temperature to collect bacteria. Discard the supernatant.</li>
		<li>Resuspend the bacterial pellet with AAM-AS medium (Table 1) and dilute the suspension to an OD600 = 0.4. 
		NOTE: The perfect OD of bacterial suspension is critical for efficient transformation. It helps in eliminating excess bacterial growth on the callus.</li>
		<li>Collect around 150 healthy growing light-yellow fragile embryogenic calli from step 2.1.3 into a 150 mL sterile flask. Add 50&#8211;75 mL bacterial cell suspension from step 2.2.6 into the sterile flask, and then add some 10&#8211;25 mL fresh AAM-AS medium to immerse the calli for 10&#8211;20 min, shaking occasionally.</li>
		<li>Pour out the bacterial suspension from the flask carefully and dry the excess bacterial suspension from the callus using sterile filter paper #1 or tissue paper. Then place them on a Petri dish with NBD-AS medium (Table 1) covered with a sterile filter paper #1. Incubate at 25&#8211;28 &#176;C in the dark for 3 days and check for bacterial overgrowth.</li>
	</ol>
	</li>
	<li>Selection for resistant callus
	<ol>
		<li>After 3 days of co-cultivation, transfer the calli to a sterile Petri dish with a sterile filter paper.</li>
		<li>Air-dry the calli for 2 h on a clean bench. Ensure that the callus is not adhered to the filter paper.</li>
		<li>Transfer the calli evenly using sterile tweezer to the primary selection medium NBD2 (with 40 mg/L hygromycin and 250 mg/L timentin) (Table 1). Culture calli for 2 weeks at 25&#8211;28 &#176;C in the dark.</li>
		<li>After 2 weeks, transfer calli evenly to a new plate containing fresh selection medium NBD2 (with 40 mg/L hygromycin and 250 mg/L timentin) (Table 1). Culture the calli for another 2 weeks at 25&#8211;28 &#176;C in the dark.</li>
	</ol>
	</li>
	<li>Callus differentiation
	<ol>
		<li>Transfer callus to fresh MS Medium (with 25 mg/L hygromycin and 150 mg/L timentin) (Table 1). Culture under the light at 25&#8211;28 &#176;C for around 2 weeks.</li>
		<li>Repeat step 2.4.1 one more time.</li>
		<li>Transfer the shoot buds to the new MS medium (with 10 mg/L hygromycin) to proliferate more shoots.</li>
	</ol>
	</li>
	<li>Root induction
	<ol>
		<li>Transfer the new shoots into &#189; MS medium (Table 1). Culture under the light at 25 &#176;C - 28 &#176;C. The transformed plants produce roots within 2 weeks.</li>
		<li>After 1 week, transfer the plants to clean pots covering the plant to prevent dehydration.</li>
	</ol>
	</li>
</ol>
3. Genotype identification
<ol>
	<li>Collect young leaves from newly generated plants for total DNA extraction using the cetyltrimethyl ammonium bromide (CTAB) method31.</li>
	<li>Using the genomic DNA as template, choose the primers (Hygromycin-F: 5&#8217; GATGTTGGCGACCTCGTATT 3&#8217; and Hygromycin-R: 5&#8217; CGAAGAATCTCGTGCTTTCA 3&#8217; located in the Hygromycin region) to perform polymerase chain reaction (PCR) to validate the transgene integration and frequencies (Figure 4). The following PCR conditions: 94 &#176;C for 5 min; 36 cycles (94 &#176;C for 30 s; 56 &#176;C for 30 s; 72 &#176;C for 1 min ); 72 &#176;C for 7 min. Successful PCR reactions yield a 604 bp amplicon.</li>
	<li>Perform another PCR to amplify the genomic region surrounding the CRISPR target sites using specific primers (OsABCG15-ID-F: 5&#8217; GTCTCATTGCTCAACAGTTTCT 3&#8217; and OsABCG15-ID-R: 5&#8217; TTGGTGTTTAAAACATTGCTAT 3&#8217;) to identify the genotype of the transformants. The PCR conditions are the same as in step 3.2.</li>
	<li>Use PCR fragments from step 3.3 directly for Sanger sequencing to identify mutations.</li>
</ol>
4. Observe the basic phenotype of the mutant
<ol>
	<li>Prepare the I2-KI solution: dissolve 2 g of KI (potassium iodide) in 10 mL of distilled water and then add 0.2 g of I2 (resublimed iodine) in it. After mixing, bring the total volume to 100 mL with distilled water.</li>
	<li>Prepare the FAA solution (63% anhydrous ethanol, 5% glacial acetic acid, 5% formaldehyde and 27% water) and mix before using.</li>
	<li>Prepare the 0.5% Toluidine blue staining solution: dissolve 0.5 g of Toluidine blue in 100 mL of distilled water.</li>
	<li>Perform vegetative phenotypic observation, by imaging the whole plants with a digital camera.</li>
	<li>Perform reproductive phenotype observation, remove the palea and lemma from the floret. Take photos of whole anthers under a stereomicroscope.</li>
	<li>Observe the pollen viability by iodine staining.
	<ol>
		<li>Pick mature rice spikelets before the flower anthesis, remove the palea and lemma to release the anthers.</li>
		<li>Take 6 anthers and place them on a glass slide. Add 1 drop of distilled water, crush the anther well with tweezers to release the pollen grains, and then add 2&#8211;3 drops of I2-KI solution. Cover with the coverslip.</li>
		<li>Observe under a low magnification microscope. Pollen grains dyed black show more vigorous viability, no color or yellow-brown dyed are stunted or degenerated.</li>
	</ol>
	</li>
	<li>Perform a semi-thin section of rice anther
	<ol>
		<li>Fix the rice flowers from different developmental stages into an FAA solution. Vacuum the materials at 4 &#176;C (generally 15 min) to allow the fixative to penetrate to the tissues until the material sinks to the bottom of the collection bottle.</li>
		<li>Replace with a new FAA solution the next day. Once the material sinks to the bottom, replace with 70% ethanol and store at 4 &#176;C for long-term use.</li>
		<li>Dehydrate the materials with different gradients of ethanol (70%, 80%, 95% each time for 30 min, 100% ethanol for 2 h, 100% ethanol containing a little of Safranin dye for 2 h). 
		NOTE: Add a little of Safranin dye into the second 100% ethanol to color the anthers for easier sectioning afterwards.</li>
		<li>Perform embedding by following the manufacturer&#8217;s instruction (Table of Materials). Then, bake in an oven at 60 &#176;C for 48 h before sectioning.</li>
		<li>Section the sample to a thickness of 2 &#956;m using a microtome. Add a drop of water on the glass slide. Then, pick up the thin sections containing anther blocks by forceps and put them onto the surface of the water drop on the slides.</li>
		<li>Place the slides on the water bath at 50 &#176;C to completely spread the sections to let it firmly adhere to the slide.</li>
		<li>Use 0.5% toluidine blue solution stain the slides for 30 min. Then, rinse with water and dry in the fume hood. Seal with neutral tree glue. Gently place a coverslip on the slide and dry in the fume hood.</li>
		<li>Observe and photograph the sample under a microscope.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Izawa, T., Shimamoto, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Becoming+a+model+plant:+The+importance+of+rice+to+plant+science.">Becoming a model plant: The importance of rice to plant science.</a> Trends in Plant Science. 1 (3), 95-99 (1996).</li><li>Shimamoto, K., Kyozuka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+as+a+model+for+comparative+genomics+of+plants.">Rice as a model for comparative genomics of plants.</a> Annual Review of Plant Biology. 53 (1), 399-419 (2002).</li><li>Selva, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybrid+breeding+in+wheat:+how+shaping+floral+biology+can+offer+new+perspectives.">Hybrid breeding in wheat: how shaping floral biology can offer new perspectives.</a> Functional Plant Biology. 47 (8), 675-694 (2020).</li><li>Lippman, Z. B., Zamir, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterosis:+revisiting+the+magic.">Heterosis: revisiting the magic.</a> Trends in Genetics. 23 (2), 60-66 (2007).</li><li>Zhang, D., Liang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+food+security:+using+male+fertility+for+hybrid+seed+breeding.">Improving food security: using male fertility for hybrid seed breeding.</a> Science. , 45-48 (2016).</li><li>Masters, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-Mediated+Immature+Embryo+Transformation+of+Recalcitrant+Maize+Inbred+Lines+Using+Morphogenic+Genes.">Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes.</a> Journal of Visualized Experiments. (156), e60782 (2020).</li><li>Laurenceau, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+type+IV+pilus+mediates+DNA+binding+during+natural+transformation+in+Streptococcus+pneumoniae.">A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.</a> PLoS Pathogens. 9 (6), 1003473 (2013).</li><li>Tzfira, T., Citovsky, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+genetic+transformation+of+plants:+biology+and+biotechnology.">Agrobacterium-mediated genetic transformation of plants: biology and biotechnology.</a> Current Opinion in Biotechnology. 17 (2), 147-154 (2006).</li><li>Gelvin, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+in+the+genomics+age.">Agrobacterium in the genomics age.</a> Plant Physiology. 150 (4), 1665-1676 (2009).</li><li>Lacroix, B., Citovsky, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+roles+of+bacterial+and+host+plant+factors+in+Agrobacterium-mediated+genetic+transformation.">The roles of bacterial and host plant factors in Agrobacterium-mediated genetic transformation.</a> International Journal of Developmental Biology. 57, 467-481 (2013).</li><li>Hiei, Y., Komari, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+rice+using+immature+embryos+or+calli+induced+from+mature+seed.">Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed.</a> Nature Protocols. 3 (5), 824 (2008).</li><li>Hiei, Y., Ohta, S., Komari, T., Kumashiro, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+rice+(Oryza+sativa+L.)+mediated+by+Agrobacterium+and+sequence+analysis+of+the+boundaries+of+the+T-DNA.">Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.</a> The Plant Journal. 6 (2), 271-282 (1994).</li><li>Hiei, Y., Komari, T., Kubo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+rice+mediated+by+Agrobacterium+tumefaciens.">Transformation of rice mediated by Agrobacterium tumefaciens.</a> Plant Molecular Biology. 35 (1-2), 205-218 (1997).</li><li>Nishimura, A., Aichi, I., Matsuoka, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+Agrobacterium-mediated+transformation+in+rice.">A protocol for Agrobacterium-mediated transformation in rice.</a> Nature Protocols. 1 (6), 2796 (2006).</li><li>Yara, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+transgenic+japonica+rice+(Oryza+sativa)+cultivar,+Taichung+65,+by+the+Agrobacterium-mediated+method.">Production of transgenic japonica rice (Oryza sativa) cultivar, Taichung 65, by the Agrobacterium-mediated method.</a> Plant Biotechnology. 18 (4), 305-310 (2001).</li><li>Cho, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+Korean+rice+cultivars+(Oryza+sativa+L.)+mediated+by+Agrobacterium+tumefaciens.">Efficient transformation of Korean rice cultivars (Oryza sativa L.) mediated by Agrobacterium tumefaciens.</a> Journal of Plant Biology. 41 (4), 262-268 (1998).</li><li>Toki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+efficient+Agrobacterium-mediated+transformation+in+rice.">Rapid and efficient Agrobacterium-mediated transformation in rice.</a> Plant Molecular Biology Reporter. 15, 16-21 (1997).</li><li>Zhang, J., Xu, R. j., Elliott, M. C., Chen, D. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+elite+indica+and+japonica+rice+cultivars.">Agrobacterium-mediated transformation of elite indica and japonica rice cultivars.</a> Molecular Biotechnology. 8 (3), 223-231 (1997).</li><li>Aldemita, R. R., Hodges, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+tumefaciens-mediated+transformation+of+japonica+and+indica+rice+varieties.">Agrobacterium tumefaciens-mediated transformation of japonica and indica rice varieties.</a> Planta. 199 (4), 612-617 (1996).</li><li>Rashid, H., Yokoi, S., Toriyama, K., Hinata, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+plant+production+mediated+by+Agrobacterium+in+indica+rice.">Transgenic plant production mediated by Agrobacterium in indica rice.</a> Plant Cell Reports. 15 (10), 727-730 (1996).</li><li>Sahoo, K. K., Tripathi, A. K., Pareek, A., Sopory, S. K., Singla-Pareek, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+protocol+for+efficient+transformation+and+regeneration+of+diverse+indica+rice+cultivars.">An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars.</a> Plant Methods. 7 (1), 49 (2011).</li><li>Rachmawati, D., Hosaka, T., Inoue, E., Anzai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Javanica+rice+cv.+Rojolele.">Agrobacterium-mediated transformation of Javanica rice cv. Rojolele.</a> Bioscience, Biotechnology, and Biochemistry. 68 (6), 1193-1200 (2004).</li><li>Dong, J., Teng, W., Buchholz, W. G., Hall, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Javanica+rice.">Agrobacterium-mediated transformation of Javanica rice.</a> Molecular Breeding. 2 (3), 267-276 (1996).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+japonica+photo-sensitive+genic+male+sterile+rice+lines+by+editing+carbon+starved+anther+using+CRISPR/Cas9.">Development of japonica photo-sensitive genic male sterile rice lines by editing carbon starved anther using CRISPR/Cas9.</a> Journal of Genetics and Genomics. 43 (6), 415 (2016).</li><li>Qin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ABCG15+encodes+an+ABC+transporter+protein,+and+is+essential+for+Post-Meiotic+anther+and+pollen+exine+development+in+rice.">ABCG15 encodes an ABC transporter protein, and is essential for Post-Meiotic anther and pollen exine development in rice.</a> Plant and Cell Physiology. 54, (2013).</li><li>Mao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+CRISPR-Cas+system+for+efficient+genome+engineering+in+plants.">Application of the CRISPR-Cas system for efficient genome engineering in plants.</a> Molecular Plant. 6 (6), 2008-2011 (2013).</li><li>Itoh, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+plant+development:+from+zygote+to+spikelet.">Rice plant development: from zygote to spikelet.</a> Plant and Cell Physiology. 46 (1), 23-47 (2005).</li><li>Gawel, N. J., Jarret, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+CTAB+DNA+extraction+procedure+forMusa+andIpomoea.">A modified CTAB DNA extraction procedure forMusa andIpomoea.</a> Plant Molecular Biology Reporter. 9 (3), 262-266 (1991).</li><li>Wei, F. J., Droc, G., Guiderdoni, E., Hsing, Y. i. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=International+Consortium+of+Rice+Mutagenesis:+resources+and+beyond.">International Consortium of Rice Mutagenesis: resources and beyond.</a> Rice. 6 (1), 39 (2013).</li><li>Feng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+editing+in+plants+using+a+CRISPR/Cas+system.">Efficient genome editing in plants using a CRISPR/Cas system.</a> Cell Research. 23 (10), 1229 (2013).</li></ol>

Artificial genic male sterile mutants are traditionally generated by random physical, chemical, or biological mutagenesis. Although these are powerful techniques, their random nature fails to capitalize on the vast amount of modern genomic knowledge that has the potential to deliver tailored improvements in molecular breeding32. The CRISPR-Cas9 system has been widely used in plants due to its simple and affordable means to manipulate and edit DNA29,<sup class="xr...

Rice is the most important food crop, particularly in developing countries, and represents a staple food for over half of the world&#8217;s population. Overall, the demand for rice grain is growing and is projected to increase 50% by 2030 and 100% by 20501,2. Future improvements in rice yield will need to capitalize on diverse molecular and genetic resources that make rice an excellent model for monocotyledonous plant research. These include an efficient transformation system, advanced molecular map, and publicly accessible database of expressed sequence tags, which have been generated over many years3,4. One strategy to improve crop yield is hybrid seed production5, a central element of which is the ability to manipulate male fertility. Understanding the molecular control of male fertility in cereal crops can help to translate key knowledge into practical techniques to improve hybrid seed production and enhance crop productivity6,7.
Genetic transformation is a key tool for basic research and commercial agriculture since it enables introduction of foreign genes or manipulation of endogenous genes in crop plants, and results in the generation of genetically modified lines. An appropriate transformation protocol can help to accelerate genetic and molecular biology studies for fundamental understanding of gene regulation8. In bacteria, genetic transformation takes place naturally; however, in plants, it is performed artificially using molecular biology techniques9,10. Agrobacterium tumefaciens is a soil-borne, Gram-negative bacterium that causes crown gall disease in plants by transferring T-DNA, a region of its Ti plasmid, into the plant cell via a type IV secretion system11,12. In plants, A. tumefaciens-mediated transformation is considered a widespread method for gene modification because it leads to stable and low copy number integration of T-DNA into the host genome13. Transgenic rice was first generated through Agrobacterium-mediated gene transformation in the mid-1990s in the japonica cultivar14. Using this protocol, several transgenic lines were obtained within a period of 4 months with a transformation efficiency of 10%&#8211;30%. The study indicated that there are two critical steps for the successful transformation: one is the induction of embryogenic callus from mature seeds and another is the addition of acetosyringone, a phenolic compound, to the bacterial culture during co-cultivation, which allows for higher transformation efficiency in plants14,15. This protocol has been extensively used with minor alterations in japonica16,17,18,19 as well as other cultivars such as indica20,21,22,23 and tropical japonica24,25. Indeed, over 80% of the articles describing rice transformation use Agrobacterium-mediated gene transformation as a tool13. To date, several genetic transformation protocols have been developed using rice seed as a starting material for callus induction16,17,18,19. However, very little is known about young inflorescence as explants for callus production. Overall, it is important to establish a rapid, reproducible, and efficient gene transformation and regeneration protocol for functional genomics and studies on crop improvement.
In recent years, the advancement of CRISPR-Cas9 technology has resulted in a precise genome editing mechanism to understand gene function and deliver agronomically important improvements for plant breeding26,27. CRISPR also offers considerable promise for the manipulation of male reproductive development and hybrid production. In this study, we utilized a gene knockout system using CRISPR-Cas9 technology and coupled it to an efficient rice gene transformation protocol using young inflorescences as explants, thereby creating stable male sterile lines for the study of reproductive development.

<table>
	<tbody>
		<tr>
			<td>1-Naphthaleneacetic acid</td>
			<td>Sigma-Aldrich</td>
			<td>N0640</td>
			<td></td>
		</tr>
		<tr>
			<td>2&#65292;4-Dichlorophenoxyacetic Acid</td>
			<td>Sigma-Aldrich</td>
			<td>D7299</td>
			<td></td>
		</tr>
		<tr>
			<td>6-Benzylaminopurine (6-BA)</td>
			<td>Sigma-Aldrich</td>
			<td>B3408</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetosyringone</td>
			<td>Sigma-Aldrich</td>
			<td>D134406</td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10000561</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium sulfate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10002918</td>
			<td></td>
		</tr>
		<tr>
			<td>Aneurine hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td>T4625</td>
			<td></td>
		</tr>
		<tr>
			<td>Anhydrous ethanol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10009218</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacteriological peptone</td>
			<td>Sangon Biotech</td>
			<td>A100636</td>
			<td></td>
		</tr>
		<tr>
			<td>Beef extract</td>
			<td>Sangon Biotech</td>
			<td>A600114</td>
			<td></td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10004808</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium chloride dihydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>20011160</td>
			<td></td>
		</tr>
		<tr>
			<td>Casein acid hydrolysate</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>C184</td>
			<td></td>
		</tr>
		<tr>
			<td>Cobalt(&#8545;) chloride hexahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10007216</td>
			<td></td>
		</tr>
		<tr>
			<td>Copper(&#8545;) sulfate pentahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10008218</td>
			<td></td>
		</tr>
		<tr>
			<td>D(+)-Glucose anhydrous</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63005518</td>
			<td></td>
		</tr>
		<tr>
			<td>D-sorbitol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63011037</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA, Disodium Salt, Dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>E5134</td>
			<td></td>
		</tr>
		<tr>
			<td>EOS Digital SLR and Compact System Cameras</td>
			<td>Canon</td>
			<td>EOS 700D</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10010018</td>
			<td></td>
		</tr>
		<tr>
			<td>Fully Automated Rotary Microtome</td>
			<td>Leica Biosystems</td>
			<td>Leica RM 2265</td>
			<td></td>
		</tr>
		<tr>
			<td>Glacial acetic acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10000208</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62011516</td>
			<td></td>
		</tr>
		<tr>
			<td>Hygromycin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>H370</td>
			<td></td>
		</tr>
		<tr>
			<td>Inositol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63007738</td>
			<td></td>
		</tr>
		<tr>
			<td>Iodine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10011517</td>
			<td></td>
		</tr>
		<tr>
			<td>Iron(&#8545;) sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10012116</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycine</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>K378</td>
			<td></td>
		</tr>
		<tr>
			<td>Kinetin</td>
			<td>Sigma-Aldrich</td>
			<td>K0753</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Arginine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62004034</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Aspartic acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62004736</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Glutamine</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>G229</td>
			<td></td>
		</tr>
		<tr>
			<td>L-proline</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>P698</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10013018</td>
			<td></td>
		</tr>
		<tr>
			<td>Manganese sulfate monohydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10013418</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscopes</td>
			<td>NIKON</td>
			<td>Eclipse 80i</td>
			<td></td>
		</tr>
		<tr>
			<td>MS</td>
			<td>Phytotech</td>
			<td>M519</td>
			<td></td>
		</tr>
		<tr>
			<td>Nicotinic acid</td>
			<td>Sigma-Aldrich</td>
			<td>N0765</td>
			<td></td>
		</tr>
		<tr>
			<td>Phytagel</td>
			<td>Sigma-Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10016308</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium dihydrogen phosphate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10017608</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium iodide</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10017160</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium nitrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>1001721933</td>
			<td></td>
		</tr>
		<tr>
			<td>Pyridoxine Hydrochloride (B6)</td>
			<td>Sigma-Aldrich</td>
			<td>47862</td>
			<td></td>
		</tr>
		<tr>
			<td>Rifampicin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>R501</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium hydroxide</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10019718</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium molybdate dihydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10019816</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereo microscopes</td>
			<td>Leica Microsystems</td>
			<td>Leica M205 A</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10021418</td>
			<td></td>
		</tr>
		<tr>
			<td>Technovit embedding Kits 7100</td>
			<td>Heraeus Teknovi, Germany</td>
			<td>14653</td>
			<td></td>
		</tr>
		<tr>
			<td>Timentin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>T869</td>
			<td></td>
		</tr>
		<tr>
			<td>Toluidine Blue O</td>
			<td>Sigma-Aldrich</td>
			<td>T3260</td>
			<td></td>
		</tr>
		<tr>
			<td>Water bath for paraffin sections</td>
			<td>Leica Biosystems</td>
			<td>Leica HI1210</td>
			<td></td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>Sangon Biotech</td>
			<td>A515245</td>
			<td></td>
		</tr>
		<tr>
			<td>Zinc sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10024018</td>
			<td></td>
		</tr>
	</tbody>
</table>

agrobacterium-mediated genetic transformation, transgenic production, and its application for the study of male reproductive development in rice

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive organs/gametes. Recent advances in CRISPR-Cas9 genome editing technology allow for high editing efficacy and timesaving knockout mutations of endogenous candidate genes at specific sites. Additionally, Agrobacterium-mediated genetic transformation of rice is also a key method for gene modification, which has been widely adopted by many public and private laboratories. In this study, we applied CRISPR-Cas9 genome editing tools and successfully generated three male sterile mutant lines by targeted genome editing of OsABCG15 in a japonica cultivar. We used a modified Agrobacterium-mediated rice transformation method that could provide excellent means of genetic emasculation for hybrid seed production in rice. Transgenic plants can be obtained within 2&#8211;3 months and homozygous transformants were screened by genotyping using PCR amplification and Sanger sequencing. Basic phenotypic characterization of the male sterile homozygous line was performed by microscopic observation of the rice male reproductive organs, pollen viability analysis by iodine potassium iodide (I2-KI) staining semi-thin cross-sectioning of developing anthers.

Demonstrated here is the use of gene editing technology to create a male sterile line for future research by Agrobacterium-mediated genetic transformation in rice. To create the male sterile line of osabcg15, CRISPR-CAS9-mediated mutagenesis was used for binary vector construction. The sgRNA was driven by the OsU3 promoter, whereas the expression cassette of hSpCas9 was driven by the double 35S promoter, and the middle vector was assembled in a single binary vector pCAMBIA1300 designed for ...

Watch this Scientific Journal Video about Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice at JoVE.com

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

This work describes the use of CRISPR-Cas9 genome editing technology to knockout endogenous gene OsABCG15 followed by a modified Agrobacterium-mediated transformation protocol to produce a stable male-sterile line in rice.

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive ...

agrobacterium-mediated-genetic-transformation-transgenic-production

Research

JoVE Journal

Biology

12.2K Views.  Shanghai Jiao Tong University. Jonge bloeiwijzen als explant voor de productie van kalen zijn belangrijk voor het vaststellen van een snelle en efficiënte gentransformatie en een regeneratiemethode voor het onthullen van de genfunctie en voor gewasverbetering. Jonge bloeiwijzen als explant voor de productie van kalen zijn belangrijk voor het vaststellen van een snelle en efficiënte gentransformatie en de regeneratiemethode voor het onthullen van de genfunctie. Video demonstratie van deze techniek zal helpen de kijker beg...

Video: Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Testing Visual Sensitivity to the Speed and Direction of Motion in Lizards

Testing visual sensitivity in any species provides basic information regarding behaviour, evolution, and ecology. However, testing specific features of the visual system provide more empirical evidence for functional applications. Investigation into the sensory system provides information about the sensory capacity, learning and memory ability, and establishes known baseline behaviour in which to gauge deviations (Burghardt, 1977). However, unlike mammalian or avian systems, testing for learning and memory in a reptile species is difficult. Furthermore, using an operant paradigm as a psychophysical measure of sensory ability is likewise as difficult. Historically, reptilian species have responded poorly to conditioning trials because of issues related to motivation, physiology, metabolism, and basic biological characteristics. Here, I demonstrate an operant paradigm used a novel model lizard species, the Jacky dragon (Amphibolurus muricatus) and describe how to test peripheral sensitivity to salient speed and motion characteristics. This method uses an innovative approach to assessing learning and sensory capacity in lizards. I employ the use of random-dot kinematograms (RDKs) to measure sensitivity to speed, and manipulate the level of signal strength by changing the proportion of dots moving in a coherent direction. RDKs do not represent a biologically meaningful stimulus, engages the visual system, and is a classic psychophysical tool used to measure sensitivity in humans and other animals. Here, RDKs are displayed to lizards using three video playback systems. Lizards are to select the direction (left or right) in which they perceive dots to be moving. Selection of the appropriate direction is reinforced by biologically important prey stimuli, simulated by computer-animated invertebrates.

Testing visual sensitivity in lizards using an operant conditioning paradigm that employs video playback of random-dot kinematograms and computer-generated invertebrates.

Testing visual sensitivity in any species provides basic information regarding behaviour, evolution, and ecology. However, testing specific features of ...

The Ladder Rung Walking Task: A Scoring System and its Practical Application.

Progress in the development of animal models for/stroke, spinal cord injury, and other neurodegenerative disease requires tests of high sensitivity to elaborate distinct aspects of motor function and to determine even subtle loss of movement capacity. To enhance efficacy and resolution of testing, tests should permit qualitative and quantitative measures of motor function and be sensitive to changes in performance during recovery periods. The present study describes a new task to assess skilled walking in the rat to measure both forelimb and hindlimb function at the same time. Animals are required to walk along a horizontal ladder on which the spacing of the rungs is variable and is periodically changed. Changes in rung spacing prevent animals from learning the absolute and relative location of the rungs and so minimize the ability of the animals to compensate for impairments through learning. In addition, changing the spacing between the rungs allows the test to be used repeatedly in long-term studies. Methods are described for both quantitative and qualitative description of both fore- and hindlimb performance, including limb placing, stepping, co-ordination. Furthermore, use of compensatory strategies is indicated by missteps or compensatory steps in response to another limb&#x2019;s misplacement. 

The ladder rung walking task is a new test to assess skilled walking and measure both forelimb and hindlimb placing, stepping, and inter-limb co-ordination.

Progress in the development of animal models for/stroke, spinal cord injury, and other neurodegenerative disease requires tests of high sensitivity to ...

Lens Transplantation in Zebrafish and its Application in the Analysis of Eye Mutants

The lens plays an important role in the development of the optic cup[1,2]. Using the zebrafish as a model organism, questions regarding lens development can be addressed. The zebrafish is useful for genetic studies due to several advantageous characteristics, including small size, high fecundity, short lifecycle, and ease of care. Lens development occurs rapidly in zebrafish. By 72 hpf, the zebrafish lens is functionally mature [3]. Abundant genetic and molecular resources are available to support research in zebrafish. In addition, the similarity of the zebrafish eye to those of other vertebrates provides basis for its use as an excellent animal model of human defects[4-7]. Several zebrafish mutants exhibit lens abnormalities, including high levels of cell death, which in some cases leads to a complete degeneration of lens tissues [8]. To determine whether lens abnormalities are due to intrinsic causes or to defective interactions with the surrounding tissues, transplantation of a mutant lens into a wild-type eye is performed. Using fire-polished metal needles, mutant or wild-type lenses are carefully dissected from the donor animal, and transferred into the host. To distinguish wild-type and mutant tissues, a transgenic line is used as the donor. This line expresses membrane-bound GFP in all tissues, including the lens. This transplantation technique is an essential tool in the studies of zebrafish lens mutants.

Lens development involves interactions with other tissues. Several zebrafish eye mutants are characterized by an abnormally small lens size. Here we demonstrate a lens transplantation experiment to determine whether this phenotype is due to intrinsic causes or defective interactions with tissues that surround the lens.

The lens plays an important role in the development of the optic cup[1,2]. Using the zebrafish as a model organism, questions regarding lens development ...

DNA Extraction from Paraffin Embedded Material for Genetic and Epigenetic Analyses

Disease development and progression are characterized by frequent genetic and epigenetic aberrations including chromosomal rearrangements, copy number gains and losses and DNA methylation. Advances in high-throughput, genome-wide profiling technologies, such as microarrays, have significantly improved our ability to identify and detect these specific alterations. However as technology continues to improve, a limiting factor remains sample quality and availability. Furthermore, follow-up clinical information and disease outcome are often collected years after the initial specimen collection. Specimens, typically formalin-fixed and paraffin embedded (FFPE), are stored in hospital archives for years to decades. DNA can be efficiently and effectively recovered from paraffin-embedded specimens if the appropriate method of extraction is applied. High quality DNA extracted from properly preserved and stored specimens can support quantitative assays for comparisons of normal and diseased tissues and generation of genetic and epigenetic signatures 1. To extract DNA from paraffin-embedded samples, tissue cores or microdissected tissue are subjected to xylene treatment, which dissolves the paraffin from the tissue, and then rehydrated using a series of ethanol washes. Proteins and harmful enzymes such as nucleases are subsequently digested by proteinase K. The addition of lysis buffer, which contains denaturing agents such as sodium dodecyl sulfate (SDS), facilitates digestion 2. Nucleic acids are purified from the tissue lysate using buffer-saturated phenol and high speed centrifugation which generates a biphasic solution. DNA and RNA remain in the upper aqueous phase, while proteins, lipids and polysaccharides are sequestered in the inter- and organic-phases respectively. Retention of the aqueous phase and repeated phenol extractions generates a clean sample. Following phenol extractions, RNase A is added to eliminate contaminating RNA. Additional phenol extractions following incubation with RNase A are used to remove any remaining enzyme. The addition of sodium acetate and isopropanol precipitates DNA, and high speed centrifugation is used to pellet the DNA and facilitate isopropanol removal. Excess salts carried over from precipitation can interfere with subsequent enzymatic assays, but can be removed from the DNA by washing with 70% ethanol, followed by centrifugation to re-pellet the DNA 3. DNA is re-suspended in distilled water or the buffer of choice, quantified and stored at -20&deg;C. Purified DNA can subsequently be used in downstream applications which include, but are not limited to, PCR, array comparative genomic hybridization 4 (array CGH), methylated DNA Immunoprecipitation (MeDIP) and sequencing, allowing for an integrative analysis of tissue/tumor samples.

This video demonstrates the protocol for DNA extraction from formalin-fixed paraffin-embedded material. This is a multi-day procedure in which tissue sections are deparaffinized with xylene, rehydrated with ethanol and treated with proteinase K to purify and isolate DNA for subsequent gene-specific or genome-wide analysis.

Disease development and progression are characterized by frequent genetic and epigenetic aberrations including chromosomal rearrangements, copy number ...

Agrobacterium-Mediated Virus-Induced Gene Silencing Assay In Cotton

Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties. The large-scale gene functional analysis in cotton has been lagged behind most of the modern plant species, likely due to its large size of genome, gene duplication and polyploidy, long growth cycle and recalcitrance to genetic transformation1. To facilitate high throughput functional genetic/genomic study in cotton, we attempt to develop rapid and efficient transient assays to assess cotton gene functions.
Virus-Induced Gene Silencing (VIGS) is a powerful technique that was developed based on the host Post-Transcriptional Gene Silencing (PTGS) to repress viral proliferation2,3. Agrobacterium-mediated VIGS has been successfully applied in a wide range of dicots species such as Solanaceae, Arabidopsis and legume species, and monocots species including barley, wheat and maize, for various functional genomic studies3,4. As this rapid and efficient approach avoids plant transformation and overcomes functional redundancy, it is particularly attractive and suitable for functional genomic study in crop species like cotton not amenable for transformation.
In this study, we report the detailed protocol of Agrobacterium-mediated VIGS system in cotton. Among the several viral VIGS vectors, the tobacco rattle virus (TRV) invades a wide range of hosts and is able to spread vigorously throughout the entire plant yet produce mild symptoms on the hosts5. To monitor the silencing efficiency, GrCLA1, a homolog gene of Arabidopsis Cloroplastos alterados 1 gene (AtCLA1) in cotton, has been cloned and inserted into the VIGS binary vector pYL156. CLA1 gene is involved in chloroplast development6, and previous studies have shown that loss-of-function of AtCLA1 resulted in an albino phenotype on true leaves7, providing an excellent visual marker for silencing efficiency. At approximately two weeks post Agrobacterium infiltration, the albino phenotype started to appear on the true leaves, with 100% silencing efficiency in all replicated experiments. The silencing of endogenous gene expression was also confirmed by RT-PCR analysis. Significantly, silencing could potently occur in all the cultivars we tested, including various commercially grown varieties in Texas. This rapid and efficient Agrobacterium-mediated VIGS assay provides a very powerful tool for rapid large-scale analysis of gene functions at genome-wide level in cotton.

We present the detailed protocol for Agrobacterium-mediated virus-induced gene silencing (VIGS) assay in cotton. The tobacco rattle virus (TRV)-derived VIGS vectors were deployed to induce RNA silencing of cotton GrCLA1, Cloroplastos alterados 1 gene. The albino phenotype caused by silencing GrCLA1 was observed at the seedling stage within 2 weeks after inoculation.

Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties.  The ...

Do-It-Yourself Device for Recovery of Cryopreserved Samples Accidentally Dropped into Cryogenic Storage Tanks

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term storage of biological materials such as blood, cells and tissues 1,2. The cryogenic nature of liquid nitrogen, while ideal for sample preservation, can cause rapid freezing of live tissues on contact - known as 'cryogenic burn'2, which may lead to severe frostbite in persons closely involved in storage and retrieval of samples from Dewars. Additionally, as liquid nitrogen evaporates it reduces the oxygen concentration in the air and might cause asphyxia, especially in confined spaces2.
In laboratories, biological samples are often stored in cryovials or cryoboxes stacked in stainless steel racks within the Dewar tanks1. These storage racks are provided with a long shaft to prevent boxes from slipping out from the racks and into the bottom of Dewars during routine handling. All too often, however, boxes or vials with precious samples slip out and sink to the bottom of liquid nitrogen filled tank. In such cases, samples could be tediously retrieved after transferring the liquid nitrogen into a spare container or discarding it. The boxes and vials can then be relatively safely recovered from emptied Dewar. However, the cryogenic nature of liquid nitrogen and its expansion rate makes sunken sample retrieval hazardous. It is commonly recommended by Safety Offices that sample retrieval be never carried out by a single person. Another alternative is to use commercially available cool grabbers or tongs to pull out the vials3. However, limited visibility within the dark liquid filled Dewars poses a major limitation in their use.
In this article, we describe the construction of a Cryotolerant DIY retrieval device, which makes sample retrieval from Dewar containing cryogenic fluids both safe and easy.

Here we present a low cost, durable cryotolerant device for sample retrieval from Dewar tanks filled with liquid nitrogen. The ease of construction and modular design of the device makes the process of sample retrieval from cryogenic tanks safe and easy.

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term ...

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short period of time. However, this technology is only just beginning to be applied to large-scale production as many technological obstacles to scale up are now being overcome. Here, we demonstrate a simple and reproducible method for industrial-scale transient protein production based on vacuum infiltration of Nicotiana plants with Agrobacteria carrying launch vectors. Optimization of Agrobacterium cultivation in AB medium allows direct dilution of the bacterial culture in Milli-Q water, simplifying the infiltration process. Among three tested species of Nicotiana, N. excelsiana (N. benthamiana &#215; N. excelsior) was selected as the most promising host due to the ease of infiltration, high level of reporter protein production, and about two-fold higher biomass production under controlled environmental conditions. Induction of Agrobacterium harboring pBID4-GFP (Tobacco mosaic virus-based) using chemicals such as acetosyringone and monosaccharide had no effect on the protein production level. Infiltrating plant under 50 to 100 mbar for 30 or 60 sec resulted in about 95% infiltration of plant leaf tissues. Infiltration with Agrobacterium laboratory strain GV3101 showed the highest protein production compared to Agrobacteria laboratory strains LBA4404 and C58C1 and wild-type Agrobacteria strains at6, at10, at77 and A4. Co-expression of a viral RNA silencing suppressor, p23 or p19, in N. benthamiana resulted in earlier accumulation and increased production (15-25%) of target protein (influenza virus hemagglutinin).

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Transient protein production in Nicotiana plants based on vacuum infiltration with Agrobacteria carrying launch vectors (Tobacco mosaic virus-based) is a rapid and economic approach to produce vaccine antigens and therapeutic proteins. We simplified the procedure and improved target accumulation by optimizing conditions of bacteria cultivation, selecting host species, and co-introducing RNA silencing suppressors.

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short ...

Reconstruction of 3-Dimensional Histology Volume and its Application to Study Mouse Mammary Glands

Histology volume reconstruction facilitates the study of 3D shape and volume change of an organ at the level of macrostructures made up of cells. It can also be used to investigate and validate novel techniques and algorithms in volumetric medical imaging and therapies. Creating 3D high-resolution atlases of different organs1,2,3 is another application of histology volume reconstruction. This provides a resource for investigating tissue structures and the spatial relationship between various cellular features. We present an image registration approach for histology volume reconstruction, which uses a set of optical blockface images. The reconstructed histology volume represents a reliable shape of the processed specimen with no propagated post-processing registration error. The Hematoxylin and Eosin (H&#38;E) stained sections of two mouse mammary glands were registered to their corresponding blockface images using boundary points extracted from the edges of the specimen in histology and blockface images. The accuracy of the registration was visually evaluated. The alignment of the macrostructures of the mammary glands was also visually assessed at high resolution.
This study delineates the different steps of this image registration pipeline, ranging from excision of the mammary gland through to 3D histology volume reconstruction. While 2D histology images reveal the structural differences between pairs of sections, 3D histology volume provides the ability to visualize the differences in shape and volume of the mammary glands.

We present an image registration approach for 3-dimensional (3D) histology volume reconstruction, which facilitates the study of the changes of an organ at the level of macrostructures made up of cells . Using this approach, we studied the 3D changes between wild-type and Igfbp7-null mammary glands.

Histology volume reconstruction facilitates the study of 3D shape and volume change of an organ at the level of macrostructures made up of cells. It can ...

Transgenic Rodent Assay for Quantifying Male Germ Cell Mutant Frequency

De novo mutations arise mostly in the male germline and may contribute to adverse health outcomes in subsequent generations. Traditional methods for assessing the induction of germ cell mutations require the use of large numbers of animals, making them impractical. As such, germ cell mutagenicity is rarely assessed during chemical testing and risk assessment. Herein, we describe an in vivo male germ cell mutation assay using a transgenic rodent model that is based on a recently approved Organisation for Economic Co-operation and Development (OECD) test guideline. This method uses an in vitro positive selection assay to measure in vivo mutations induced in a transgenic &#955;gt10 vector bearing a reporter gene directly in the germ cells of exposed males. We further describe how the detection of mutations in the transgene recovered from germ cells can be used to characterize the stage-specific sensitivity of the various spermatogenic cell types to mutagen exposure by controlling three experimental parameters: the duration of exposure (administration time), the time between exposure and sample collection (sampling time), and the cell population collected for analysis. Because a large number of germ cells can be assayed from a single male, this method has superior sensitivity compared with traditional methods, requires fewer animals and therefore much less time and resources.

De novo mutations in the male germline may contribute to adverse health outcomes in subsequent generations. Here we describe a protocol for the use of a transgenic rodent model for quantifying mutations in male germ cells induced by environmental agents.

De novo mutations arise mostly in the male germline and may contribute to adverse health outcomes in subsequent generations. Traditional methods for ...

A Multi-hole Cryovial Eliminates Freezing Artifacts when Muscle Tissues are Directly Immersed in Liquid Nitrogen

Studies on skeletal muscle physiology face the technical challenge of appropriately processing the specimens to obtain sections with clearly visible cytoplasmic compartments. Another hurdle is the tight apposition of myofibers to the surrounding tissues. Because the process of tissue fixation and paraffin embedding leads to the shrinkage of muscle fibers, freezing is an optimal means of hardening muscle tissue for sectioning. However, a commonly encountered issue, the formation of ice crystals, occurs during the preparation of frozen sections because of the high water content of muscle. The protocol presented here first describes a simple and efficient method for properly freezing muscle tissues by immersing them in liquid nitrogen. The problem with using liquid nitrogen alone is that it causes the formation of a nitrogen gas barrier next to the tissue, which acts as an insulator and inhibits the cooling of the tissues. To avoid this "vapor blanket" effect, a new cryovial was designed to increase the speed of liquid flow around the tissue surface. This was achieved by punching a total of 14 inlet holes in the wall of the vial. According to bubble dynamics, a higher rate of liquid flow results in smaller bubbles and fewer chances to form a gas barrier. When liquid nitrogen flows into the cryovial through the inlet holes, the flow velocity around the tissue is fast enough to eliminate the gas barrier. Compared to the method of freezing muscle tissues using pre-chilled isopentane, this protocol is simpler and more efficient and can be used to freeze muscle in a throughput manner. Furthermore, this method is optimal for institutions that do not have access to isopentane, which is extremely flammable at room temperature.

This protocol describes a procedure to freeze muscle tissues by plunging them directly into liquid nitrogen. This protocol also highlights a new cryovial that can avoid the &#34;blanket effect&#34; of nitrogen gas when liquid nitrogen contacts the tissue surface of a specimen.

Studies on skeletal muscle physiology face the technical challenge of appropriately processing the specimens to obtain sections with clearly visible ...

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video