We thank Dr. Ana-Maria Zaske, operator of Atomic Force Microscope-UT Core facility at the University of Texas Health Sciences Center, for the contributed expertise in AFM in this project. We also thank the funding sources from the National Institutes of Health (K01DE026561, R03DE025873, R01DE029014, R56HL142704, and R01HL142704 to J. Wang).

1. Hydrogel preparation
NOTE: All steps must be performed in a cell culture hood that has been disinfected with ethanol and ultraviolet (UV)-sterilized before use to maintain sterility. Tools, such as tweezers and pipettes, must be sprayed with ethanol. Buffer solutions must also be sterile-filtered.
<ol>
	<li>Preparation of aminosilane-coated glass coverslips
	<ol>
		<li>Place the desired number of glass coverslips onto a piece of laboratory wipe. 
		NOTE: Prepare an additional 3-4 coverslips to ensure sufficient backup supplies as they break easily. Different materials of glass coverslips will yield different compatibility of cell seeding and attachment. It is better to determine which type suits the experiment best before starting the experiments (see the Table of Materials).</li>
		<li>Use an alcohol burner or Bunsen burner to sterilize each coverslip by passing it back and forth through the flame (30 s for protein assay experiments). Place each glass coverslip on a laboratory wipe to cool down.</li>
		<li>Once the glass coverslips are cooled down, transfer them onto a Petri dish lined with parafilm to prevent slippage. 
		NOTE: If the coverslips are not cool enough, the residual heat will melt the parafilm onto the slips, rendering them unusable.</li>
		<li>Cover the coverslips with approximately 200 &#956;L and 800 &#956;L of 0.1 M NaOH for a 12 mm and a 25 mm coverslip, respectively, and let them sit for 5 min. Then, aspirate the 0.1 M NaOH and allow the coverslips to air-dry for another 5 min to form an even film.</li>
		<li>Once the coverslips are dried, pipette approximately 80 &#956;L and 150 &#956;L of 3-aminopropyl triethoxysilane (APTS) for 12 mm and 25 mm coverslips, respectively. Be careful to avoid spilling the solution onto the parafilm. Allow the solution to sit for 5 min.</li>
		<li>Aspirate as much excess APTS as possible and allow the residual APTS to dry for 5 min. Rinse the coverslips well by submerging them in sterile, deionized (DI) H2O three times for 5 min each time. 
		NOTE: If the glass coverslips are not rinsed well, the residual APTS causes unwanted reactions with glutaraldehyde, causing a white precipitate to form and resulting in unusable coverslips.</li>
		<li>Move the coverslips to a new Petri dish with the reactive side facing up. Add enough 0.5% glutaraldehyde to the Petri dish to cover the coverslips entirely and allow the coverslips to sit for 30 min.</li>
		<li>Aspirate the 0.5% glutaraldehyde and rinse the coverslips again in DI H2O one time for 3 min. Set the coverslips reactive side up on a laboratory wipe or a clean Petri dish to air-dry completely before using. 
		NOTE: The protocol can be paused here; coverslips must be placed in sterile DI H2O until use.</li>
	</ol>
	</li>
	<li>Preparation of siliconized coverslips
	<ol>
		<li>Place the same number of coverslips as the aminosilane-coated coverslips (step 1.1.1) in a Petri dish lined with parafilm.</li>
		<li>Pipette 40 &#956;L or 150 &#956;L for 12 mm and 25 mm coverslips, respectively, of dichloromethylsilane (DCMS) to one side of the coverslip and allow the solution to sit for 5 min.</li>
		<li>Aspirate any remaining solution from the coverslip, wash in sterile DI H2O once for 1 min, and place the reactive coverslips face up on a laboratory wipe to air-dry completely before moving onto the next step.</li>
	</ol>
	</li>
	<li>Preparing hydrogels
	<ol>
		<li>Mix acrylamide, bis-acrylamide, and DI H2O in a 1.5 mL centrifuge tube to prepare 500 &#956;L of solutions with varying stiffnesses (see Table 1). Vortex the solution for 30 s to mix it thoroughly.</li>
		<li>Working swiftly, add the 10% ammonium persulfate solution (APS) and tetramethylethylenediamine (TEMED) to the tube and vortex the solutions again to mix the solutions. 
		NOTE: Prepare fresh 10% APS and leave it on ice or freeze into single-use aliquots due to its sensitive freeze/thaw cycle.</li>
		<li>Pipette approximately 33 &#956;L or 100 &#956;L of the solution onto the dried 12 mm or 25 mm aminosilane-coated coverslips (section 1.1), respectively.</li>
		<li>Using curved tweezers, immediately place the DCMS-treated coverslip on top of the gel solution with the treated side touching the gel solution, thus sandwiching the gel solution between the DCMS-treated coverslip and aminosilane-coated coverslip.</li>
		<li>Allow the gel solution to polymerize for 5-15 min, while actively monitoring for gel polymerization of the leftover solution in the tube.</li>
		<li>Once the gel is polymerized, separate the DCMS-treated coverslip with curved tweezers or a razor blade, leaving the gel attached to the original aminosilane-coated coverslip.</li>
		<li>Immediately place the coverslip with the attached hydrogel in a predetermined 4-well/24-well and 6-well plate covered with 500 &#181;L and 2 mL of sterile PBS or DI H2O for 12 mm and 25 mm coverslips, respectively, to prevent the gel from drying out.</li>
		<li>Repeat steps 1.3.4-1.3.7 for all coverslips.</li>
		<li>Submerge the hydrogels in sterile PBS or DI H2O for 30 min to remove excess acrylamide solution. Store the hydrogels in sterile PBS or DI H2O at 4 &#176;C for a procedural stop here.</li>
		<li>In a dark room, prepare the sulfosuccinimidyl 6-(4&#39;-azido-2&#39;-nitrophenylamino) hexanoate (sulfo-SANPAH) mixture by mixing 2.5 mL of 50 mM 2-[4-(2-hydroxyethyl) piperazin-1-yl] ethanesulfonic acid(HEPES) (pH=8.5) with 25 &#956;L of the 50 &#956;g/mL sulfo-SANPAH in a conical tube, wrapped in aluminum foil to protect from light. Use a pipette to mix the solution well before using. 
		NOTE: A volume of 2.5 mL of sulfo-SANPAH solution is enough for approximately twenty-five 12 mm hydrogels or five 25 mm hydrogels.</li>
		<li>Aspirate PBS or DI H2O from the well plate. Add approximately 100 &#956;L or 500 &#956;L for 12 mm and 25 mm coverslips, respectively, of sulfo-SANPAH solution (step 1.3.10) to cover the gel. Ensure the solution covers the gel entirely. 
		NOTE: Adjust the vacuum suction strength to prevent the strong force from ripping or disturbing the hydrogels.</li>
		<li>Place the gels with the solution under a 15 W, 365 nm UV&#160;light for 10 min, uncovered to minimize any interference of the UV light reacting with the sulfo-SANPAH.</li>
		<li>Aspirate the excess sulfo-SANPAH by tilting the plate to collect as much of the solution as possible. Wash the gel with 50 mM HEPES two to three times.</li>
		<li>Add 500 &#956;L and 2 mL for 12 mm and 25 mm gels, respectively, of 50 mg/mL collagen I diluted in 0.2% acetic acid to each well containing the hydrogel. Allow the gels to incubate overnight in a 37 &#176;C, 5% CO2 incubator. 
		NOTE: Dilute collagen I in 0.2% acetic acid instead of 50 mM HEPES to promote homogenous distribution and attachment of collagen I.</li>
		<li>Aspirate the collagen I and wash the gels with sterile PBS three times to remove excess collagen I for 5 min each wash. Incubate the hydrogels in PBS with 10% horse serum, 5% FBS&#160;for 2 h in the 37 &#176;C, 5% CO2 incubator. 
		NOTE: The addition of 10% horse serum promotes higher proliferation compared to only using FBS as done in the previous publication.</li>
		<li>Aspirate the medium. Add 500 mL of sterile-filtered Dulbecco&#39;s Modified Eagle Medium (DMEM) with 10% FBS and 1% penicillin-streptomycin (P/S) to each well. Store the gels in the 37 &#176;C, 5% CO2 incubator until ready for cell culture.</li>
		<li>Once ready, plate approximately 1.5 &#215; 104 O9-1 cells/cm2 in basal medium in the culture dishes. Incubate the cells for 2 days in an incubator at 37 &#176;C, 5% CO2. Check the cells for confluency to ensure that the cells are sufficiently attached to gels, and that the number of cells is enough before collecting for analysis. 
		NOTE: See the previously published protocol for the steps of recovery, passage, and collection of O9-1 cells20.</li>
		<li>Proceed to sections 2, 3, or 4 for further analysis of the hydrogels.</li>
	</ol>
	</li>
</ol>
2. Quantitative analysis of stiffness via AFM
<ol>
	<li>Start the AFM system computer, followed by the AFM controller (see the Table of Materials).</li>
	<li>Mount the AFM cantilever on the AFM probe holder. Use a spherical cantilever with a 0.5 &#956;m silica bead mounted at the end of the cantilever (cantilever with spherical bead). 
	NOTE: For stiffer hydrogels, such as 10 kPa, 20 kPa, and 40 kPa, a stiffer probe was used with the spring constant of 0.24 N/m. A softer probe was used for softer hydrogels, such as 0.5 kPa and 1 kPa, with a spring constant of 0.059 N/m.</li>
	<li>Set the AFM software under contact mode.</li>
	<li>Mount the silicon wafer onto the AFM sample stage to collect force curves by clicking on Engage for the cantilever to touch the silicon substrate, thus generating the force curves.</li>
	<li>Use the force curves above (2.4) for calibration, click on Calibrate in the controlling software to obtain an average spring constant of the cantilever under thermal tune condition, and save the calibrated values in the controlling software.</li>
	<li>Mount the samples by placing the coverslip with the attached hydrogel in a 60 mm Petri dish onto the AFM scanning stage. Add 3 mL of PBS into the dish before conducting measurements to prevent the gel from drying out.</li>
	<li>Set the AFM to work in contact mode (fluid) to start measurement. Engage the spherical bead to continuously touch and lift from the gel sample.</li>
	<li>Set the cantilever so that its deflection threshold remains at 10 nm. Keep the ramping size of the probe at 10 &#956;m. Then, record the force curves as in step 2.4.</li>
	<li>Acquire at least 20 force curves from at least 3 to 10 different spots across the surface of the hydrogel.</li>
	<li>Calculate the average Young&#39;s modulus of ~20 force curves for each spot with AFM imaging and analysis software. Use extend ramp force curves and a linearized model (spherical). Calculate the average of all spots for each sample to yield the final stiffness. 
	NOTE: Young&#39;s modulus and related data (i.e., standard deviations) are automatically saved as a spreadsheet.</li>
	<li>Repeat steps 2.6-2.10 for all samples.</li>
</ol>
3. Molecular analysis of stiffness via immunofluorescence staining
<ol>
	<li>Use tweezers to transport the coverslip to a new plate to minimize false signals from cells grown directly onto the plate. Wash the cells with 500 &#181;L of sterile PBS three times to remove dead cells and any remaining culture medium.</li>
	<li>Fix the cells using 500 &#181;L of 4% paraformaldehyde (PFA) for 10 min at room temperature, undisturbed. Then, rewash the cells three times using 500 &#181;L of PBS/well for 2 min each. 
	NOTE: Store at 4 &#176;C for a procedural stop.</li>
	<li>Treat the cells with 500 &#181;L of 0.1% Triton X-100 for 15 min at room temperature. Then, wash the cells three times with 500 &#181;L of PBS/well.</li>
	<li>Block the cells with 250 &#181;L of 10% donkey serum (diluted in PBS and 0.1% Tween 20) per well for 30 min at room temperature.</li>
	<li>Incubate the cells with 250 &#181;L of primary antibodies for 2 h at room temperature or overnight at 4 &#176;C. Then, wash the cells three times with 500 &#181;L of PBS/well for 5 min each. 
	NOTE: Anti-Vinculin (Vcl) (1:250) and anti-AP2 alpha (1:250) were used in this experiment and were diluted in 10% donkey serum.</li>
	<li>Incubate the cells with corresponding secondary antibodies and/or phalloidin used for F-actin staining at a dilution of 1:400 in 250 &#181;L of 10% donkey serum for 30 min at room temperature. Then, wash the cells three times with PBS for 5 min each. 
	NOTE: 568 nm Phalloidin can be co-incubated with 488 nm or 647 nm secondary antibodies or on its own.</li>
	<li>Incubate the cells with 4&#8242;,6-diamidino-2-phenylindole (DAPI, 1:1000 dilution) in 250 &#181;L of PBS for 10 min followed by one last wash of PBS for 2 min.</li>
	<li>Add 3-4 drops of mounting medium to each well. Store the samples at 4 &#176;C to set for at least 2 h before imaging to ensure the mounting medium has set properly.</li>
	<li>Capture images of at least 3 random frames per hydrogel sample with a fluorescence microscope, producing individual and merged channels.</li>
</ol>
4. Quantitative real-time PCR (RT-qPCR)
<ol>
	<li>Transfer the hydrogels with the adherent cells for RNA collection to a new plate to minimize unwanted RNA from cells attached to the cell plate. Wash the cells with PBS three times to remove dead cells and culture medium.</li>
	<li>Extract the total mRNA using an RNA extraction kit. Perform reverse-transcription of RNA to cDNA using a reverse transcription supermix following the manufacturer&#39;s instructions.</li>
	<li>Perform RT-qPCR with primers for Vcl as the stiffness marker of choice and analyze using the 2-&#916;&#916;CT method. 
	NOTE: Primer sequence of Vcl: Forward 5&#39; GCTTCAGTCAGACCCATACTCG 3&#39;; reverse 5&#39; AGGTAAGCAGTAGGTCAGATGT 3&#39;.</li>
</ol>

The authors have no conflicts of interest to disclose.

The goal of the current study is&#160;to provide an effective and efficient in vitro system to better understand the impact of mechanical signals in NCCs. In addition to following the step-by-step protocol mentioned above, researchers need to keep in mind that the cell culture of O9-1 NCCs is affected by the type of glass coverslips used to prepare hydrogels. For instance, it was noted that cells seeded on a specific type of glass coverslip (see the Table of Materials) survived and proliferated ...

Neural crest cells (NCCs) are a group of stem cells during vertebrate embryogenesis with a remarkable ability to migrate and contribute to the development of various organs and tissues. NCCs can differentiate into different cell types, including sensory neurons, cartilage, bone, melanocytes, and smooth muscle cells, depending on the location of axial origin and the local environmental guidance of the NCC1,2. With the ability to differentiate into a wide array of cell types, genetic abnormalities that cause dysregulation at any stage of neural crest (NC) development can lead to numerous congenital diseases2. For instance, perturbations during the formation, migration, and development of NCCs lead to developmental disorders known collectively as neurocristopathies1,3. These diseases range from craniofacial defects due to failure in NCC formation, such as Treacher Collins syndrome, to the development of various cancers due to NCC metastatic migratory ability, as seen in melanoma3,4,5,6. Over the last few decades, researchers have made remarkable discoveries about the roles and mechanisms of NCCs in development and diseases, with the majority of findings being focused on chemical signals7,8. More recently, mechanical signals have been indicated to play a critical but poorly understood role in NCC development9,10.
The environmental cues of NCCs play a critical role during their development, including the regulation of NCC differentiation into various cell types. Environmental cues, e.g., physical cues, influence pivotal behaviors and cellular responses, such as functional diversification. Mechanotransduction allows cells to sense and respond to those cues to maintain various biological processes2. NCCs are surrounded by neighboring cells and different substrates, such as the extracellular matrix (ECM), which can give rise to mechanical stimuli to maintain homeostasis and adapt to the changes through fate determination, proliferation, and apoptosis11. Mechanotransduction begins at the plasma membrane where the sensory component of mechanical extracellular stimuli occurs, resulting in the intracellular regulation of the cell12. Integrins, focal adhesions, and junctions of the plasma membrane relay mechanical signals, such as shearing forces, stress, and the stiffness of surrounding substrates, into chemical signals to produce cellular responses12. The relaying of chemical signals from the plasma membrane to the final cellular regulation is carried out via different signaling pathways to finalize vital processes for the organism, such as differentiation.
Several studies have suggested that mechanical signaling from substrate stiffness plays a role in cell differentiation13,14. For instance, previous studies have shown that mesenchymal stem cells (MSCs) grown on soft substrates with a stiffness similar to that of brain tissue (in the range of 0.1-1.0 kPa) resulted in neuronal cell differentiation15,16. However, more MSCs differentiate into myocyte-like cells when grown on 8-17 kPa substrates mimicking the stiffness of muscle, while osteoblast-like differentiation was observed when MSCs were cultured on stiff substrates (25-40 kPa)15,16. The significance of mechanotransduction is highlighted by the irregularities and abnormalities in the mechanical signaling pathway that potentially lead to severe developmental defects and diseases, including cancer, cardiovascular diseases, and osteoporosis17,18,19. In cancers, normal breast tissue is soft, and the risk of breast cancer increases in stiff and dense breast tissue, an environment that is more akin to breast tumors15. With this knowledge, the effects of mechanical signaling on NCC development can be studied through simple manipulation of substrate stiffness through an in vitro system, providing further advantages and possibilities in understanding the fundamentals of NC-related disease progression and etiology.
To study the impact of mechanical signals in NCCs, we established an efficient in vitro system for NCCs based on the optimization of previously published methods and evaluation of the responses of NCCs to different mechanical signals20,21. A detailed protocol was provided for varying hydrogel stiffness preparation and evaluation of the impact of mechanical signaling in NCCs. To achieve this, O9-1 NCCs are utilized as the NC&#160;model to study the effects and changes in response to stiff versus soft hydrogels. O9-1 NCCs are a stable NC cell line isolated from mouse embryo (E) at day 8.5. O9-1 NCCs mimic NCCs in vivo because they can differentiate into various NC-derived cell types in defined differentiation media22. To study the mechanical signaling of NCCs, a matrix substrate was fabricated with tunable elasticity from varying concentrations of acrylamide and bis-acrylamide solutions to achieve the desired stiffness, correlating to the biological substrate stiffness20,21,23. To optimize the conditions of matrix substrate for NCCs, specifically O9-1 cells, modifications were made from the previously published protocol20. One change made in this protocol was to incubate hydrogels in collagen I, diluted in 0.2% acetic acid instead of 50 mM HEPES, at 37 &#176;C overnight. The low pH of acetic acid leads to a homogeneous distribution and higher collagen I incorporation, thus allowing for a more uniform attachment of the ECM protein24. In addition, a combination of horse serum and fetal bovine serum (FBS) was used at the concentrations of 10% and 5% in phosphate buffer saline (PBS), respectively, before storing the hydrogels in the incubator. Horse serum was used as an additional supplement to FBS due to its ability to promote cell proliferation and differentiation at the concentration of 10%25.
With this method, a biological environment was mimicked by the ECM protein coating (e.g., Collagen I) to create an accurate in vitro environment for NCCs to grow and survive20,21. The stiffness of the prepared hydrogels was quantitatively analyzed via atomic force microscopy (AFM), a well-known technique to depict the elastic modulus26. To study the effect of different stiffness levels on NCCs, wild-type O9-1 cells were cultured and prepared on hydrogels for immunofluorescence (IF) staining against filamentous actin (F-actin) to show the differences in cell adhesion and morphologies in response to changes in substrate stiffness. Utilizing this in vitro system, researchers will be able to study the roles of mechanical signaling in NCCs and its interaction with other chemical signals to gain a deeper understanding of the relationship between NCCs and mechanical signaling.

<table><tbody><tr><td>12 mm #1 Corning 0211 Glass Coverslip</td><td>Chemglass Life Sciences</td><td>CLS-1763-012</td><td></td></tr><tr><td>2% Bis-Acrylamide</td><td>Sigma Aldrich</td><td>M1533</td><td></td></tr><tr><td>24-well plate</td><td>Greiner Bio-one</td><td>662165</td><td></td></tr><tr><td>25 mm #1 Corning 0211 Glass Coverslip</td><td>Chemglass Life Sciences</td><td>CLS-1763-025</td><td></td></tr><tr><td>3-aminopropyl triethoxysilane (APTS)</td><td>Sigma Aldrich</td><td>A3648</td><td></td></tr><tr><td>4-well cell culture plate</td><td>Thermo Scientific</td><td>179830</td><td></td></tr><tr><td>4% Paraformaldehyde</td><td>Sigma Aldrich</td><td>J61899-AP</td><td></td></tr><tr><td>40% Acrylamide</td><td>Sigma Aldrich</td><td>A4058</td><td></td></tr><tr><td>50% glutaraldehyde</td><td>Sigma Aldrich</td><td>G7651</td><td></td></tr><tr><td>6-well cell culture plate</td><td>Greiner Bio-one</td><td>657160</td><td></td></tr><tr><td>AFM cantilever (spherical bead)</td><td>Novascan</td><td></td><td></td></tr><tr><td>AFM software</td><td>Catalyst NanoScope</td><td></td><td>Model: 8.15 SR3R1</td></tr><tr><td>Alexa Fluor 488 Phalloidin</td><td>Thermo Fisher</td><td>A12379</td><td></td></tr><tr><td>Ammonium Persulfate (APS)</td><td>Sigma Aldrich</td><td>248614</td><td>Powder</td></tr><tr><td>anti-AP-2&amp;alpha; Antibody</td><td>Santa Cruz</td><td>sc-12726</td><td></td></tr><tr><td>anti-Vinculin antibody</td><td>Abcam</td><td>ab129002</td><td></td></tr><tr><td>Atomic Force Microscopy (AFM) Bioscope Catalyst</td><td>Bruker Corporation</td><td></td><td></td></tr><tr><td>Collagen type I (100mg)</td><td>Corning</td><td>354236</td><td></td></tr><tr><td>DAPI (4&#039;,6-Diamidino-2-Phenylindole, Dihydrochloride)</td><td>Thermo Fisher</td><td>D1306</td><td></td></tr><tr><td>Dichloromethylsilane (DCMS)</td><td>Sigma Aldrich</td><td>440272</td><td></td></tr><tr><td>Donkey serum</td><td>Sigma Aldrich</td><td>D9663</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM)</td><td>Corning</td><td>10-017-CV</td><td></td></tr><tr><td>Fetal bovine serum (FBS)</td><td>Corning</td><td>35-010-CV</td><td></td></tr><tr><td>Fluorescence microscope</td><td>Leica</td><td></td><td>Model DMi8</td></tr><tr><td>Fluoromount-G mounting medium</td><td>SouthernBiotech</td><td>0100-35</td><td></td></tr><tr><td>HEPES</td><td>Sigma Aldrich</td><td>H3375</td><td>Powder</td></tr><tr><td>Horse serum</td><td>Corning</td><td>35-030-CI</td><td></td></tr><tr><td>iScript Reverse Transcription Supermix</td><td>Bio-Rad</td><td>1708841</td><td></td></tr><tr><td>Penicillin-Streptomycin antibiotic</td><td>Thermo Fisher</td><td>15140148</td><td></td></tr><tr><td>RNeasy micro kit</td><td>Qiagen</td><td>74004</td><td></td></tr><tr><td>Sterile 1x PBS</td><td>Hyclone</td><td>SH30256.02</td><td></td></tr><tr><td>Sterile deionized water</td><td>Hardy Diagnostics</td><td>U284</td><td></td></tr><tr><td>sulfo-SANPAH</td><td>Thermo Fisher</td><td>22589</td><td></td></tr><tr><td>SYBR green</td><td>Applied Biosystems</td><td>4472908</td><td></td></tr><tr><td>TEMED</td><td>Sigma Aldrich</td><td>T9281</td><td></td></tr><tr><td>Triton X-100</td><td>Sigma Aldrich</td><td>X100</td><td></td></tr><tr><td>Tween 20</td><td>Sigma Aldrich</td><td>P9416</td><td></td></tr></tbody></table>

an optimized o9-1/hydrogel system for studying mechanical signals in neural crest cells

Neural crest cells (NCCs) are vertebrate embryonic multipotent cells that can migrate and differentiate into a wide array of cell types that give rise to various organs and tissues. Tissue stiffness produces mechanical force, a physical cue that plays a critical role in NCC differentiation; however, the mechanism remains unclear. The method described here provides detailed information for the optimized generation of polyacrylamide hydrogels of varying stiffness, the accurate measurement of such stiffness, and the evaluation of the impact of mechanical signals in O9-1 cells, a NCC line that mimics in vivo NCCs.
Hydrogel stiffness was measured using atomic force microscopy (AFM) and indicated different stiffness levels accordingly. O9-1 NCCs cultured on hydrogels of varying stiffness showed different cell morphology and gene expression of stress fibers, which indicated varying biological effects caused by mechanical signal changes. Moreover, this established that varying the hydrogel stiffness resulted in an efficient in vitro system to manipulate mechanical signaling by altering gel stiffness and analyzing the molecular and genetic regulation in NCCs. O9-1 NCCs can differentiate into a wide range of cell types under the influence of the corresponding differentiation media, and it is convenient to manipulate chemical signals in vitro. Therefore, this in vitro system is a powerful tool to study the role of mechanical signaling in NCCs and its interaction with chemical signals, which will help researchers better understand the molecular and genetic mechanisms of neural crest development and diseases.

Hydrogel preparation and stiffness assessment through AFM and the Hertz model 
Here, a detailed protocol is provided to generate polyacrylamide hydrogels of varying stiffness by regulating the ratio of acrylamide and bis-acrylamide. However, the polyacrylamide hydrogels are not ready for the adhesion of cells due to the lack of ECM proteins. Thus, sulfo-SANPAH, acting as a linker, covalently binds to the hydrogels and reacts with the primary amines of ECM proteins to allow the adhesion of ECM protei...

Watch this Scientific Journal Video about An Optimized O9-1/Hydrogel System for Studying Mechanical Signals in Neural Crest Cells at JoVE.com

An Optimized O9-1/Hydrogel System for Studying Mechanical Signals in Neural Crest Cells

Detailed step-by-step protocols are described here for studying mechanical signals in vitro using multipotent O9-1 neural crest cells and polyacrylamide hydrogels of varying stiffness.

Neural crest cells (NCCs) are vertebrate embryonic multipotent cells that can migrate and differentiate into a wide array of cell types that give rise to ...

an-optimized-o9-1hydrogel-system-for-studying-mechanical-signals

Research

JoVE Journal

Developmental Biology

2.9K Views.  The University of Texas Health Science Center at Houston. De methode helpt bij de studie van de mechanische signalering van de neurale crest-cellen en de interactie met chemische signalen. Het kan ook helpen bij de moleculaire en genetische mechanismen van de ontwikkeling van de neurale top bij ziekten. Het overbrengen van de glassportreten is het meest uitdagend, daarom breng je ze langzaam en aandachtig over om te voorkomen dat ze breken en vallen.De procedure wordt gedemonstreerd door mij en Dr. Sherry Zhao, een postdoctoraal fellow uit mi...

Video: An Optimized O9-1/Hydrogel System for Studying Mechanical Signals in Neural Crest Cells

Assessing Neural Stem Cell Motility Using an Agarose Gel-based Microfluidic Device

While microfluidic technology is reaching a new level of maturity for macromolecular assays, cell-based assays are still at an infant stage1. This is largely due to the difficulty with which one can create a cell-compatible and steady microenvironment using conventional microfabrication techniques and materials. We address this problem via the introduction of a novel microfabrication material, agarose gel, as the base material for the microfluidic device. Agarose gel is highly malleable, and permeable to gas and nutrients necessary for cell survival, and thus an ideal material for cell-based assays. We have shown previously that agarose gel based devices have been successful in studying bacterial and neutrophil cell migration2. In this report, three parallel microfluidic channels are patterned in an agarose gel membrane of about 1mm thickness. Constant flows with media/buffer are maintained in the two side channels using a peristaltic pump. Cells are maintained in the center channel for observation. Since the nutrients and chemicals in the side channels are constantly diffusing from the side to center channel, the chemical environment of the center channel is easily controlled via the flow along the side channels. Using this device, we demonstrate that the movement of neural stem cells can be monitored optically with ease under various chemical conditions, and the experimental results show that the over expression of epidermal growth factor receptors (EGFR) enhances the motility of neural stem cells. Motility of neural stem cells is an important biomarker for assessing cells aggressiveness, thus tumorigenic factor3. Deciphering the mechanism underlying NSC motility will yield insight into both disorders of neural development and into brain cancer stem cell invasion.

We demonstrate that the over expression of epidermal growth factor receptors (EGFR) enhances the motility of neural stem cells(NSCs) using a novel agarose gel based microfluidic device. This technology can be readily adaptable to other mammalian cell systems where cell sources are scarce, such as human neural stem cells, and the turn around time is critical.

While microfluidic technology is reaching a new level of maturity for macromolecular assays, cell-based assays are still at an infant stage1. This is ...

Biology

Culturing and Manipulation of O9-1 Neural Crest Cells

Neural crest cells (NCCs) are migrating multipotent stem cells that can differentiate into different cell types and give rise to multiple tissues and organs. The O9-1 cell line is derived from the endogenous mouse embryonic NCCs and maintains its multipotency. However, under specific culture conditions, O9-1 cells can differentiate into different cell types and be utilized in a wide range of research applications. Recently, with the combination of mouse studies and O9-1 cell studies, we have shown that the Hippo signaling pathway effectors Yap and Taz play important roles in neural crest-derived craniofacial development. Although the culturing process for O9-1 cells is more complicated than that used for other cell lines, the O9-1 cell line is a powerful model for investigating NCCs in vitro. Here, we present a protocol for culturing the O9-1 cell line to maintain its stemness, as well as protocols for differentiating O9-1 cells into different cell types, such as smooth muscle cells and osteoblasts. In addition, protocols are described for performing gene loss-of-function studies in O9-1 cells by using CRISPR-Cas9 deletion and small interfering RNA-mediated knockdown.

O9-1 is a multipotent mouse neural crest cell line. Here we describe detailed step-by-step protocols for culturing O9-1 cells, differentiating O9-1 cells into specific cell types, and genetically manipulating O9-1 cells by using siRNA-mediated knockdown or CRISPR-Cas9 genome editing.

Neural crest cells (NCCs) are migrating multipotent stem cells that can differentiate into different cell types and give rise to multiple tissues and ...

Genetics

Preparation of Hydroxy-PAAm Hydrogels for Decoupling the Effects of Mechanotransduction Cues

It is now well established that many cellular functions are regulated by interactions of cells with physicochemical and mechanical cues of their extracellular matrix (ECM) environment. Eukaryotic cells constantly sense their local microenvironment through surface mechanosensors to transduce physical changes of ECM into biochemical signals, and integrate these signals to achieve specific changes in gene expression. Interestingly, physicochemical and mechanical parameters of the ECM can couple with each other to regulate cell fate. Therefore, a key to understanding mechanotransduction is to decouple the relative contribution of ECM cues on cellular functions.
Here we present a detailed experimental protocol to rapidly and easily generate biologically relevant hydrogels for the independent tuning of mechanotransduction cues in vitro. We chemically modified polyacrylamide hydrogels (PAAm) to surmount their intrinsically non-adhesive properties by incorporating hydroxyl-functionalized acrylamide monomers during the polymerization. We obtained a novel PAAm hydrogel, called hydroxy-PAAm, which permits immobilization of any desired nature of ECM proteins. The combination of hydroxy-PAAm hydrogels with microcontact printing allows to independently control the morphology of single-cells, the matrix stiffness, the nature and the density of ECM proteins. We provide a simple and rapid method that can be set up in every biology lab to study in vitro cell mechanotransduction processes. We validate this novel two-dimensional platform by conducting experiments on endothelial cells that demonstrate a mechanical coupling between ECM stiffness and the nucleus.

We present a new polyacrylamide hydrogel, called hydroxy-PAAm, that allows a direct binding of ECM proteins with minimal cost or expertise. The combination of hydroxy-PAAm hydrogels with microcontact printing facilitates independent control of many cues of the natural cell microenvironment for studying cellular mechanostransduction.

It is now well established that many cellular functions are regulated by interactions of cells with physicochemical and mechanical cues of their ...

Bioengineering

Dissection, Culture and Analysis of Primary Cranial Neural Crest Cells from Mouse for the Study of Neural Crest Cell Delamination and Migration

Over the past several decades there has been an increased availability of genetically modified mouse models used to mimic human pathologies. However, the ability to study cell movements and differentiation in vivo is still very difficult. Neurocristopathies, or disorders of the neural crest lineage, are particularly challenging to study due to a lack of accessibility of key embryonic stages and the difficulties in separating out the neural crest mesenchyme from adjacent mesodermal mesenchyme. Here, we set out to establish a well-defined, routine protocol for the culture of primary cranial neural crest cells. In our approach we dissect out the mouse neural plate border during the initial neural crest induction stage. The neural plate border region is explanted and cultured. The neural crest cells form in an epithelial sheet surrounding the neural plate border, and by 24 h after explant, begin to delaminate, undergoing an epithelial-mesenchymal transition (EMT) to become fully motile neural crest cells. Due to our two-dimensional culturing approach, the distinct tissue populations (neural plate versus premigratory and migratory neural crest) can be readily distinguished. Using live imaging approaches, we can then identify changes in neural crest induction, EMT and migratory behaviors. The combination of this technique with genetic mutants will be a very powerful approach for understanding normal and pathological neural crest cell biology.

This protocol describes the dissection and culture of cranial neural crest cells from mouse models, primarily for the study of cell migration. We describe the live imaging techniques used and the analysis of speed and cell shape changes.

Over the past several decades there has been an increased availability of genetically modified mouse models used to mimic human pathologies. However, the ...

In Vitro Investigation of the Effects of the Hyaluronan-Rich Extracellular Matrix on Neural Crest Cell Migration

Neural crest cells (NCCs) are highly migratory cells that originate from the dorsal region of the neural tube. The emigration of NCCs from the neural tube is an essential process for NCC production and their subsequent migration toward target sites. The migratory route of NCCs, including the surrounding neural tube tissues, involves hyaluronan (HA)-rich extracellular matrix. To model NCC migration into these HA-rich surrounding tissues from the neural tube, a mixed substrate migration assay consisting of HA (average molecular weight: 1,200-1,400 kDa) and collagen type I (Col1) was established in this study. This migration assay demonstrates that NCC cell line, O9-1, cells are highly migratory on the mixed substrate and that the HA coating is degraded at the site of focal adhesions in the course of migration. This in vitro model can be useful for further exploration of the mechanistic basis involved in NCC migration. This protocol is also applicable for evaluating different substrates as scaffolds to study NCC migration.

In Vitro Investigation of the Effects of the Hyaluronan-Rich Extracellular Matrix on Neural Crest Cell Migration

This protocol outlines an in vitro migration experiment suitable for the functional analysis of the molecules involved in the in vivo migration of neural crest cells into the hyaluronan-rich extracellular matrix.

Neural crest cells (NCCs) are highly migratory cells that originate from the dorsal region of the neural tube. The emigration of NCCs from the neural tube ...

Longitudinal Monitoring of Neural Plate Mechanics in Chick Embryo Development

Monitoring the Mechanical Evolution of Tissue During Neural Tube Closure of Chick Embryo

Neural tube closure (NTC) is a critical process during embryonic development. Failure in this process can lead to neural tube defects, causing congenital malformations or even mortality. NTC involves a series of mechanisms on genetic, molecular, and mechanical levels. While mechanical regulation has become an increasingly attractive topic in recent years, it remains largely unexplored due to the lack of suitable technology for conducting mechanical testing of 3D embryonic tissue in situ. In response, we have developed a protocol for quantifying the mechanical properties of chicken embryonic tissue in a non-contact and non-invasive manner. This is achieved by integrating a confocal Brillouin microscope with an on-stage incubation system. To probe tissue mechanics, a pre-cultured embryo is collected and transferred to an on-stage incubator for ex ovo culture. Simultaneously, the mechanical images of the neural plate tissue are acquired by the Brillouin microscope at different time points during development. This protocol includes detailed descriptions of sample preparation, the implementation of Brillouin microscopy experiments, and data post-processing and analysis. By following this protocol, researchers can study the mechanical evolution of embryonic tissue during development longitudinally.

Author Spotlight: Non-Contact Measurement of Tissue Mechanics in Live Chick Embryos Using Brillouin Microscopy

This protocol was developed to longitudinally monitor the mechanical properties of neural plate tissue during chick embryo neurulation. It is based on the integration of a Brillouin microscope and an on-stage incubation system, enabling live mechanical imaging of neural plate tissue in ex ovo cultured chick embryos.

Neural tube closure (NTC) is a critical process during embryonic development. Failure in this process can lead to neural tube defects, causing congenital ...

Preparation of Tunable Extracellular Matrix Microenvironments to Evaluate Schwann Cell Phenotype Specification

Traumatic peripheral nervous system (PNS) injuries currently lack suitable treatments to regain full functional recovery. Schwann cells (SCs), as the major glial cells of the PNS, play a vital role in promoting PNS regeneration by dedifferentiating into a regenerative cell phenotype following injury. However, the dedifferentiated state of SCs is challenging to maintain through the time-period needed for regeneration and is impacted by changes in the surrounding extracellular matrix (ECM). Therefore, determining the complex interplay between SCs and differing ECM to provide cues of regenerative potential of SCs is essential. To address this, a strategy was created where different ECM proteins were adsorbed onto a tunable polydimethylsiloxane (PDMS) substrate which provided a platform where stiffness and protein composition can be modulated. SCs were seeded onto the tunable substrates and critical cellular functions representing the dynamics of SC phenotype were measured. To illustrate the interplay between SC protein expression and cellular morphology, differing seeding densities of SCs in addition to individual microcontact printed cellular patterns were utilized and characterized by immunofluorescence staining and western blot. Results showed that cells with a smaller spreading area and higher extent of cellular elongation promoted higher levels of SC regenerative phenotypic markers. This methodology not only begins to unravel the significant relationship between the ECM and cellular function of SCs, but also provides guidelines for the future optimization of biomaterials in peripheral nerve repair.

This methodology aims to illustrate the mechanisms by which extracellular matrix cues such as substrate stiffness, protein composition and cell morphology regulate Schwann cell (SC) phenotype.

Traumatic peripheral nervous system (PNS) injuries currently lack suitable treatments to regain full functional recovery. Schwann cells (SCs), as the ...

A Microbiomechanical System for Studying Varicosity Formation and Recovery in Central Neuron Axons

Axonal varicosities are enlarged structures along the shafts of axons with a high degree of heterogeneity. They are present not only in brains with neurodegenerative diseases or injuries, but also in the normal brain. Here, we describe a newly-established micromechanical system to rapidly, reliably, and reversibly induce axonal varicosities, allowing us to understand the mechanisms governing varicosity formation and heterogeneous protein composition. This system represents a novel means to evaluate the effects of compression and shear stress on different subcellular compartments of neurons, different from other in vitro systems that mainly focus on the effect of stretching. Importantly, owing to the unique features of our system, we recently made a novel discovery showing that the application of pressurized fluid can rapidly and reversibly induce axonal varicosities through the activation of a transient receptor potential channel. Our biomechanical system can be utilized conveniently in combination with drug perfusion, live cell imaging, calcium imaging, and patch clamp recording. Therefore, this method can be adopted for studying mechanosensitive ion channels, axonal transport regulation, axonal cytoskeleton dynamics, calcium signaling, and morphological changes related to traumatic brain injury.

This protocol describes a physiologically relevant, pressurized fluid approach for rapid and reversible induction of varicosities in neurons.

Axonal varicosities are enlarged structures along the shafts of axons with a high degree of heterogeneity. They are present not only in brains with ...

Neuroscience

Generation of 3-D Collagen-based Hydrogels to Analyze Axonal Growth and Behavior During Nervous System Development

This protocol uses natural type I collagen to generate three-dimensional (3-D) hydrogel for monitoring and analyzing the axonal growth. The protocol is centered on culturing small pieces of embryonic or early postnatal rodent brains inside a 3-D hydrogel formed by the rat tail tendon-derived type I collagen with specific porosity. Tissue pieces are cultured inside the hydrogel and confronted to specific brain fragments or genetically-modified cell aggregates to produce and secrete molecules suitable for creating a gradient inside the porous matrix. The steps of this protocol are simple and reproducible but include critical steps to be considered carefully during its development. Moreover, the behavior of growing axons can be monitored and analyzed directly using a phase-contrast microscope or mono/multiphoton fluorescence microscope after fixation by immunocytochemical methods.

Here, we provide a method for analyzing the behavior of growing axons in 3D matrices, mimicking their natural development.

This protocol uses natural type I collagen to generate three-dimensional (3-D) hydrogel for monitoring and analyzing the axonal growth. The protocol is ...

Single Cell Durotaxis Assay for Assessing Mechanical Control of Cellular Movement and Related Signaling Events

Durotaxis is the process by which cells sense and respond to gradients of tension. In order to study this process in vitro, the stiffness of the substrate underlying a cell must be manipulated. While hydrogels with graded stiffness and long-term migration assays have proven useful in durotaxis studies, immediate, acute responses to local changes in substrate tension allow focused study of individual cell movements and subcellular signaling events. To repeatably test the ability of cells to sense and respond to the underlying substrate stiffness, a modified method for application of acute gradients of increased tension to individual cells cultured on deformable hydrogels is used which allows for real time manipulation of the strength and direction of stiffness gradients imparted upon cells in question. Additionally, by fine tuning the details and parameters of the assay, such as the shape and dimensions of the micropipette or the relative position, placement, and direction of the applied gradient, the assay can be optimized for the study of any mechanically sensitive cell type and system. These parameters can be altered to reliably change the applied stimulus and expand the functionality and versatility of the assay. This method allows examination of both long term durotactic movement as well as more immediate changes in cellular signaling and morphological dynamics in response to changing stiffness.

Mechanical forces are important for controlling cell migration. This protocol demonstrates the use of elastic hydrogels that can be deformed using a glass micropipette and a micromanipulator to stimulate cells with a local stiffness gradient to elicit changes in cell structure and migration.

Durotaxis is the process by which cells sense and respond to gradients of tension. In order to study this process in vitro, the stiffness of the substrate ...

An Optimized O9-1/Hydrogel System for Studying Mechanical Signals in Neural Crest Cells

Samenvatting

Meer video's verkennen