We thank the flow cytometry core facility of Xinxiang Medical University. Development of such technology has been supported by NSFC grants 81601360 to LZ, 81471595 and 32070898 to YL. The work is also supported by Foundation of Henan Educational Committee No. 21IRTSTHN030.

1. Design and Plasmid Construction of sgRNAs Targeting Rosa26 Locus
<ol>
	<li>Design guide RNAs around the desired insertion site
	<ol>
		<li>Ensure that the insertion site for mouse Rosa26 (hereafter designated as mRosa26) knock-in experiments is located in the first intron of mRosa26; this site has been used in previous studies28,29. For knock-in experiments in human cells, ensure that the insertion site resides in the human ROSA26 locus (hereafter referred as hROSA26), which has been identified as the human homolog of mRosa2630.</li>
		<li>Use the genomic sequences of mouse and human species obtained from Mouse Genome Informatics (http://www.informatics.jax.org/) and Ensembl genome browser (http://www.ensembl.org/index.html), respectively. Copy 50 base pairs (bp) of the genomic sequence of the&#160;mRosa26 or hROSA26 locus on each side flanking the desired insertion site.</li>
		<li>Design guide RNAs using the online web tool CRISPOR (http://crispor.tefor.net/)31. Paste the 100 bp of input sequence from 1.1.2. Select two guide RNAs with a high specificity score, a high efficiency score, and low off-target activity. In addition, choose RNA guides with higher Doench scores and avoid those labeled as &#8220;Inefficient&#8221;32. 
		NOTE: Alternative CRISPR design tools are also valuable and publicly available, for instance the Benchling CRISPR design tool (https://benchling.com/crispr). To increase the frequency of CRISPR/Cas9-mediated knock-in mutated cells, select two guide RNAs close to the desired insertion site when possible33.</li>
		<li>For the mRosa26 locus, use two adjacent guide RNAs designated as mR26-sg1 (5&#39;- CTCCAGTCTTTCTAGAAGAT -3&#39;) and mR26-sg2 (5&#39;- CGCCCATCTTCTAGAAAGAC -3&#39;) (Figure 1A). For the hROSA26 locus, use two adjacent guide RNAs, namely hR26-sg1 (5&#39;- GGCGATGACGAGATCACGCG -3&#39;) and hR26-sg2 (5&#39;- AATCGAGAAGCGACTCGACA -3&#39;) (Figure 1B). 
		NOTE: Genome editing activities of mR26-sg1 and mR26-sg2 and those of hR26-sg1 and hR26-sg2 were evaluated in RAW264.7 cells and Jurkat cells, respectively (See Supplementary File, Figure S1).</li>
	</ol>
	</li>
	<li>Cloning of CRISPR expression vectors containing sgRNA targeting the Rosa26 Locus
	<ol>
		<li>Synthesize forward and reverse oligos for one guide RNA (See Supplementary File). 
		NOTE: It is preferable to add a &#39;G&#39; nucleotide to the start of the guide sequence, which helps with expression driven by the U6 promoter. For example, to clone the aforementioned mR26-sg1, the forward oligo is CACCGCTCCAGTCTTTCTAGAAGAT and the reverse oligo is AAACATCTTCTAGAAAGACTGGAGC. The additional G in the forward oligo and its complement in the reverse oligo are indicated in bold.</li>
		<li>Clone synthetic oligos corresponding to the guide RNAs into the all-in-one CRISPR expression vector pX458-DsRed2 generated in our previous work21 (Figure 1C) using the general protocol for gRNA cloning developed by Zhang&#39;s Lab (https://www.addgene.org/crispr/zhang/); however, skip the gel purification step and purify the digested vector using a PCR purification kit (see&#160;Table of Materials). 
		&#8203;NOTE: In previous protocols, gel purification of the BbsI-digested vector was performed; however, this step is time-consuming. In the present protocol, the digested product is purified using a PCR purification kit and used directly for the downstream ligation reaction, which generally produces positive colonies with comparable efficiency.</li>
		<li>Transform 10 &#181;L of the ligation product (step 1.2.2) into 50 &#181;Lof Escherichia coli DH5&#945; competent cells according to the manufacturer&#39;s instructions. Randomly pick three colonies from an LB agar plate with ampicillin (100 &#181;g/mL) and inoculate each into 3 mL of LB medium with ampicillin for culturing overnight.</li>
		<li>Use 1 mL of the overnight bacterial culture for Sanger sequencing and keep the rest at 4 &#176;C until the construct is confirmed to be correct: pDsR-mR26-sg1 and pDsR-mR26-sg2 for mRosa26 locus knock-in, and pDsR-hR26-sg1 and pDsR-hR26-sg2 for the hROSA26 locus.</li>
		<li>Prepare a high concentration of plasmid DNA (approximately 2 &#181;g/&#181;L) with a maxiprep kit for purification of transfection-grade plasmid (see Table of Materials).</li>
	</ol>
	</li>
</ol>
2. Design and Construction of Targeting Vectors as Homologous Recombination Templates
<ol>
	<li>Design a homology-directed repair template
	<ol>
		<li>Design a targeting vector to constitutively express the POI using an expression cassette optimized from a previous study29, which includes a CAG hybrid promoter, an AscI restriction site permitting cloning of the cDNA of the POI, an IRES-EBFP2 reporter, and a bovine growth hormone polyadenylation (bGH-polyA) signal (Figure 1B and Supplementary File).</li>
		<li>Design homology arms (HAs) that share homology with the genomic sequences of the mRosa26 or hROSA26 locus. Include ~1 kb of the 5&#39; HA corresponding to the upstream genomic sequence from the desired insertion site to the left of the expression cassette. Similarly, include ~1 kb of the 3&#39; HA corresponding to the downstream genomic sequence from the insertion site to the right of the expression cassette. 
		NOTE: The expression cassette is inserted as close as possible to the CRISPR/Cas9 cleavage sites34. To avoid re-cutting of the targeted allele by CRISPR/Cas9, incorporate nucleotide changes into the protospacer-adjacent motif (PAM) sequence (5&#39;-NGG-3&#39;) in the targeting vector34,35.</li>
		<li>To allow linearization of the targeting vector, insert a unique EcoRI site just upstream of the 5&#39; HA and a unique BamHI site just downstream of the 3&#39; HA.</li>
		<li>Have a commercial vendor synthesize the targeting vectors and designate them as pKR26-iBFP and pKhR26-iBFP for mRosa26 and hROSA26 knock-in, respectively.</li>
	</ol>
	</li>
	<li>Construct a targeting vector as a homology-directed repair template
	<ol>
		<li>To express the POI, obtain the cDNA sequence (coding sequence) from the Ensembl genome browser and choose the transcript possessing the longest protein sequence. For example, the cDNA of the human ACE2 gene is ACE2-202 ENST00000427411.2 and the cDNA of human RASGRP1 gene is RASGRP1 ENSG00000172575.</li>
		<li>Synthesize the cDNA of the POI with the help of a commercial vendor. It is also possible to clone the cDNA via PCR amplification (not described here). Place the sequence GGCGCGCCACC (5&#39; - 3&#39;), which includes an AscI restriction site (italics and bold) and Kozak consensus translation initiation site (underlined), immediately before the ATG initiation codon of the cDNA and another AscI restriction site (5&#39;- GGCGCGCC -3&#39;) after the stop codon of the cDNA.</li>
		<li>Digest the synthesized sequence with AscI and purify using a PCR purification kit designed for purifying DNA fragments after restriction digestion, following the manufacturers&#39; instructions (see Table of Materials).</li>
		<li>Ligate the purified cDNA insert into the AscI-linearized backbone vector pKR26-iBFP or pKhR26-iBFP using T4 DNA ligase following the manufacturer&#39;s instructions.</li>
		<li>Verify the final targeting vector, pKR26-POI-iBFP or pKhR26-POI-iBFP, by sequencing. Use maxiprep to purify the verified constructs according to the manufacturer&#39;s protocol.</li>
		<li>Digest the targeting vector using either EcoRI or BamHI and purify the digestion product using a PCR purification kit according to the manufacturer&#39;s instructions. Store the linearized targeting vector (~0.8 &#181;g/&#181;L) at -20 &#176;C until electroporation.</li>
	</ol>
	</li>
</ol>
3. Electroporation of Macrophage and T Cell Lines
<ol>
	<li>Prepare cell cultures for electroporation
	<ol>
		<li>Prepare Roswell Park Memorial Institute (RPMI) 1640 supplemented with 10% fetal bovine serum (FBS) as complete growth medium for Jurkat T cells. Prepare Dulbecco&#39;s Modified Eagle Medium (DMEM) with 10% FBS for culturing RAW264.7 macrophages. Supplement all complete growth media with 100 U/mL penicillin and 100 &#181;g/mL streptomycin (Pen/Strep) except for media used for post-transfection incubation before cell sorting.</li>
		<li>Perform subculturing of RAW264.7 and Jurkat T cells according to the supplier&#39;s instructions (See Table of Materials). When subculturing RAW264.7 cells, use trypsin-EDTA solution (0.25%) to detach cells. Use FBS supplemented with 10% (v/v) DMSO as a cryopreservation medium for RAW264.7 and Jurkat cells.</li>
		<li>Collect cells at 250 &#215; g for 5 min for RAW264.7 macrophages and 90 &#215; g for 8 min for Jurkat T cells. Then wash with 5-10 mL of 1&#215; DPBS (without Ca2+ or Mg2+ ions). Remove the DPBS.</li>
		<li>Resuspend the cell pellet using 2 mL of 1&#215; DPBS. Use 10 &#181;L of cells and mix with an equal volume of 0.2% trypan blue to estimate the cell count and viability. 
		NOTE: Ensure that the cell culture has &#62;90% viability on the day of transfection.</li>
		<li>For a single knock-in experiment, perform electroporation with 10 &#181;L nucleofection tips with five repetitions. Calculate the volume needed for 2.0 &#215; 106 cells and pellet the cells by centrifugation. Wash the cell pellet again with 1&#215; DPBS as described in step 3.1.3. 
		NOTE: When using 10 &#181;L nucleofection tips, 4.0 &#215; 105 cells are needed per electroporation. Accordingly, prepare at least 2.0 &#215; 106 cells for one knock-in experiment.</li>
		<li>Prepare a 24-well plate with 0.5 mL of complete growth medium (prepared in step 3.1.1) per well without Pen/Strep and prewarm in a 37 &#176;C incubator.</li>
	</ol>
	</li>
	<li>Electroporation of CRISPR/Cas9 components and the targeting vector
	<ol>
		<li>Turn on the electroporation system. Use electroporation parameters optimized in a previous study21: 1,400 V/20 ms/2 pulses for RAW264.7 macrophages and 1350 V/20 ms/2 pulses for Jurkat T cells.</li>
		<li>Accounting for sample loss due to pipetting, prepare a 55 &#181;L electroporation mixture in a sterile 1.5 mL microcentrifuge tube containing 2.5 &#181;g of each CRISPR/Cas9 vector, 2.4 &#181;g of the linearized targeting vector, and the Resuspension Buffer R. 
		NOTE: To save time, the electroporation mixture can be prepared during centrifugation (step 3.1.5).</li>
		<li>Resuspend 2.0 &#215; 106 cells (prepared in step 3.1.5) in the 55 &#181;L electroporation mixture from step 3.2.2.</li>
		<li>Aspirate the cell/electroporation mixture from step 3.2.3 using a 10 &#181;L nucleofection tip with a pipette. 
		NOTE: During pipetting, avoid introducing air bubbles, which may cause electroporation failure.</li>
		<li>Add the sample to a tube filled with 3 mL of Buffer E from the electroporation kit.</li>
		<li>Apply the electroporation parameters for the two cell types as described in step 3.2.1.</li>
		<li>Transfer the sample into one well of the 24-well plate with prewarmed medium from step 3.1.6.</li>
		<li>Repeat steps 3.2.4-3.2.7 for the other four repetitions as well as for the targeting vector only and CRISPR expression vector only controls. 
		NOTE: Change the nucleofection tip and tube when switching to a different cell type/plasmid DNA.</li>
		<li>Culture the transfected cells for 48-72 h to allow for recovery after electroporation and expression of CRISPR/Cas9 components prior to flow cytometry analysis or fluorescence-activated cell sorting (FACS). Examine the expression of DsRed2 using a fluorescent microscope equipped with a red channel at 24 h post-transfection. 
		NOTE: A benefit of monitoring DsRed2 fluorescent cells is that the efficiency of electroporation can be estimated and the suitability for further cell sorting can be predicted.</li>
	</ol>
	</li>
</ol>
4. Cell Sorting to Isolate Putative Knock-in Cells
<ol>
	<li>Before FACS sorting, wash the transfected cells once with complete growth medium. Pellet cells by centrifugation as described in step 3.1.3 and resuspend the pellet in 500 &#181;L of fresh medium.</li>
	<li>Set the cell sorter (located in a biosafety cabinet) with an 85 &#181;m nozzle and low flow rate. Select the &#34;single cell&#34; mode for sorting and test the single cell sorting efficiency and precision by sorting 20-30 cells onto the cover of 96-well microplate. One droplet localized at the center of each well indicates proper setup of the instrument.</li>
	<li>Transfer the cell suspension from step 4.1 into sterile FACS tubes and add SYTOX Red Dead Cell Stain to a final concentration of 1 nM.</li>
	<li>Analyze samples on the cell sorter. SYTOX Red and EBFP2 are excited by a 405 nm laser and detected by the V450/BV421 and APC channels, respectively. DsRed2 is excited by a 488 nm laser and detected by the PE channel. Use non-transfected cells and EBFP2- and DsRed2-single positive cells as controls for spectral compensation.</li>
	<li>Sort 10 single cells into each well of a 96-well microplate containing 150 &#181;L per well of pre-warmed complete growth medium. Use round bottom microplates for culturing suspension cell lines such as Jurkat T cells and flat bottom microplates for adherent RAW264.7 macrophages. 
	&#8203;NOTE: Sorting of 10 cells per well is an optimized strategy for improving cell survival and minimizing the number of 96-well microplates that need to be seeded and the number of samples that need to be screened by flow cytometry and genotyping; if sorting only one cell per well, seeding of more microplates is required to increase the chance of obtaining correctly edited cells.</li>
</ol>
5. Screening and Validation of Positive Knock-in Cells
<ol>
	<li>Screening for candidate knock-in cells by flow cytometry
	<ol>
		<li>Incubate the cells from step 4.5 for 10-15 days and add complete growth medium every 3 days to replace liquid lost through evaporation. For Jurkat T cells, transfer cells grown in the round bottom 96-well plate to a flat bottom plate to optimize cell proliferation.</li>
		<li>Transfer the expanded sorted cells to 48-well plates for further expansion.</li>
		<li>When cells are close to confluence, use half of the culture to screen for EBFP2 expression by flow cytometry (Figure 3). Normally, half of the culture in a 48-well plate after confluent growth equates to 0.5-1.0 &#215; 105 cells, which is adequate for analysis of one sample by flow cytometry.</li>
		<li>Transfer the remaining cells to 24-well plates for further proliferation.</li>
		<li>Keep the candidate cell populations possessing a high percentage of EBFP2-positive cells for further genotyping experiments. 
		NOTE: Because 10 cells are sorted into each well of the 96-well microplate, it is possible that the knock-in cells will grow with cells that do not express the knock-in gene. Therefore, it is normal to perform an additional round of cell sorting to separate the EBFP2-positive cells from the negative cells.</li>
	</ol>
	</li>
	<li>Screening for candidate knock-in cells by PCR and sequencing
	<ol>
		<li>Collect 2 &#215; 105 candidate cells. Extract the genomic DNA using a DNA prep kit (See Table of Materials).</li>
		<li>To verify that precise homology-directed repair (HDR) has occurred at the mRosa26 locus rather than at random sites in the genome of the candidate knock-in cells, perform PCR with primers spanning each side of the HAs (Figure 4). Choose one primer located in the genomic region outside of the targeting vector (external oligo) and another primer located inside the targeting vector (internal oligo). 
		NOTE: A similar design is used to verify HDR at the hROSA26 locus. PCR primers can also be easily designed for detecting the insertion of the POI sequence. In addition, the wild-type and knock-in allele genotypes can be simultaneously detected using three-primer PCR (See Supplementary File, Figure S2).</li>
		<li>Clone the positive PCR products using a fast-cloning kit (see Table of Materials). Transform the reaction mixture into DH5&#945; competent cells.</li>
		<li>Randomly pick 8-10 individual bacterial colonies per transformation and sequence the PCR products from step 5.2.3 by Sanger sequencing.</li>
	</ol>
	</li>
	<li>Validation of positive knock-in cells by immunoblot analysis and affinity purification 
	NOTE: Candidate cells are subjected to immunoblot analysis for validation of insertion of the POI, or affinity purification (AP) for studies of protein-protein interaction.
	<ol>
		<li>Perform immunoblot analysis according to antibody manufacturer&#39;s instructions. See Table of Materials for information regarding the use of primary antibodies and secondary antibodies.</li>
		<li>Subject the lysates of the knock-in cells expressing the OST-tagged POI to AP using Strep-Tactin Sepharose beads following the manufacturer&#39;s instructions (see Table of Materials).</li>
		<li>Detect chemiluminescence using an imager.</li>
	</ol>
	</li>
</ol>

The authors have nothing to disclose.

In our experiments, we demonstrated how to perform knock-in editing in immune cells from construct design to knock-in cell screening and validation using human Jurkat T cells and murine RAW264.7 macrophages as examples. Both T cell and macrophage cell lines are resistant to transfection36,37; however, the problem of low efficiency of CRISPR/Cas9 delivery can be overcome with the aid of fluorescent reporters coupled with cell sorting. This protocol is suitable for...

Immune cells are critical for defense against pathogens. Both innate and adaptive immunity are required for clearance of infectants and maintenance of tissue homeostasis1,2. Cell line models are essential tools for understanding the molecular fundamentals of the mammalian immune system; they are used in in vitro functional assays, such as those modeling human T cell activation, and in determining the function of genetic factors in activating or dampening immune responses3,4. It is important to note that the mammalian immune system is enormously heterogeneous and, equally important, a huge number of molecules control the differentiation, migration, and function of a given cell type5,6.
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 genome editing tools allow for genetic manipulation of specific cell types, which facilitates functional annotation of genes in a precise manner7,8. Several published protocols have described the delivery of CRISPR/Cas9 in the form of Cas9-guide RNA complexes known as a ribonucleoproteins (RNPs) in HEK293 cells, Jurkat cell lines, primary T cells9,10, macrophages11,12,13, stem cells14, and others15,16. In these protocols, gene tagging is usually achieved by fusing a fluorescent tag to endogenous proteins17,18. However few attempts have been made to use dual fluorescent reporters, which are compatible with single cell sorting, to facilitate knock-in experiments19,20, particularly in immune cells.
In-depth mechanistic analyses aimed at understanding the functions of a novel genetic factor in immune cells generally require cell-type specific deletion of a gene, genetic rescue experiments, and ideally identification of its interactors. Even though methods for optimization of genetic deletion of genes in immune cells have been published9,15,21, far fewer methods have been reported for introducing knock-in alleles with versatile functions to understand the immune response. Therefore, in this protocol we aim to describe in detail an efficient and highly reproducible protocol to express a protein of interest (POI) at the safe harbor locus Rosa26 in both human and murine immune cell lines. We designed a two-color reporter system to enrich for cells transfected with plasmids expressing CRISPR/Cas9 (DsRed2) and a recombinant DNA template (EBFP2), which can be isolated by cell sorting. Following this protocol, we obtained multiple knock-in lines of the human T cell line Jurkat and murine macrophage RAW264.7 for functional analyses of poorly studied proteins.
As an example, we show in this protocol how to obtain knock-in RAW264.7 macrophages stably expressing human ACE2 (a receptor of SARS-Cov-2)22. Because innate immune cells are involved in the pathogenesis of Covid-1923,24 and human ACE2 is regarded as a major receptor required for viral entry into cells before replication, macrophages with knock-in of human ACE2 can serve as a useful tool for mechanistic studies of viral multiplication inside macrophages. In parallel, we also present an example of knock-in of a gene at the human ROSA26 locus to express the RASGRP1 protein, which was fused at its amino terminus with an affinity Twin-Strep-tag (OST). T cells are key target cells in immune therapies, and an increasing number of studies have focused on manipulation of their responsiveness to cancer25,26. As Rasgrp1 is known to be a key signaling molecule downstream of the T cell receptor and its interactors are not well elucidated27, the OST-RASGRP1 knock-in model provides the foundation for identifying interactors regulating the response of T cells to tumors and infection. Taken together, these tools can be used for Covid-19 studies and the discovery of novel molecules interacting with Rasgrp1.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Amersham Imager 600</td>
			<td>Ge Healthcare</td>
			<td></td>
			<td>imaging of chemiluminescence</td>
		</tr>
		<tr>
			<td>Ampicillin, sodium salt</td>
			<td>MP Biomedicals</td>
			<td>194526</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-rabbit IgG, HRP-linked Antibody</td>
			<td>Cell Signaling Technology</td>
			<td>7074</td>
			<td>at 1/5000 dilution</td>
		</tr>
		<tr>
			<td>Anti-RasGRP1 antibody, clone 10.1</td>
			<td>Merck</td>
			<td>MABS146</td>
			<td>1.0 &#956;g/mL of working concentration</td>
		</tr>
		<tr>
			<td>AscI</td>
			<td>New England BioLabs</td>
			<td>R0558S</td>
			<td></td>
		</tr>
		<tr>
			<td>&#946;-Actin (D6A8) Rabbit mAb</td>
			<td>Cell Signaling Technology</td>
			<td>8457</td>
			<td>at 1/1000 dilution</td>
		</tr>
		<tr>
			<td>BamHI-HF</td>
			<td>New England BioLabs</td>
			<td>R3136S</td>
			<td></td>
		</tr>
		<tr>
			<td>BbsI-HF</td>
			<td>New England BioLabs</td>
			<td>R3539S</td>
			<td></td>
		</tr>
		<tr>
			<td>Cellometer Mini Automated Cell Counter</td>
			<td>Nexcelom Bioscience</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>E.coli DH5&#945; Competent Cells</td>
			<td>Takara</td>
			<td>9057</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO (Dimethyl Sulfoxide)</td>
			<td>MP Biomedicals</td>
			<td>196055</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Blood &#38; Tissue Kits</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td>cell culture reagent</td>
		</tr>
		<tr>
			<td>DPBS (10X), no calcium, no magnesium</td>
			<td>ThermoFisher Scientific</td>
			<td>14200075</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM) with high glucose</td>
			<td>HyClone</td>
			<td>SH30022.01</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRI-HF</td>
			<td>New England BioLabs</td>
			<td>R3101S</td>
			<td></td>
		</tr>
		<tr>
			<td>FACSAria&#8482; Fusion</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>equipped with biosafety cabinet</td>
		</tr>
		<tr>
			<td>FACS Canto flow cytometer</td>
			<td>BD Biosciences</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon 5 ml polystyrene round bottom test tube</td>
			<td>BD Biosciences</td>
			<td>352003</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>ThermoFisher Scientific</td>
			<td>10099141</td>
			<td></td>
		</tr>
		<tr>
			<td>FlowJo version 10.7</td>
			<td>BD Biosciences</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>GAPDH (D16H11) XP&#160;Rabbit mAb</td>
			<td>Cell Signaling Technology</td>
			<td>5174</td>
			<td>at 1/1000 dilution</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP</td>
			<td>ThermoFisher Scientific</td>
			<td>31430</td>
			<td>at 1/5000 dilution</td>
		</tr>
		<tr>
			<td>Immobilon ECL Ultra Western HRP Substrate</td>
			<td>Millipore</td>
			<td>WBKLS0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Immobilon-PSQ PVDF Membrane</td>
			<td>Millipore</td>
			<td>ISEQ00010</td>
			<td></td>
		</tr>
		<tr>
			<td>Jurkat</td>
			<td>ATCC</td>
			<td>TIB-152</td>
			<td>https://www.atcc.org/</td>
		</tr>
		<tr>
			<td>Kanamycin sulfate</td>
			<td>MP Biomedicals</td>
			<td>194531</td>
			<td></td>
		</tr>
		<tr>
			<td>LB agar powder</td>
			<td>ThermoFisher Scientific</td>
			<td>22700041</td>
			<td></td>
		</tr>
		<tr>
			<td>Multi-channel Pipette (30-300 &#956;L)</td>
			<td>Eppendorf, or similar</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Neon Transfection System</td>
			<td>ThermoFisher Scientific</td>
			<td>MPK5000</td>
			<td></td>
		</tr>
		<tr>
			<td>Neon Transfection System, 10 &#956;L kit</td>
			<td>ThermoFisher Scientific</td>
			<td>MPK1096</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc 15 mL Conical Sterile Centrifuge Tubes</td>
			<td>ThermoFisher Scientific</td>
			<td>339651</td>
			<td></td>
		</tr>
		<tr>
			<td>OneTaq&#174; Hot Start Quick-Load&#174; 2X Master Mix</td>
			<td>New England BioLabs</td>
			<td>(M0489)</td>
			<td>for high GC% template</td>
		</tr>
		<tr>
			<td>PageRuler Prestained Protein Ladder, 10 to 180 kDa</td>
			<td>ThermoFisher Scientific</td>
			<td>26616</td>
			<td></td>
		</tr>
		<tr>
			<td>Pipette tip 0.1-20&#181;l</td>
			<td>Eppendorf, or similar</td>
			<td>0030 075.005</td>
			<td></td>
		</tr>
		<tr>
			<td>Pipette tip 2-200&#181;l</td>
			<td>Eppendorf, or similar</td>
			<td>0030 075.021</td>
			<td></td>
		</tr>
		<tr>
			<td>Pipette tip 50-1000&#181;l</td>
			<td>Eppendorf, or similar</td>
			<td>0030 075.064</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid Maxi Kit</td>
			<td>Qiagen</td>
			<td>12163</td>
			<td></td>
		</tr>
		<tr>
			<td>pX458-DsRed2</td>
			<td>Addgene</td>
			<td>112219</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td>purify plasmid from restriction digestion</td>
		</tr>
		<tr>
			<td>Q5 Hot Start High-Fidelity 2X Master Mix</td>
			<td>New England BioLabs</td>
			<td>M0494S</td>
			<td></td>
		</tr>
		<tr>
			<td>RAW264.7</td>
			<td>ATCC</td>
			<td>TIB-71</td>
			<td>https://www.atcc.org/</td>
		</tr>
		<tr>
			<td>Recombinant Anti-ACE2 antibody [EPR4435(2)]</td>
			<td>Abcam</td>
			<td>ab108252</td>
			<td>at 1/1000 dilution</td>
		</tr>
		<tr>
			<td>RPMI 1640 Medium</td>
			<td>HyClone</td>
			<td>SH30027.01</td>
			<td></td>
		</tr>
		<tr>
			<td>Strep-Tactin Sepharose beads</td>
			<td>IBA Lifesciences</td>
			<td>2-1201-010</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin</td>
			<td>ThermoFisher Scientific</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>SYTOX&#8482; Red Dead Cell Stain, for 633 or 635 nm excitation</td>
			<td>ThermoFisher Scientific</td>
			<td>S34859</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>New England BioLabs</td>
			<td>M0202S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 Polynucleotide Kinase</td>
			<td>New England BioLabs</td>
			<td>M0201S</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution, 0.4%</td>
			<td>ThermoFisher Scientific</td>
			<td>15250061</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin-EDTA solution (0.25%), with phenol red</td>
			<td>ThermoFisher Scientific</td>
			<td>25200056</td>
			<td></td>
		</tr>
		<tr>
			<td>ZOE Fluorescent Cell Imager</td>
			<td>Bio-Rad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 mL microtubes, PCR-clean</td>
			<td>Eppendorf, or similar</td>
			<td>0030 125.215</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well Clear TC-treated Multiple Well Plates</td>
			<td>Corning</td>
			<td>3524</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well Clear Flat Bottom Polystyrene TC-treated Microplates</td>
			<td>Corning</td>
			<td>3599</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well Clear Round Bottom TC-treated Microplate</td>
			<td>Corning</td>
			<td>3799</td>
			<td></td>
		</tr>
	</tbody>
</table>

gene knock-in by crispr/cas9 and cell sorting in macrophage and t cell lines

Functional genomics studies of the immune system require genetic manipulations that involve both deletion of target genes and addition of elements to proteins of interest. Identification of gene functions in cell line models is important for gene discovery and exploration of cell-intrinsic mechanisms. However, genetic manipulations of immune cells such as T cells and macrophage cell lines using CRISPR/Cas9-mediated knock-in are difficult because of the low transfection efficiency of these cells, especially in a quiescent state. To modify genes in immune cells, drug-resistance selection and viral vectors are typically used to enrich for cells expressing the CRIPSR/Cas9 system, which inevitably results in undesirable intervention of the cells. In a previous study, we designed dual fluorescent reporters coupled to CRISPR/Cas9 that were transiently expressed after electroporation. This technical solution leads to rapid gene deletion in immune cells; however, gene knock-in in immune cells such as T cells and macrophages without the use of drug-resistance selection or viral vectors is even more challenging. In this article, we show that by using cell sorting to aid selection of cells transiently expressing CRISPR/Cas9 constructs targeting the Rosa26 locus in combination with a donor plasmid, gene knock-in can be achieved in both T cells and macrophages without drug-resistance enrichment. As an example, we show how to express human ACE2, a receptor of SARS-Cov-2, which is responsible for the current Covid-19 pandemic, in RAW264.7 macrophages by performing knock-in experiments. Such gene knock-in cells can be widely used for mechanistic studies.

Following the protocol described above to perform knock-in experiments at the mRosa26 locus using murine RAW264.7 macrophages, we designed a targeting vector to express human ACE2, a receptor for the SARS-Cov-2 virus (Figure 2A). Using a similar design, we generated human Jurkat T cells with knock-in of the OST-tagged RASGRP1 fusion protein (Figure 2C). After transfection of three plasmids, two of which were used for expression of CRISPR/Cas9 (DsRed2; p...

Watch this Scientific Journal Video about Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines at JoVE.com

Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines

This protocol uses fluorescent reporters and cell sorting to simplify knock-in experiments in macrophage and T cell lines. Two plasmids are used for these simplified knock-in experiments, namely a CRISPR/Cas9- and DsRed2-expressing plasmid and a homologous recombination donor plasmid expressing EBFP2, which is permanently integrated at the Rosa26 locus in immune cells.

Functional genomics studies of the immune system require genetic manipulations that involve both deletion of target genes and addition of elements to ...

gene-knock-crisprcas9-cell-sorting-macrophage-t-cell

Research

JoVE Journal

Immunology and Infection

10.3K Views.  Xinxiang Medical University. This protocol uses fluorescent reporters and cell sorting to simplify knock-in experiments in macrophage and T cell lines. Two plasmids are used for these simplified knock-in experiments, namely a CRISPR/Cas9- and DsRed2-expressing plasmid and a homologous recombination donor plasmid expressing EBFP2, which is permanently integrated at the Rosa26 locus in immune cells.

Video: Gene Knock-in by CRISPR/Cas9 and Cell Sorting in Macrophage and T Cell Lines

Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS)

Experimental and clinical studies often require highly purified cell populations.  FACS is a technique of choice to purify cell populations of known phenotype.  Other bulk methods of purification include panning, complement depletion and magnetic bead separation.  However, FACS has several advantages over other available methods.  FACS is the preferred method when very high purity of the desired population is required, when the target cell population expresses a very low level of the identifying marker or when cell populations require separation based on differential marker density.  In addition, FACS is the only available purification technique to isolate cells based on internal staining or intracellular protein expression, such as a genetically modified fluorescent protein marker.  FACS allows the purification of individual cells based on size, granularity and fluorescence.  In order to purify cells of interest, they are first stained with fluorescently-tagged monoclonal antibodies (mAb), which recognize specific surface markers on the desired cell population (1).  Negative selection of unstained cells is also possible.  FACS purification requires a flow cytometer with sorting capacity and the appropriate software.  For FACS, cells in suspension are passed as a stream in droplets with each containing a single cell in front of a laser.  The fluorescence detection system detects cells of interest based on predetermined fluorescent parameters of the cells.  The instrument applies a charge to the droplet containing a cell of interest and an electrostatic deflection system facilitates collection of the charged droplets into appropriate collection tubes (2).  The success of staining and thereby sorting depends largely on the selection of the identifying markers and the choice of mAb.  Sorting parameters can be adjusted depending on the requirement of purity and yield.  Although FACS requires specialized equipment and personnel training, it is the method of choice for isolation of highly purified cell populations.

Purification of Specific Cell Population by Fluorescence Activated Cell Sorting FACS

For many scientific studies requiring a biological and chemical analysis of cell populations the cells must be in a high state of purity. Fluorescence activated cell sorting (FACS) is a superior method in which to obtain pure cell populations.

Experimental and clinical studies often require highly purified cell populations.  FACS is a technique of choice to purify cell populations of known ...

Retroviral Transduction of T-cell Receptors in Mouse T-cells

T-cell receptors (TCRs) play a central role in the immune system. TCRs on T-cell surfaces can specifically recognize peptide antigens presented by antigen presenting cells (APCs)1. This recognition leads to the activation of T-cells and a series of functional outcomes (e.g. cytokine production, killing of the target cells). Understanding the functional role of TCRs is critical to harness the power of the immune system to treat a variety of immunology related diseases (e.g. cancer or autoimmunity).
It is convenient to study TCRs in mouse models, which can be accomplished in several ways. Making TCR transgenic mouse models is costly and time-consuming and currently there are only a limited number of them available2-4. Alternatively, mice with antigen-specific T-cells can be generated by bone marrow chimera. This method also takes several weeks and requires expertise5. Retroviral transduction of TCRs into in vitro activated mouse T-cells is a quick and relatively easy method to obtain T-cells of desired peptide-MHC specificity. Antigen-specific T-cells can be generated in one week and used in any downstream applications. Studying transduced T-cells also has direct application to human immunotherapy, as adoptive transfer of human T-cells transduced with antigen-specific TCRs is an emerging strategy for cancer treatment6.
Here we present a protocol to retrovirally transduce TCRs into in vitro activated mouse T-cells. Both human and mouse TCR genes can be used. Retroviruses carrying specific TCR genes are generated and used to infect mouse T-cells activated with anti-CD3 and anti-CD28 antibodies. After in vitro expansion, transduced T-cells are analyzed by flow cytometry.

We present a protocol to produce antigen-specific mouse T-cells using retroviral transduction

T-cell receptors (TCRs) play a central role in the immune system. TCRs on T-cell surfaces can specifically recognize peptide antigens presented by antigen ...

Derivation of Thymic Lymphoma T-cell Lines from Atm-/- and p53-/- Mice

Established cell lines are a critical research tool that can reduce the use of laboratory animals in research. Certain strains of genetically modified mice, such as Atm-/- and p53-/- consistently develop thymic lymphoma early in life 1,2, and thus, can serve as a reliable source for derivation of murine T-cell lines. Here we present a detailed protocol for the development of established murine thymic lymphoma T-cell lines without the need to add interleukins as described in previous protocols 1,3. Tumors were harvested from mice aged three to six months, at the earliest indication of visible tumors based on the observation of hunched posture, labored breathing, poor grooming and wasting in a susceptible strain 1,4. We have successfully established several T-cell lines using this protocol and inbred strains ofAtm-/- [FVB/N-Atmtm1Led/J] 2 and p53-/- [129/S6-Trp53tm1Tyj/J] 5 mice. We further demonstrate that more than 90% of the established T-cell population expresses CD3, CD4 and CD8. Consistent with stably established cell lines, the T-cells generated by using the present protocol have been passaged for over a year.

Derivation of Thymic Lymphoma T-cell Lines from Atm-/- and p53-/- Mice

In this video we demonstrate a protocol to establish mouse thymic lymphoma cell lines. By following this protocol, we have successfully established several T-cell lines from Atm-/- and p53-/- mice with thymic lymphoma.

Established cell lines are a critical research tool that can reduce the use of laboratory animals in research. Certain strains of genetically modified ...

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully generated and infused T-cells specific for Epstein Barr virus (EBV), cytomegalovirus (CMV) and Adenovirus (Adv) using monocytes and EBV-transformed lymphoblastoid cell (EBV-LCL) gene-modified with an adenovirus vector as antigen presenting cells (APCs). As few as 2x105/kg trivirus-specific cytotoxic T lymphocytes (CTL) proliferated by several logs after infusion and appeared to prevent and treat even severe viral disease resistant to other available therapies. The broader implementation of this encouraging approach is limited by high production costs, complexity of manufacture and the prolonged time (4-6 weeks for EBV-LCL generation, and 4-8 weeks for CTL manufacture &#x2013; total 10-14 weeks) for preparation. To overcome these limitations we have developed a new, GMP-compliant CTL production protocol. First, in place of adenovectors to stimulate T-cells we use dendritic cells (DCs) nucleofected with DNA plasmids encoding LMP2, EBNA1 and BZLF1 (EBV), Hexon and Penton (Adv), and pp65 and IE1 (CMV) as antigen-presenting cells. These APCs reactivate T cells specific for all the stimulating antigens. Second, culture of activated T-cells in the presence of IL-4 (1,000U/ml) and IL-7 (10ng/ml) increases and sustains the repertoire and frequency of specific T cells in our lines. Third, we have used a new, gas permeable culture device (G-Rex) that promotes the expansion and survival of large cell numbers after a single stimulation, thus removing the requirement for EBV-LCLs and reducing technician intervention. By implementing these changes we can now produce multispecific CTL targeting EBV, CMV, and Adv at a cost per 106 cells that is reduced by &gt;90%, and in just 10 days rather than 10 weeks using an approach that may be extended to additional protective viral antigens. Our FDA-approved approach should be of value for prophylactic and treatment applications for high risk allogeneic HSCT recipients.

A rapid, simple and cost-effective protocol for the generation of donor-derived multivirus-specific CTLs (rCTL) for infusion to allogeneic hematopoietic stem cell transplant (HSCT) recipients at risk of developing CMV, Adv or EBV infections. This manufacturing process is GMP-compliant and should ensure the broader implementation of T-cell immunotherapy beyond specialized centers.

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Expanding Cytotoxic T Lymphocytes from Umbilical Cord Blood that Target Cytomegalovirus, Epstein-Barr Virus, and Adenovirus

Virus infections after stem cell transplantation are among the most common causes of death, especially after cord blood (CB) transplantation (CBT) where the CB does not contain appreciable numbers of virus-experienced T cells which can protect the recipient from infection.1-4 We and others have shown that virus-specific CTL generated from seropositive donors and infused to the recipient are safe and protective.5-8 However, until recently, virus-specific T cells could not be generated from cord blood, likely due to the absence of virus-specific memory T cells. 
In an effort to better mimic the in vivo priming conditions of na&iuml;ve T cells, we established a method that used CB-derived dendritic cells (DC) transduced with an adenoviral vector (Ad5f35pp65) containing the immunodominant CMV antigen pp65, hence driving T cell specificity towards CMV and adenovirus.9 At initiation, we use these matured DCs as well as CB-derived T cells in the presence of the cytokines IL-7, IL-12, and IL-15.10 At the second stimulation we used EBV-transformed B cells, or EBV-LCL, which express both latent and lytic EBV antigens. Ad5f35pp65-transduced EBV-LCL are used to stimulate the T cells in the presence of IL-15 at the second stimulation. Subsequent stimulations use Ad5f35pp65-transduced EBV-LCL and IL-2. 
From 50x106 CB mononuclear cells we are able to generate upwards of 150 x 106 virus-specific T cells that lyse antigen-pulsed targets and release cytokines in response to antigenic stimulation.11 These cells were manufactured in a GMP-compliant manner using only the 20% fraction of a fractionated cord blood unit and have been translated for clinical use.

Here we describe the first good manufacturing practice (GMP)-compliant method of producing virus-specific cytotoxic T lymphocytes (CTL) from umbilical cord blood, a source of predominantly na&#238;ve T cells.

Virus infections after stem cell transplantation are among the most common causes of death, especially after cord blood (CB) transplantation (CBT) where ...

piggyBac Transposon System Modification of Primary Human T Cells

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most commonly utilizing two plasmids with one expressing the piggyBac transposase enzyme and a transposon plasmid harboring the gene(s) of interest between inverted repeat elements which are required for gene transfer activity. PiggyBac mediates gene transfer through a "cut and paste" mechanism whereby the transposase integrates the transposon segment into the genome of the target cell(s) of interest. PiggyBac has demonstrated efficient gene delivery activity in a wide variety of insect1,2, mammalian3-5, and human cells6 including primary human T cells7,8. Recently, a hyperactive piggyBac transposase was generated improving gene transfer efficiency9,10.
Human T lymphocytes are of clinical interest for adoptive immunotherapy of cancer11. Of note, the first clinical trial involving transposon modification of human T cells using the Sleeping beauty transposon system has been approved12. We have previously evaluated the utility of piggyBac as a non-viral methodology for genetic modification of human T cells. We found piggyBac to be efficient in genetic modification of human T cells with a reporter gene and a non-immunogenic inducible suicide gene7. Analysis of genomic integration sites revealed a lack of preference for integration into or near known proto-oncogenes13. We used piggyBac to gene-modify cytotoxic T lymphocytes to carry a chimeric antigen receptor directed against the tumor antigen HER2, and found that gene-modified T cells mediated targeted killing of HER2-positive tumor cells in vitro and in vivo in an orthotopic mouse model14. We have also used piggyBac to generate human T cells resistant to rapamycin, which should be useful in cancer therapies where rapamycin is utilized15.
Herein, we describe a method for using piggyBac to genetically modify primary human T cells. This includes isolation of peripheral blood mononuclear cells (PBMCs) from human blood followed by culture, gene modification, and activation of T cells. For the purpose of this report, T cells were modified with a reporter gene (eGFP) for analysis and quantification of gene expression by flow cytometry.
PiggyBac can be used to modify human T cells with a variety of genes of interest. Although we have used piggyBac to direct T cells to tumor antigens14, we have also used piggyBac to add an inducible safety switch in order to eliminate gene modified cells if needed7. The large cargo capacity of piggyBac has also enabled gene transfer of a large rapamycin resistant mTOR molecule (15 kb)15. Therefore, we present a non-viral methodology for stable gene-modification of primary human T cells for a wide variety of purposes.

piggyBac Transposon System Modification of Primary Human T Cells

We describe a method to genetically modify primary human T cells with a transgene using the non-viral piggyBac transposon system. T cells modified to using the piggyBac transposon system exhibit stable transgene expression.

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition of cognate antigen presented on MHC class II. The cytokine signals present in the environment at the time of TCR activation are a major factor in determining the effector fate of a na&#239;ve CD4+ T cell. Although the cytokine environment during na&#239;ve T cell activation may be complex and involve both redundant and opposing signals in vivo, the addition of various cytokine combinations during naive CD4+ T cell activation in vitro can readily promote the establishment of effector T helper lineages with hallmark cytokine and transcription factor expression. Such differentiation experiments are commonly used as a first step for the evaluation of targets believed to promote or inhibit the development of certain CD4+ T helper subsets. The addition of mediators, such as signaling agonists, antagonists, or other cytokines, during the differentiation process can also be used to study the influence of a particular target on T cell differentiation. Here, we describe a basic protocol for the isolation of na&#239;ve T cells from mouse and the subsequent steps necessary for polarizing na&#239;ve cells to various T helper effector lineages in vitro.

Mouse Na&amp;#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Na&#239;ve CD4+ T cells polarize to various subsets depending on the environment at the time of activation. The differentiation of na&#239;ve CD4+ T cells to various effector subsets can be achieved in vitro through the addition of T cell receptor stimuli and specific cytokine signals.

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Analyzing the Functions of Mast Cells In Vivo Using 'Mast Cell Knock-in' Mice

Mast cells (MCs) are hematopoietic cells which reside in various tissues, and are especially abundant at sites exposed to the external environment, such as skin, airways and gastrointestinal tract. Best known for their detrimental role in IgE-dependent allergic reactions, MCs have also emerged as important players in host defense against venom and invading bacteria and parasites. MC phenotype and function can be influenced by microenvironmental factors that may differ according to anatomic location and/or based on the type or stage of development of immune responses. For this reason, we and others have favored in vivo approaches over in vitro methods to gain insight into MC functions. Here, we describe methods for the generation of mouse bone marrow-derived cultured MCs (BMCMCs), their adoptive transfer into genetically MC-deficient mice, and the analysis of the numbers and distribution of adoptively transferred MCs at different anatomical sites. This method, named the &#8216;mast cell knock-in&#8217; approach, has been extensively used over the past 30 years to assess the functions of MCs and MC-derived products in vivo. We discuss the advantages and limitations of this method, in light of alternative approaches that have been developed in recent years.

Analyzing the Functions of Mast Cells In Vivo Using &#039;Mast Cell Knock-in&#039; Mice

We describe a method for the generation of in vitro derived mast cells, their engraftment into mast cell-deficient mice, and the analysis of the phenotype, numbers and distribution of engrafted mast cells at different anatomical sites. This protocol can be used to assess the functions of mast cells in vivo.

Mast cells (MCs) are hematopoietic cells which reside in various tissues, and are especially abundant at sites exposed to the external environment, such ...

An Efficient and Simple Method to Establish NK and T Cell Lines from Patients with Chronic Active Epstein-Barr Virus Infection

A number of methods have been described to establish NK/T cell lines from patients with lymphoma or lymphoproliferative syndrome. These methods employed feeder cells, purified NK or T cells with as much as 10 mL of blood, or a high-dose of IL-2. This study presents a new method with a powerful and simple strategy to establish NK and T cell lines by culturing the peripheral blood mononuclear cells (PBMC) with the addition of recombinant human IL-2 (rhIL-2), and uses as little as 2 mL of whole blood. The cells can proliferate quickly in two weeks and be maintained for more than 3 months. With this method, 7 NK or T cell lines have been established with a high success rate. This method is simple, reliable, and applicable to establishing cell lines from more cases of CAEBV or NK/T cell lymphoma.

A simple method for obtaining NK and T cell clones from CAEBV patients was developed with high efficiency, a small amount of peripheral blood, and a low-dose of IL-2.

A number of methods have been described to establish NK/T cell lines from patients with lymphoma or lymphoproliferative syndrome. These methods employed ...

Generating Recombinant Avian Herpesvirus Vectors with CRISPR/Cas9 Gene Editing

Herpesvirus of turkeys (HVT) is an ideal viral vector for the generation of recombinant vaccines against a number of avian diseases, such as avian influenza (AI), Newcastle disease (ND), and infectious bursal disease (IBD), using bacterial artificial chromosome (BAC) mutagenesis or conventional recombination methods. The clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 system has been successfully used in many settings for gene editing, including the manipulation of several large DNA virus genomes. We have developed a rapid and efficient CRISPR/Cas9-mediated genome editing pipeline to generate recombinant HVT. To maximize the potential use of this method, we present here detailed information about the methodology of generating recombinant HVT expressing the VP2 protein of IBDV. The VP2 expression cassette is inserted into the HVT genome via an NHEJ (nonhomologous end-joining)-dependent repair pathway. A green fluorescence protein (GFP) expression cassette is first attached to the insert for easy visualization and then removed via the Cre-LoxP system. This approach offers an efficient way to introduce other viral antigens into the HVT genome for the rapid development of recombinant vaccines.

Herpesvirus of turkeys (HVT) is widely used as a vector platform for the generation of recombinant vaccines against a number of avian diseases. This article describes a simple and rapid approach for the generation of recombinant HVT-vectored vaccines using an integrated NHEJ-CRISPR/Cas9 and Cre-Lox system.