We thank the flow cytometry core facility of Xinxiang Medical University. Development of such technology has been supported by NSFC grants 81601360 to LZ, 81471595 and 32070898 to YL. The work is also supported by Foundation of Henan Educational Committee No. 21IRTSTHN030.

1. Design and Plasmid Construction of sgRNAs Targeting Rosa26 Locus
<ol>
	<li>Design guide RNAs around the desired insertion site
	<ol>
		<li>Ensure that the insertion site for mouse Rosa26 (hereafter designated as mRosa26) knock-in experiments is located in the first intron of mRosa26; this site has been used in previous studies28,29. For knock-in experiments in human cells, ensure that the insertion site resides in the human ROSA26 locus (hereafter referred as hROSA26), which has been identified as the human homolog of mRosa2630.</li>
		<li>Use the genomic sequences of mouse and human species obtained from Mouse Genome Informatics (http://www.informatics.jax.org/) and Ensembl genome browser (http://www.ensembl.org/index.html), respectively. Copy 50 base pairs (bp) of the genomic sequence of the&#160;mRosa26 or hROSA26 locus on each side flanking the desired insertion site.</li>
		<li>Design guide RNAs using the online web tool CRISPOR (http://crispor.tefor.net/)31. Paste the 100 bp of input sequence from 1.1.2. Select two guide RNAs with a high specificity score, a high efficiency score, and low off-target activity. In addition, choose RNA guides with higher Doench scores and avoid those labeled as &#8220;Inefficient&#8221;32. 
		NOTE: Alternative CRISPR design tools are also valuable and publicly available, for instance the Benchling CRISPR design tool (https://benchling.com/crispr). To increase the frequency of CRISPR/Cas9-mediated knock-in mutated cells, select two guide RNAs close to the desired insertion site when possible33.</li>
		<li>For the mRosa26 locus, use two adjacent guide RNAs designated as mR26-sg1 (5&#39;- CTCCAGTCTTTCTAGAAGAT -3&#39;) and mR26-sg2 (5&#39;- CGCCCATCTTCTAGAAAGAC -3&#39;) (Figure 1A). For the hROSA26 locus, use two adjacent guide RNAs, namely hR26-sg1 (5&#39;- GGCGATGACGAGATCACGCG -3&#39;) and hR26-sg2 (5&#39;- AATCGAGAAGCGACTCGACA -3&#39;) (Figure 1B). 
		NOTE: Genome editing activities of mR26-sg1 and mR26-sg2 and those of hR26-sg1 and hR26-sg2 were evaluated in RAW264.7 cells and Jurkat cells, respectively (See Supplementary File, Figure S1).</li>
	</ol>
	</li>
	<li>Cloning of CRISPR expression vectors containing sgRNA targeting the Rosa26 Locus
	<ol>
		<li>Synthesize forward and reverse oligos for one guide RNA (See Supplementary File). 
		NOTE: It is preferable to add a &#39;G&#39; nucleotide to the start of the guide sequence, which helps with expression driven by the U6 promoter. For example, to clone the aforementioned mR26-sg1, the forward oligo is CACCGCTCCAGTCTTTCTAGAAGAT and the reverse oligo is AAACATCTTCTAGAAAGACTGGAGC. The additional G in the forward oligo and its complement in the reverse oligo are indicated in bold.</li>
		<li>Clone synthetic oligos corresponding to the guide RNAs into the all-in-one CRISPR expression vector pX458-DsRed2 generated in our previous work21 (Figure 1C) using the general protocol for gRNA cloning developed by Zhang&#39;s Lab (https://www.addgene.org/crispr/zhang/); however, skip the gel purification step and purify the digested vector using a PCR purification kit (see&#160;Table of Materials). 
		&#8203;NOTE: In previous protocols, gel purification of the BbsI-digested vector was performed; however, this step is time-consuming. In the present protocol, the digested product is purified using a PCR purification kit and used directly for the downstream ligation reaction, which generally produces positive colonies with comparable efficiency.</li>
		<li>Transform 10 &#181;L of the ligation product (step 1.2.2) into 50 &#181;Lof Escherichia coli DH5&#945; competent cells according to the manufacturer&#39;s instructions. Randomly pick three colonies from an LB agar plate with ampicillin (100 &#181;g/mL) and inoculate each into 3 mL of LB medium with ampicillin for culturing overnight.</li>
		<li>Use 1 mL of the overnight bacterial culture for Sanger sequencing and keep the rest at 4 &#176;C until the construct is confirmed to be correct: pDsR-mR26-sg1 and pDsR-mR26-sg2 for mRosa26 locus knock-in, and pDsR-hR26-sg1 and pDsR-hR26-sg2 for the hROSA26 locus.</li>
		<li>Prepare a high concentration of plasmid DNA (approximately 2 &#181;g/&#181;L) with a maxiprep kit for purification of transfection-grade plasmid (see Table of Materials).</li>
	</ol>
	</li>
</ol>
2. Design and Construction of Targeting Vectors as Homologous Recombination Templates
<ol>
	<li>Design a homology-directed repair template
	<ol>
		<li>Design a targeting vector to constitutively express the POI using an expression cassette optimized from a previous study29, which includes a CAG hybrid promoter, an AscI restriction site permitting cloning of the cDNA of the POI, an IRES-EBFP2 reporter, and a bovine growth hormone polyadenylation (bGH-polyA) signal (Figure 1B and Supplementary File).</li>
		<li>Design homology arms (HAs) that share homology with the genomic sequences of the mRosa26 or hROSA26 locus. Include ~1 kb of the 5&#39; HA corresponding to the upstream genomic sequence from the desired insertion site to the left of the expression cassette. Similarly, include ~1 kb of the 3&#39; HA corresponding to the downstream genomic sequence from the insertion site to the right of the expression cassette. 
		NOTE: The expression cassette is inserted as close as possible to the CRISPR/Cas9 cleavage sites34. To avoid re-cutting of the targeted allele by CRISPR/Cas9, incorporate nucleotide changes into the protospacer-adjacent motif (PAM) sequence (5&#39;-NGG-3&#39;) in the targeting vector34,35.</li>
		<li>To allow linearization of the targeting vector, insert a unique EcoRI site just upstream of the 5&#39; HA and a unique BamHI site just downstream of the 3&#39; HA.</li>
		<li>Have a commercial vendor synthesize the targeting vectors and designate them as pKR26-iBFP and pKhR26-iBFP for mRosa26 and hROSA26 knock-in, respectively.</li>
	</ol>
	</li>
	<li>Construct a targeting vector as a homology-directed repair template
	<ol>
		<li>To express the POI, obtain the cDNA sequence (coding sequence) from the Ensembl genome browser and choose the transcript possessing the longest protein sequence. For example, the cDNA of the human ACE2 gene is ACE2-202 ENST00000427411.2 and the cDNA of human RASGRP1 gene is RASGRP1 ENSG00000172575.</li>
		<li>Synthesize the cDNA of the POI with the help of a commercial vendor. It is also possible to clone the cDNA via PCR amplification (not described here). Place the sequence GGCGCGCCACC (5&#39; - 3&#39;), which includes an AscI restriction site (italics and bold) and Kozak consensus translation initiation site (underlined), immediately before the ATG initiation codon of the cDNA and another AscI restriction site (5&#39;- GGCGCGCC -3&#39;) after the stop codon of the cDNA.</li>
		<li>Digest the synthesized sequence with AscI and purify using a PCR purification kit designed for purifying DNA fragments after restriction digestion, following the manufacturers&#39; instructions (see Table of Materials).</li>
		<li>Ligate the purified cDNA insert into the AscI-linearized backbone vector pKR26-iBFP or pKhR26-iBFP using T4 DNA ligase following the manufacturer&#39;s instructions.</li>
		<li>Verify the final targeting vector, pKR26-POI-iBFP or pKhR26-POI-iBFP, by sequencing. Use maxiprep to purify the verified constructs according to the manufacturer&#39;s protocol.</li>
		<li>Digest the targeting vector using either EcoRI or BamHI and purify the digestion product using a PCR purification kit according to the manufacturer&#39;s instructions. Store the linearized targeting vector (~0.8 &#181;g/&#181;L) at -20 &#176;C until electroporation.</li>
	</ol>
	</li>
</ol>
3. Electroporation of Macrophage and T Cell Lines
<ol>
	<li>Prepare cell cultures for electroporation
	<ol>
		<li>Prepare Roswell Park Memorial Institute (RPMI) 1640 supplemented with 10% fetal bovine serum (FBS) as complete growth medium for Jurkat T cells. Prepare Dulbecco&#39;s Modified Eagle Medium (DMEM) with 10% FBS for culturing RAW264.7 macrophages. Supplement all complete growth media with 100 U/mL penicillin and 100 &#181;g/mL streptomycin (Pen/Strep) except for media used for post-transfection incubation before cell sorting.</li>
		<li>Perform subculturing of RAW264.7 and Jurkat T cells according to the supplier&#39;s instructions (See Table of Materials). When subculturing RAW264.7 cells, use trypsin-EDTA solution (0.25%) to detach cells. Use FBS supplemented with 10% (v/v) DMSO as a cryopreservation medium for RAW264.7 and Jurkat cells.</li>
		<li>Collect cells at 250 &#215; g for 5 min for RAW264.7 macrophages and 90 &#215; g for 8 min for Jurkat T cells. Then wash with 5-10 mL of 1&#215; DPBS (without Ca2+ or Mg2+ ions). Remove the DPBS.</li>
		<li>Resuspend the cell pellet using 2 mL of 1&#215; DPBS. Use 10 &#181;L of cells and mix with an equal volume of 0.2% trypan blue to estimate the cell count and viability. 
		NOTE: Ensure that the cell culture has &#62;90% viability on the day of transfection.</li>
		<li>For a single knock-in experiment, perform electroporation with 10 &#181;L nucleofection tips with five repetitions. Calculate the volume needed for 2.0 &#215; 106 cells and pellet the cells by centrifugation. Wash the cell pellet again with 1&#215; DPBS as described in step 3.1.3. 
		NOTE: When using 10 &#181;L nucleofection tips, 4.0 &#215; 105 cells are needed per electroporation. Accordingly, prepare at least 2.0 &#215; 106 cells for one knock-in experiment.</li>
		<li>Prepare a 24-well plate with 0.5 mL of complete growth medium (prepared in step 3.1.1) per well without Pen/Strep and prewarm in a 37 &#176;C incubator.</li>
	</ol>
	</li>
	<li>Electroporation of CRISPR/Cas9 components and the targeting vector
	<ol>
		<li>Turn on the electroporation system. Use electroporation parameters optimized in a previous study21: 1,400 V/20 ms/2 pulses for RAW264.7 macrophages and 1350 V/20 ms/2 pulses for Jurkat T cells.</li>
		<li>Accounting for sample loss due to pipetting, prepare a 55 &#181;L electroporation mixture in a sterile 1.5 mL microcentrifuge tube containing 2.5 &#181;g of each CRISPR/Cas9 vector, 2.4 &#181;g of the linearized targeting vector, and the Resuspension Buffer R. 
		NOTE: To save time, the electroporation mixture can be prepared during centrifugation (step 3.1.5).</li>
		<li>Resuspend 2.0 &#215; 106 cells (prepared in step 3.1.5) in the 55 &#181;L electroporation mixture from step 3.2.2.</li>
		<li>Aspirate the cell/electroporation mixture from step 3.2.3 using a 10 &#181;L nucleofection tip with a pipette. 
		NOTE: During pipetting, avoid introducing air bubbles, which may cause electroporation failure.</li>
		<li>Add the sample to a tube filled with 3 mL of Buffer E from the electroporation kit.</li>
		<li>Apply the electroporation parameters for the two cell types as described in step 3.2.1.</li>
		<li>Transfer the sample into one well of the 24-well plate with prewarmed medium from step 3.1.6.</li>
		<li>Repeat steps 3.2.4-3.2.7 for the other four repetitions as well as for the targeting vector only and CRISPR expression vector only controls. 
		NOTE: Change the nucleofection tip and tube when switching to a different cell type/plasmid DNA.</li>
		<li>Culture the transfected cells for 48-72 h to allow for recovery after electroporation and expression of CRISPR/Cas9 components prior to flow cytometry analysis or fluorescence-activated cell sorting (FACS). Examine the expression of DsRed2 using a fluorescent microscope equipped with a red channel at 24 h post-transfection. 
		NOTE: A benefit of monitoring DsRed2 fluorescent cells is that the efficiency of electroporation can be estimated and the suitability for further cell sorting can be predicted.</li>
	</ol>
	</li>
</ol>
4. Cell Sorting to Isolate Putative Knock-in Cells
<ol>
	<li>Before FACS sorting, wash the transfected cells once with complete growth medium. Pellet cells by centrifugation as described in step 3.1.3 and resuspend the pellet in 500 &#181;L of fresh medium.</li>
	<li>Set the cell sorter (located in a biosafety cabinet) with an 85 &#181;m nozzle and low flow rate. Select the &#34;single cell&#34; mode for sorting and test the single cell sorting efficiency and precision by sorting 20-30 cells onto the cover of 96-well microplate. One droplet localized at the center of each well indicates proper setup of the instrument.</li>
	<li>Transfer the cell suspension from step 4.1 into sterile FACS tubes and add SYTOX Red Dead Cell Stain to a final concentration of 1 nM.</li>
	<li>Analyze samples on the cell sorter. SYTOX Red and EBFP2 are excited by a 405 nm laser and detected by the V450/BV421 and APC channels, respectively. DsRed2 is excited by a 488 nm laser and detected by the PE channel. Use non-transfected cells and EBFP2- and DsRed2-single positive cells as controls for spectral compensation.</li>
	<li>Sort 10 single cells into each well of a 96-well microplate containing 150 &#181;L per well of pre-warmed complete growth medium. Use round bottom microplates for culturing suspension cell lines such as Jurkat T cells and flat bottom microplates for adherent RAW264.7 macrophages. 
	&#8203;NOTE: Sorting of 10 cells per well is an optimized strategy for improving cell survival and minimizing the number of 96-well microplates that need to be seeded and the number of samples that need to be screened by flow cytometry and genotyping; if sorting only one cell per well, seeding of more microplates is required to increase the chance of obtaining correctly edited cells.</li>
</ol>
5. Screening and Validation of Positive Knock-in Cells
<ol>
	<li>Screening for candidate knock-in cells by flow cytometry
	<ol>
		<li>Incubate the cells from step 4.5 for 10-15 days and add complete growth medium every 3 days to replace liquid lost through evaporation. For Jurkat T cells, transfer cells grown in the round bottom 96-well plate to a flat bottom plate to optimize cell proliferation.</li>
		<li>Transfer the expanded sorted cells to 48-well plates for further expansion.</li>
		<li>When cells are close to confluence, use half of the culture to screen for EBFP2 expression by flow cytometry (Figure 3). Normally, half of the culture in a 48-well plate after confluent growth equates to 0.5-1.0 &#215; 105 cells, which is adequate for analysis of one sample by flow cytometry.</li>
		<li>Transfer the remaining cells to 24-well plates for further proliferation.</li>
		<li>Keep the candidate cell populations possessing a high percentage of EBFP2-positive cells for further genotyping experiments. 
		NOTE: Because 10 cells are sorted into each well of the 96-well microplate, it is possible that the knock-in cells will grow with cells that do not express the knock-in gene. Therefore, it is normal to perform an additional round of cell sorting to separate the EBFP2-positive cells from the negative cells.</li>
	</ol>
	</li>
	<li>Screening for candidate knock-in cells by PCR and sequencing
	<ol>
		<li>Collect 2 &#215; 105 candidate cells. Extract the genomic DNA using a DNA prep kit (See Table of Materials).</li>
		<li>To verify that precise homology-directed repair (HDR) has occurred at the mRosa26 locus rather than at random sites in the genome of the candidate knock-in cells, perform PCR with primers spanning each side of the HAs (Figure 4). Choose one primer located in the genomic region outside of the targeting vector (external oligo) and another primer located inside the targeting vector (internal oligo). 
		NOTE: A similar design is used to verify HDR at the hROSA26 locus. PCR primers can also be easily designed for detecting the insertion of the POI sequence. In addition, the wild-type and knock-in allele genotypes can be simultaneously detected using three-primer PCR (See Supplementary File, Figure S2).</li>
		<li>Clone the positive PCR products using a fast-cloning kit (see Table of Materials). Transform the reaction mixture into DH5&#945; competent cells.</li>
		<li>Randomly pick 8-10 individual bacterial colonies per transformation and sequence the PCR products from step 5.2.3 by Sanger sequencing.</li>
	</ol>
	</li>
	<li>Validation of positive knock-in cells by immunoblot analysis and affinity purification 
	NOTE: Candidate cells are subjected to immunoblot analysis for validation of insertion of the POI, or affinity purification (AP) for studies of protein-protein interaction.
	<ol>
		<li>Perform immunoblot analysis according to antibody manufacturer&#39;s instructions. See Table of Materials for information regarding the use of primary antibodies and secondary antibodies.</li>
		<li>Subject the lysates of the knock-in cells expressing the OST-tagged POI to AP using Strep-Tactin Sepharose beads following the manufacturer&#39;s instructions (see Table of Materials).</li>
		<li>Detect chemiluminescence using an imager.</li>
	</ol>
	</li>
</ol>

The authors have nothing to disclose.

In our experiments, we demonstrated how to perform knock-in editing in immune cells from construct design to knock-in cell screening and validation using human Jurkat T cells and murine RAW264.7 macrophages as examples. Both T cell and macrophage cell lines are resistant to transfection36,37; however, the problem of low efficiency of CRISPR/Cas9 delivery can be overcome with the aid of fluorescent reporters coupled with cell sorting. This protocol is suitable for...

Immune cells are critical for defense against pathogens. Both innate and adaptive immunity are required for clearance of infectants and maintenance of tissue homeostasis1,2. Cell line models are essential tools for understanding the molecular fundamentals of the mammalian immune system; they are used in in vitro functional assays, such as those modeling human T cell activation, and in determining the function of genetic factors in activating or dampening immune responses3,4. It is important to note that the mammalian immune system is enormously heterogeneous and, equally important, a huge number of molecules control the differentiation, migration, and function of a given cell type5,6.
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 genome editing tools allow for genetic manipulation of specific cell types, which facilitates functional annotation of genes in a precise manner7,8. Several published protocols have described the delivery of CRISPR/Cas9 in the form of Cas9-guide RNA complexes known as a ribonucleoproteins (RNPs) in HEK293 cells, Jurkat cell lines, primary T cells9,10, macrophages11,12,13, stem cells14, and others15,16. In these protocols, gene tagging is usually achieved by fusing a fluorescent tag to endogenous proteins17,18. However few attempts have been made to use dual fluorescent reporters, which are compatible with single cell sorting, to facilitate knock-in experiments19,20, particularly in immune cells.
In-depth mechanistic analyses aimed at understanding the functions of a novel genetic factor in immune cells generally require cell-type specific deletion of a gene, genetic rescue experiments, and ideally identification of its interactors. Even though methods for optimization of genetic deletion of genes in immune cells have been published9,15,21, far fewer methods have been reported for introducing knock-in alleles with versatile functions to understand the immune response. Therefore, in this protocol we aim to describe in detail an efficient and highly reproducible protocol to express a protein of interest (POI) at the safe harbor locus Rosa26 in both human and murine immune cell lines. We designed a two-color reporter system to enrich for cells transfected with plasmids expressing CRISPR/Cas9 (DsRed2) and a recombinant DNA template (EBFP2), which can be isolated by cell sorting. Following this protocol, we obtained multiple knock-in lines of the human T cell line Jurkat and murine macrophage RAW264.7 for functional analyses of poorly studied proteins.
As an example, we show in this protocol how to obtain knock-in RAW264.7 macrophages stably expressing human ACE2 (a receptor of SARS-Cov-2)22. Because innate immune cells are involved in the pathogenesis of Covid-1923,24 and human ACE2 is regarded as a major receptor required for viral entry into cells before replication, macrophages with knock-in of human ACE2 can serve as a useful tool for mechanistic studies of viral multiplication inside macrophages. In parallel, we also present an example of knock-in of a gene at the human ROSA26 locus to express the RASGRP1 protein, which was fused at its amino terminus with an affinity Twin-Strep-tag (OST). T cells are key target cells in immune therapies, and an increasing number of studies have focused on manipulation of their responsiveness to cancer25,26. As Rasgrp1 is known to be a key signaling molecule downstream of the T cell receptor and its interactors are not well elucidated27, the OST-RASGRP1 knock-in model provides the foundation for identifying interactors regulating the response of T cells to tumors and infection. Taken together, these tools can be used for Covid-19 studies and the discovery of novel molecules interacting with Rasgrp1.

<table><tbody><tr><td>Amersham Imager 600</td><td>Ge Healthcare</td><td></td><td>imaging of chemiluminescence</td></tr><tr><td>Ampicillin, sodium salt</td><td>MP Biomedicals</td><td>194526</td><td></td></tr><tr><td>Anti-rabbit IgG, HRP-linked Antibody</td><td>Cell Signaling Technology</td><td>7074</td><td>at 1/5000 dilution</td></tr><tr><td>Anti-RasGRP1 antibody, clone 10.1</td><td>Merck</td><td>MABS146</td><td>1.0 &amp;mu;g/mL of working concentration</td></tr><tr><td>AscI</td><td>New England BioLabs</td><td>R0558S</td><td></td></tr><tr><td>&amp;beta;-Actin (D6A8) Rabbit mAb</td><td>Cell Signaling Technology</td><td>8457</td><td>at 1/1000 dilution</td></tr><tr><td>BamHI-HF</td><td>New England BioLabs</td><td>R3136S</td><td></td></tr><tr><td>BbsI-HF</td><td>New England BioLabs</td><td>R3539S</td><td></td></tr><tr><td>Cellometer Mini Automated Cell Counter</td><td>Nexcelom Bioscience</td><td></td><td></td></tr><tr><td>&lt;em&gt;E.coli &lt;/em&gt;DH5&amp;alpha; Competent Cells</td><td>Takara</td><td>9057</td><td></td></tr><tr><td>DMSO (Dimethyl Sulfoxide)</td><td>MP Biomedicals</td><td>196055</td><td></td></tr><tr><td>DNeasy Blood &amp;amp; Tissue Kits</td><td>Qiagen</td><td>69506</td><td>cell culture reagent</td></tr><tr><td>DPBS (10X), no calcium, no magnesium</td><td>ThermoFisher Scientific</td><td>14200075</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM) with high glucose</td><td>HyClone</td><td>SH30022.01</td><td></td></tr><tr><td>EcoRI-HF</td><td>New England BioLabs</td><td>R3101S</td><td></td></tr><tr><td>FACSAria&amp;trade; Fusion</td><td>BD Biosciences</td><td></td><td>equipped with biosafety cabinet</td></tr><tr><td>FACS Canto flow cytometer</td><td>BD Biosciences</td><td></td><td></td></tr><tr><td>Falcon 5 ml polystyrene round bottom test tube</td><td>BD Biosciences</td><td>352003</td><td></td></tr><tr><td>Fetal bovine serum (FBS)</td><td>ThermoFisher Scientific</td><td>10099141</td><td></td></tr><tr><td>FlowJo version 10.7</td><td>BD Biosciences</td><td></td><td></td></tr><tr><td>GAPDH (D16H11) XP&amp;nbsp;Rabbit mAb</td><td>Cell Signaling Technology</td><td>5174</td><td>at 1/1000 dilution</td></tr><tr><td>Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP</td><td>ThermoFisher Scientific</td><td>31430</td><td>at 1/5000 dilution</td></tr><tr><td>Immobilon ECL Ultra Western HRP Substrate</td><td>Millipore</td><td>WBKLS0500</td><td></td></tr><tr><td>Immobilon-PSQ PVDF Membrane</td><td>Millipore</td><td>ISEQ00010</td><td></td></tr><tr><td>Jurkat</td><td>ATCC</td><td>TIB-152</td><td>https://www.atcc.org/</td></tr><tr><td>Kanamycin sulfate</td><td>MP Biomedicals</td><td>194531</td><td></td></tr><tr><td>LB agar powder</td><td>ThermoFisher Scientific</td><td>22700041</td><td></td></tr><tr><td>Multi-channel Pipette (30-300 &amp;mu;L)</td><td>Eppendorf, or similar</td><td></td><td></td></tr><tr><td>Neon Transfection System</td><td>ThermoFisher Scientific</td><td>MPK5000</td><td></td></tr><tr><td>Neon Transfection System, 10 &amp;mu;L kit</td><td>ThermoFisher Scientific</td><td>MPK1096</td><td></td></tr><tr><td>Nunc 15 mL Conical Sterile Centrifuge Tubes</td><td>ThermoFisher Scientific</td><td>339651</td><td></td></tr><tr><td>OneTaq&amp;reg; Hot Start Quick-Load&amp;reg; 2X Master Mix</td><td>New England BioLabs</td><td>(M0489)</td><td>for high GC% template</td></tr><tr><td>PageRuler Prestained Protein Ladder, 10 to 180 kDa</td><td>ThermoFisher Scientific</td><td>26616</td><td></td></tr><tr><td>Pipette tip 0.1-20&amp;micro;l</td><td>Eppendorf, or similar</td><td>0030 075.005</td><td></td></tr><tr><td>Pipette tip 2-200&amp;micro;l</td><td>Eppendorf, or similar</td><td>0030 075.021</td><td></td></tr><tr><td>Pipette tip 50-1000&amp;micro;l</td><td>Eppendorf, or similar</td><td>0030 075.064</td><td></td></tr><tr><td>Plasmid Maxi Kit</td><td>Qiagen</td><td>12163</td><td></td></tr><tr><td>pX458-DsRed2</td><td>Addgene</td><td>112219</td><td></td></tr><tr><td>QIAquick PCR Purification Kit</td><td>Qiagen</td><td>28104</td><td>purify plasmid from restriction digestion</td></tr><tr><td>Q5 Hot Start High-Fidelity 2X Master Mix</td><td>New England BioLabs</td><td>M0494S</td><td></td></tr><tr><td>RAW264.7</td><td>ATCC</td><td>TIB-71</td><td>https://www.atcc.org/</td></tr><tr><td>Recombinant Anti-ACE2 antibody [EPR4435(2)]</td><td>Abcam</td><td>ab108252</td><td>at 1/1000 dilution</td></tr><tr><td>RPMI 1640 Medium</td><td>HyClone</td><td>SH30027.01</td><td></td></tr><tr><td>Strep-Tactin Sepharose beads</td><td>IBA Lifesciences</td><td>2-1201-010</td><td></td></tr><tr><td>Penicillin-Streptomycin</td><td>ThermoFisher Scientific</td><td>15140122</td><td></td></tr><tr><td>SYTOX&amp;trade; Red Dead Cell Stain, for 633 or 635 nm excitation</td><td>ThermoFisher Scientific</td><td>S34859</td><td></td></tr><tr><td>T4 DNA ligase</td><td>New England BioLabs</td><td>M0202S</td><td></td></tr><tr><td>T4 Polynucleotide Kinase</td><td>New England BioLabs</td><td>M0201S</td><td></td></tr><tr><td>Trypan Blue Solution, 0.4%</td><td>ThermoFisher Scientific</td><td>15250061</td><td></td></tr><tr><td>Trypsin-EDTA solution (0.25%), with phenol red</td><td>ThermoFisher Scientific</td><td>25200056</td><td></td></tr><tr><td>ZOE Fluorescent Cell Imager</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>1.5 mL microtubes, PCR-clean</td><td>Eppendorf, or similar</td><td>0030 125.215</td><td></td></tr><tr><td>24-well Clear TC-treated Multiple Well Plates</td><td>Corning</td><td>3524</td><td></td></tr><tr><td>96-well Clear Flat Bottom Polystyrene TC-treated Microplates</td><td>Corning</td><td>3599</td><td></td></tr><tr><td>96-well Clear Round Bottom TC-treated Microplate</td><td>Corning</td><td>3799</td><td></td></tr></tbody></table>

gene knock-in by crispr/cas9 and cell sorting in macrophage and t cell lines

Functional genomics studies of the immune system require genetic manipulations that involve both deletion of target genes and addition of elements to proteins of interest. Identification of gene functions in cell line models is important for gene discovery and exploration of cell-intrinsic mechanisms. However, genetic manipulations of immune cells such as T cells and macrophage cell lines using CRISPR/Cas9-mediated knock-in are difficult because of the low transfection efficiency of these cells, especially in a quiescent state. To modify genes in immune cells, drug-resistance selection and viral vectors are typically used to enrich for cells expressing the CRIPSR/Cas9 system, which inevitably results in undesirable intervention of the cells. In a previous study, we designed dual fluorescent reporters coupled to CRISPR/Cas9 that were transiently expressed after electroporation. This technical solution leads to rapid gene deletion in immune cells; however, gene knock-in in immune cells such as T cells and macrophages without the use of drug-resistance selection or viral vectors is even more challenging. In this article, we show that by using cell sorting to aid selection of cells transiently expressing CRISPR/Cas9 constructs targeting the Rosa26 locus in combination with a donor plasmid, gene knock-in can be achieved in both T cells and macrophages without drug-resistance enrichment. As an example, we show how to express human ACE2, a receptor of SARS-Cov-2, which is responsible for the current Covid-19 pandemic, in RAW264.7 macrophages by performing knock-in experiments. Such gene knock-in cells can be widely used for mechanistic studies.

Following the protocol described above to perform knock-in experiments at the mRosa26 locus using murine RAW264.7 macrophages, we designed a targeting vector to express human ACE2, a receptor for the SARS-Cov-2 virus (Figure 2A). Using a similar design, we generated human Jurkat T cells with knock-in of the OST-tagged RASGRP1 fusion protein (Figure 2C). After transfection of three plasmids, two of which were used for expression of CRISPR/Cas9 (DsRed2; p...

Watch this Scientific Journal Video about Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines at JoVE.com

Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines

This protocol uses fluorescent reporters and cell sorting to simplify knock-in experiments in macrophage and T cell lines. Two plasmids are used for these simplified knock-in experiments, namely a CRISPR/Cas9- and DsRed2-expressing plasmid and a homologous recombination donor plasmid expressing EBFP2, which is permanently integrated at the Rosa26 locus in immune cells.

Functional genomics studies of the immune system require genetic manipulations that involve both deletion of target genes and addition of elements to ...

gene-knock-crisprcas9-cell-sorting-macrophage-t-cell

Research

JoVE Journal

Immunology and Infection

10.4K Views.  Xinxiang Medical University. Het doel van dit protocol is om crispr/cas9 gemedieerde knock-in experimenten in macrofaag- en T-cellijnen te vereenvoudigen, met behulp van fluorescerende verslaggevers en celsortering te beïnvloeden. ROSA26 Locus staat bekend als een genomische veilige havenplaats voor het inbrengen van transgenen. Het is gebruikelijk om eiwit van belang met of zonder aanval uit te drukken in de muizenwereld van 26 locus, of in de menselijke ortho log.Deel 1: Ontwerp en de plasmideconstructie van sg...

Video: Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Genetics

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to generate RNA-guided nucleases, such as CRISPR-associated (Cas) 9 for site-specific eukaryotic genome editing. Genome engineering by Cas9 is used to efficiently, easily and robustly modify endogenous genes in many biomedically-relevant mammalian cell lines and organisms. Here we show an example of how to utilize the CRISPR/Cas9 methodology to understand the biological function of specific genetic mutations. We model calreticulin (CALR) mutations in murine interleukin-3 (mIL-3) dependent pro-B (Ba/F3) cells by delivery of single guide RNAs (sgRNAs) targeting the endogenous Calr locus in the specific region where insertion and/or deletion (indel) CALR mutations occur in patients with myeloproliferative neoplasms (MPN), a type of blood cancer. The sgRNAs create double strand breaks (DSBs) in the targeted region that are repaired by non-homologous end joining (NHEJ) to give indels of various sizes. We then employ the standard Ba/F3 cellular transformation assay to understand the effect of physiological level expression of Calr mutations on hematopoietic cellular transformation. This approach can be applied to other genes to study their biological function in various mammalian cell lines.

Targeted gene editing using CRISPR/Cas9 has greatly facilitated the understanding of the biological functions of genes. Here, we utilize the CRISPR/Cas9 methodology to model calreticulin mutations in cytokine-dependent hematopoietic cells in order to study their oncogenic activity.

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

Cancer Research

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been successfully repurposed for genome engineering in many different living organisms. Most commonly, the wildtype CRISPR associated 9 (Cas9) or Cas12a endonuclease is used to cleave specific sites in the genome, after which the DNA double-stranded break is repaired via the non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway depending on whether a donor template is absent or present respectively. To date, CRISPR systems from different bacterial species have been shown to be capable of performing genome editing in mammalian cells. However, despite the apparent simplicity of the technology, multiple design parameters need to be considered, which often leave users perplexed about how best to carry out their genome editing experiments. Here, we describe a complete workflow from experimental design to identification of cell clones that carry desired DNA modifications, with the goal of facilitating successful execution of genome editing experiments in mammalian cell lines. We highlight key considerations for users to take note of, including the choice of CRISPR system, the spacer length, and the design of a single-stranded oligodeoxynucleotide (ssODN) donor template. We envision that this workflow will be useful for gene knockout studies, disease modeling efforts, or the generation of reporter cell lines.

CRISPR-Cas is a powerful technology to engineer the complex genomes of plants and animals. Here, we detail a protocol to efficiently edit the human genome using different Cas endonucleases. We highlight important considerations and design parameters to optimize editing efficiency.

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

A Guide to Precise Gene Disruption in Primary Bone Marrow-Derived Macrophages

High-Efficiency Gene Disruption in Primary Bone Marrow-Derived Macrophages Using Electroporated Cas9-sgRNA Complexes

Bone marrow-derived macrophages (BMDMs) from mice are a key tool for studying the complex biology of tissue macrophages. As primary cells, they model the physiology of macrophages in vivo more closely than immortalized macrophage cell lines and can be derived from mice already carrying defined genetic changes. However, disrupting gene function in BMDMs remains technically challenging. Here, we provide a protocol for efficient CRISPR/Cas9 genome editing in BMDMs, which allows for the introduction of small insertions and deletions (indels) that result in frameshift mutations that disrupt gene function. The protocol describes how to synthesize single-guide RNAs (sgRNA-Cas9) and form purified sgRNA-Cas9 ribonucleoprotein complexes (RNPs) that can be delivered by electroporation. It also provides an efficient method for monitoring editing efficiency using routine Sanger sequencing and a freely available online analysis program. The protocol can be performed within 1 week and does not require plasmid construction; it typically results in 85% to 95% editing efficiency.

Author Spotlight: Efficient CRISPR/Cas9 Genome Editing in Bone Marrow-Derived Macrophages for Precise Gene Disruption

This protocol describes the procedure for genome editing in mouse bone marrow-derived macrophages using Cas9-sgRNA ribonucleoprotein complexes assembled in vitro and delivered by electroporation.

Bone marrow-derived macrophages (BMDMs) from mice are a key tool for studying the complex biology of tissue macrophages. As primary cells, they model the ...

Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins

CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging in primary NK cells. For example, transgene delivery using lentiviral or retroviral transduction resulted in a limited yield of genetically-engineered NK cells due to substantial procedure-associated NK cell apoptosis. We describe here a DNA-free method for genome editing of human primary and expanded NK cells using Cas9 ribonucleoprotein complexes (Cas9/RNPs). This method allowed efficient knockout of the TGFBR2 and HPRT1 genes in NK cells. RT-PCR data showed a significant decrease in gene expression level, and a cytotoxicity assay of a representative cell product suggested that the RNP-modified NK cells became less sensitive to TGF&#946;. Genetically modified cells could be expanded post-electroporation by stimulation with irradiated mbIL21-expressing feeder cells.

Here, we present a protocol to genetically modify primary or expanded human natural killer (NK) cells using Cas9 Ribonucleoproteins (Cas9/RNPs). By using this protocol, we generated human NK cells deficient for transforming growth factor&#8211;b receptor 2 (TGFBR2) and hypoxanthine phosphoribosyltransferase 1 (HPRT1).

CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging ...

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.

The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

CRISPR Gene Editing Tool for MicroRNA Cluster Network Analysis

MicroRNAs (miRNAs) have emerged as important cellular regulators (tumor suppressors, pro-oncogenic factors) of cancer and metastasis. Most published studies focus on a single miRNA when characterizing the role of small RNAs in cancer. However, ~30%&#160;of human miRNA genes are organized in clustered units that are often co-expressed, indicating a complex and coordinated system of noncoding RNA regulation. A clearer understating of how clustered miRNA networks function cooperatively to regulate tumor growth, cancer aggressiveness, and drug resistance is required before translating noncoding small RNAs to the clinic.
The use of a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR)-mediated gene editing procedure has been employed to study the oncogenic role of a genomic cluster of seven miRNA genes located within a locus spanning ~35,000 bp in length in the context of prostate cancer. For this approach, human cancer cell lines were infected with a lentivirus vector for doxycycline (DOX)-inducible Cas9 nuclease grown in DOX-containing medium for 48 h. The cells were subsequently co-transfected with synthetic trans-activating CRISPR RNA (tracrRNA) complexed with genomic site-specific CRISPR RNA (crRNA) oligonucleotides to allow the rapid generation of cancer cell lines carrying the entire miRNA cluster deletion and individual or combination miRNA gene cluster deletions within a single experiment.
The advantages of this high-throughput gene editing system are the ability to avoid time-consuming DNA vector subcloning, the flexibility in transfecting cells with unique guide RNA combinations in a 24-well format, and the lower-cost PCR genotyping using crude cell lysates. Studies using this streamlined approach promise to uncover functional redundancies and synergistic/antagonistic interactions between miRNA cluster members, which will aid in characterizing the complex small noncoding RNA networks involved in human disease and better inform future therapeutic design.

This protocol describes a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR) gene editing workflow for microRNA cluster network analysis that allows the rapid generation of a panel of genetically modified cell lines carrying unique miRNA cluster member deletion combinations as large as 35 kb within a single experiment.

MicroRNAs (miRNAs) have emerged as important cellular regulators (tumor suppressors, pro-oncogenic factors) of cancer and metastasis. Most published ...

Biology

Generation of a RIP1 Knockout U937 Cell Line Using the CRISPR-Cas9 System

This protocol outlines a procedure for knocking out the RIP1 gene using CRISPR/Cas9 in the human monocyte U937 cell line. The method utilizes designated guide RNA plasmids and lentiviral packaging plasmids to achieve RIP1 gene knockout. The protocol addresses challenges and improvements to traditional CRISPR methods, enabling its replication for future cell death studies. The resulting mutant cells can be used to investigate mechanistic changes in cell death, where functional RIP1 proteins would otherwise play a role. Viability assays demonstrated a significant reduction in cell death in knockout cells following necroptosis induction. Fluorescence microscopy revealed a marked decrease in mitochondrial reactive oxygen species (ROS) in knockout cells under the same conditions. Together, these functional assays confirm the loss of RIP1 protein. Optimized for use with U937 human monocytes, this procedure may also be adapted to target other key cell death regulators, yielding functional, non-lethal mutants. Potential pitfalls are addressed throughout to provide insights into challenges that may arise during mutant generation.

As CRISPR-related protocols become increasingly useful and accessible, complications and obstacles can still arise under specific experimental conditions. This protocol outlines the creation of a receptor-interacting serine/threonine-protein kinase 1 (RIPK1/RIP1) knockout human cell line using CRISPR/Cas9 and highlights potential challenges encountered during this process.

This protocol outlines a procedure for knocking out the RIP1 gene using CRISPR/Cas9 in the human monocyte U937 cell line. The method utilizes designated ...

All-in-One CRISPR Genome Editing: A Method for Homology Directed Repair-Based Gene Knock-In in Cultured Cells Using CRISPR-Cas9 System

Source: Zhang, L. et al, <a href="https://www.jove.com/v/62328">Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines.</a> J. Vis. Exp. (2021).
In this video, we demonstrate all-in-one CRISPR-Cas9 based genome editing in cultured cells where Cas9 and sgRNA are provided as a single plasmid construct to the cells. The CRISPR-Cas9 system and desired gene to be inserted was introduced in cells through electroporation technique to facilitate successful gene editing.

Source: Zhang, L. et al, Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines. J. Vis. Exp. (2021).
In this video, we demonstrate ...

Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines

Samenvatting

Meer video's verkennen