This work was supported by the Medical Research Fund project of Guangdong Province (A2022363) and the major project of the Guangdong Committee of Science and Technology, China (grant no.2022).
We would like to thank Qingjian Chen of the University of Maryland, College Park for the help during the preparation of this manuscript.

The histories of the families were obtained by interviewing the family members. The study was approved by the Ethics Committee of the Guangdong Provincial Hospital of Chinese Medicine (No. 2019074). Informed written consent was obtained from all the family members. All the animals are treated in accordance with the ethical guidelines of the Guangdong Provincial Hospital of Chinese Medicine (Guangzhou, China).
1. Study subjects
NOTE: The proband III-3 sought medical advice in the Department of Cardiovascular Surgery of the Guangdong Provincial Hospital of Chinese Medicine in July 2019.
<ol>
	<li>Obtain detailed family medical history of the proband. Notify and call all the family members of the proband. All the family members have undergone meticulous physical examinations.
	<ol>
		<li>Perform a systematic review of all clinical data, including medical records, ECGs, echocardiograms, and cardiac catheterization reports.</li>
		<li>Reconfirm cardiac phenotypes in all the patients during intervention or surgery.</li>
	</ol>
	</li>
	<li>Select a total of 174 population-based healthy controls from the local database. Collect approximately 4.0 mL of peripheral venous blood from each patient.</li>
</ol>
2. DNA extraction
NOTE: DNA is extracted with a commercial blood kit according to the manufacturer&#39;s instructions.
<ol>
	<li>Lyse blood cells with an anionic detergent in the presence of a DNA stabilizer following the manufacturer&#39;s protocol.</li>
	<li>Add 10 &#181;L of RNase A solution to the cell lysate and mix by inverting the tube 25 times. Incubate at 37 &#176;C for 15 min to 1 h.</li>
	<li>Remove proteins by salt precipitation. Use protein precipitation solution (0.25 mg of bovine serum albumin dissolved in 25 mL of distilled water) and 100% isopropanol to precipitate proteins. Then, use 200 &#181;L of 70% ethanol and perform centrifugation at 12,000 x g/min at 4 &#176;C for 15 min to wash the DNA pellet.</li>
	<li>Recover the genomic DNA by precipitation with 500 &#181;L of 70% ethanol. Centrifuge at 12,000 x g for 30 s. Aspirate and then dissolve the pellet in hydration solution (1 mM EDTA, 10 mM Tris&#183;Cl, pH 7.5).</li>
	<li>Use a spectrophotometer (e.g., NanoDrop 2000) to determine purity. Purified DNA typically has an A260/A280 ratio between 1.7 and 1.9 and is up to 200 kb in size.</li>
	<li>Store the DNA for a long term at 2-8, -20, or -80 &#176;C.</li>
</ol>
3.&#160;Whole exome sequencing and variant analysis
NOTE: To systematically search for disease-causing gene mutations, exome sequencing in affected individuals (II-5, II-7, III-3, III-7, III-8, III-9, and IV-3) and unaffected individuals (III-2, III-5, IV-4) was performed.
<ol>
	<li>Use exome probe according to the manufacturer&#39;s instructions to perform the exome capture.</li>
	<li>Apply the qualified libraries to 2 &#215; 150 bp paired-end sequencing on the HiSeq X-ten platform. Please see Supplemental File 1.</li>
	<li>Align FASTQ files to the human reference genome (hg19/GRCh37) with BWA v0.7.1318,19. Sort the aligned files (sam/bam format files) with samtools, and then flag duplicates using Picard. Please see Supplemental File 1.</li>
	<li>Use GATK, realign reads locally and recalibrate base qualities. Please see Supplemental File 1.</li>
	<li>Generate mapping statistics that include coverage and depth from recalibrated files by BEDTools and in-house perl/python scripts.</li>
	<li>Genotype variants (SNVs and indels) from recalibrated BAM files using the multi-sample processing mode of the HaplotypeCaller tool from GATK.</li>
	<li>Use VQSR (variant quality score recalibration) to reduce false positives of variant calling.</li>
	<li>Annotate SNVs and indels using ANNOVAR software21 against multiple databases, including the Exome Aggregation Consortium (ExAC) (http://exac.broadinstitute.org), the Exome Sequencing Project (ESP) (https://esp.gs.washington.edu), and 1,000 G (http://www.1000genomes.org). Interpret the pathogenicity of the sequence variants according to the ACMG guidelines.</li>
</ol>
4. Sanger sequencing
<ol>
	<li>Perform Sanger sequencing to confirm potential causative variants and determine variant segregation in the family using an ABI 3500 sequencer23.</li>
	<li>Design primer sequences for the variant in the MYH7 gene (NM_000257) as follows: 5&#39;-TTCAAACACAGAGACCTGCAGG-3&#39; and 5&#39;- CGGACTTCTCTAGCGCCTCTT -3&#39;.</li>
	<li>Confirm a variant, screen all the available family members to determine variant segregation within the family23.</li>
</ol>
5. Generation of C57BL/6N-MYH7em1(G823E) knockin mice
<ol>
	<li>Use the CRISPR/Cas9 system to generate C57BL/6N-Myh7em1(G823E) knockin mice. The mouse Myh7 gene (GenBank accession number: NM_001361607.1; Ensembl: ENSMUSG00000053093) is located on mouse chromosome 14 and has 41 exons. The ATG start codon in exon 4 and TAG stop codon in exon 41, and the G823E is located on exon 23. Select exon 23 as the target site.</li>
	<li>Design the sequence of gRNA targeting vector and donor oligo (with targeting sequence, flanked by 134 bp homologous sequences combined on both sides).
	<ol>
		<li>Log in to the NCBI website and click on the BLAST online primer design function on the right.</li>
		<li>Click on the Primer-BLAST function at the bottom of the page to design primers.</li>
		<li>Paste the MYH7 NCBI reference sequence number NM_000257.4 into the PCR template box.</li>
		<li>Amplify the target fragment (MYH7 cDNA exon 23 and its adjacent exons) so design the upstream primer on exon 21 (2392-2528) and the downstream primer on exon 25 (3205-3350). Enter the exon number of the upstream and downstream primers into the right range box.</li>
		<li>Click on the Get Primers button at the bottom to automatically generate multiple pairs of primers.</li>
	</ol>
	</li>
	<li>Input the MYH7 gene into ZFIN database, introduce the p.g823e (GGG to GAG) mutation site in the donor oligonucleotide and the silent mutation p.r819 (AGG to CGA) into exon 23. The silent mutation prevents the binding and re-cutting of the sequence by gRNA after homology-directed repair.
	<ol>
		<li>Design gRNA according to the general sequence, the sequences at both ends are TAATACGACTCACTATA- and -GTTTTAGAGCTA. The middle of the sequence is the target site mentioned above.</li>
	</ol>
	</li>
	<li>Co-inject Cas9 mRNA, gRNA generated by in vitro transcription and donor oligo into fertilized eggs for KI mouse production.
	<ol>
		<li>Use the Cas9/gRNA target efficiency detection kit to transcribe the designed gRNA target into gRNA in vitro and detect the activity of the transcript (see the VK007 kit instructions for specific detection methods) according to manufacturer&#39;s protocol.</li>
		<li>Thaw the T7 ARCA mRNA kit components, mix, and pulse-spin in a microfuge to collect solutions to the bottoms of the tubes. Assemble the reaction at room temperature in the following order: 2x ARCA/NTP mix to 10 &#181;L, 1 &#181;g of template DNA, 2 &#181;L of T7 RNA polymerase mix, and nuclease-free water to 20 &#181;L.</li>
		<li>Mix thoroughly and pulse-spin in a microfuge. Incubate at 37 &#176;C for 30 min.</li>
		<li>Remove the template DNA by adding 2 &#181;L of DNase I, mix well, and incubate at 37 &#176;C for 15 min to obtain mRNA.</li>
		<li>Perform intraperitoneal injection of serum gonadotropin and human chorionic gonadotropin into pre-prepared C57BL/6 female mice at about 4 weeks old with a 0.5 mL syringe at a dose of approximately 5 U per mouse with an interval between the two injections of 48 h.</li>
		<li>Eighteen hours after dosing, sacrifice C57BL/6 female mice and one 8-12-week-old C57BL/6 male mouse by cervical dislocation after hormone injection. Collect the eggs and sperm separately.</li>
		<li>The sperm is capacitated in the capacitation fluid. Take and drop the sperm at the edge of the fluid into the short-lived egg cells for in vitro fertilization for 3-4 h.</li>
		<li>Dilute the successfully transcribed gRNA and Cas9 mRNA in vitro with RNase-free water to 25 ng/&#181;L and 50 ng/&#181;L. Introduce into the cytoplasm of mouse fertilized eggs by microinjection. Transplant fertilized eggs in good condition into the enlarged oviduct of the female mice. Co-cage with ligated male mice.</li>
	</ol>
	</li>
	<li>Genotype the pups by PCR. Use the following PCR conditions: 94 &#176;C for 3 min, 35 cycles of 94 &#176;C for 30 s, 60 &#176;C for 35 s, and 72 &#176;C for 35 s; 72 &#176;C for 5 min. Follow with sequence analysis.
	<ol>
		<li>Cut the tails of 4-month-old mice with scissors and place them into 1.5 mL EP tube. Add 180 &#181;L of Buffer GL, 20 &#181;L of Proteinase K, and 10 &#181;L of RNase A per tail piece (2-5 mm) in a microcentrifuge tube. Be careful not to cut too much tail.</li>
		<li>Incubate the tube at 56 &#176;C overnight.</li>
		<li>Spin in a microcentrifuge tube at 1,000 x g for 2 min to remove impurities.</li>
		<li>Add 200 &#181;L of Buffer GB and 200 &#181;L of absolute ethyl alcohol with sufficient mixing.</li>
		<li>Place the spin column in a collection tube. Apply the sample to the spin and centrifuge at 1,000 x g for 2 min. Discard the flow-through.</li>
		<li>Add 500 &#181;L of Buffer WA to the spin column and centrifuge at 1,000 x g for 1 min. Discard the flow-through.</li>
		<li>Add 700 &#181;L of Buffer WB to the spin column and centrifuge at 1,000 x g for 1 min. Discard the flow-through. 
		NOTE: Make sure the Buffer WB has been premixed with 100% ethanol. When adding Buffer WB, add to the tube wall to wash off the residual salt.</li>
		<li>Repeat step 5.5.7.</li>
		<li>Place the spin column in a collection tube and centrifuge at 1,000 x g for 2 min.</li>
		<li>Place the spin column in a new 1.5 mL tube. Add 50-200 &#181;L of sterilized water or elution buffer to the center of the column membrane and let the column stand for 5 min. 
		NOTE: Heating sterilized water or elution buffer up to 65 &#176;C can increase the yield of elution.</li>
		<li>To elute DNA, centrifuge the column at 1,000 x g for 2 min. To increase the yield of DNA, add the flow-through and/or 50-200 &#181;L of sterilized water or elution buffer to the center of the spin column membrane and let the column stand for 5 min. Centrifuge at 1,000 x g for 2 min.</li>
		<li>Quantify the eluted genomic DNA by electrophoresis.</li>
	</ol>
	</li>
</ol>
6. Evaluation of the cardiac morphology and function
NOTE: Apply M-mode echocardiography to assess heart morphology and function of C57BL/6N-Myh7em1(G823E) knockin mice.
<ol>
	<li>Put the knockin mice into a closed acrylic box connected to the anesthesia machine and adjust the three-way interface to allow isoflurane (concentration: 3%) to flow into the acrylic box. After the knockin mice cease to move autonomously, remove the knockin mice.</li>
	<li>Place the knockin mice flat on the life monitoring platform of the small animal anesthesia machine, and continuous inhalation anesthesia mixed with oxygen (flow: 0.8 L/min) and isoflurane (concentration: 3%). Apply eye lubricant to the anesthetized mice to prevent drying of the cornea.</li>
	<li>Fix the knockin mice horizontally on the platform. Tilt the platform 30&#176; caudal to the knockin mouse. Remove hair on the anterior chest wall of the knocking mouse using a depilatory cream.</li>
	<li>Position the probe vertically with the bump facing the animal&#39;s head. Then, rotate the probe counterclockwise, approximately 45&#176;.</li>
	<li>In the parasternal long-axis view, rotate the probe 90&#176; clockwise to observe the parasternal short-axis view. After rotating the probe 90&#176;, adjust the y-axis displacement to get the correct slice.</li>
	<li>Observe the long-axis image of the heart (Figure 1C), and then select M-mode measurement data.</li>
	<li>Acquire ultrasound data from parasternal long-axis views of mice (Figure 1). Heart rate (HR), left ventricular ejection fraction (LVEF), cardiac output (CO), Left ventricular end-diastolic dimension (LVDd), LVDs left ventricular end-systolic dimension (LVSd), interventricular septum (IVS), and left ventricular posterior wall (LVPW) are measured.</li>
	<li>After the measurement, provide the mice with oxygen, and place them back into their respective cages when they regain autonomous activity.</li>
</ol>

<ol>
	<li>Toepfer, C. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myosin+sequestration+regulates+sarcomere+function,+cardiomyocyte+energetics,+and+metabolism,+informing+the+pathogenesis+of+hypertrophic+cardiomyopathy.">Myosin sequestration regulates sarcomere function, cardiomyocyte energetics, and metabolism, informing the pathogenesis of hypertrophic cardiomyopathy.</a> Circulation. 141 (10), 828-842 (2020).</li><li>Writing Committee Members et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=2020+AHA/ACC+guideline+for+the+diagnosis+and+treatment+of+patients+with+hypertrophic+cardiomyopathy:+A+report+of+the+American+College+of+Cardiology/American+Heart+Association+Joint+Committee+on+Clinical+Practice+Guidelines.">2020 AHA/ACC guideline for the diagnosis and treatment of patients with hypertrophic cardiomyopathy: A report of the American College of Cardiology/American Heart Association Joint Committee on Clinical Practice Guidelines.</a> The Journal of Thoracic and Cardiovascular Surgery. 162 (1), 23-106 (2021).</li><li>Elliott, P., McKenna, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypertrophic+cardiomyopathy.">Hypertrophic cardiomyopathy.</a> Lancet. 363 (9424), 1881-1891 (2004).</li><li>Maron, B. J., Maron, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypertrophic+cardiomyopathy.">Hypertrophic cardiomyopathy.</a> Lancet. 381 (9862), 242-255 (2013).</li><li>Inoue, T., Orgel, L. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nonenzymatic+RNA+polymerase+model.">A nonenzymatic RNA polymerase model.</a> Science. 219 (4586), 859-862 (1983).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (12), 5463-5467 (1977).</li><li>Sachidanandam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+map+of+human+genome+sequence+variation+containing+1.42+million+single+nucleotide+polymorphisms.">A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms.</a> Nature. 409 (6822), 928-933 (2001).</li><li>Ng, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+capture+and+massively+parallel+sequencing+of+12+human+exomes.">Targeted capture and massively parallel sequencing of 12 human exomes.</a> Nature. 461 (7261), 272-276 (2009).</li><li>Wong, K. M., Hudson, T. J., McPherson, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+genetics+of+cancer:+genome+sequencing+and+beyond.">Unraveling the genetics of cancer: genome sequencing and beyond.</a> Annual Review of Genomics and Human Genetics. 12, 407-430 (2011).</li><li>Mattivi, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+utility+of+a+phenotype-enhanced+MYH7-specific+variant+classification+framework+in+hypertrophic+cardiomyopathy+genetic+testing.">Clinical utility of a phenotype-enhanced MYH7-specific variant classification framework in hypertrophic cardiomyopathy genetic testing.</a> Circulation. Genomic and Precision Medicine. 13 (5), 453-459 (2020).</li><li>Jiang, J., Wakimoto, H., Seidman, J. G., Seidman, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+silencing+of+mutant+Myh6+transcripts+in+mice+suppresses+hypertrophic+cardiomyopathy.">Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy.</a> Science. 342 (6154), 111-114 (2013).</li><li>Hayashi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+background+of+Japanese+patients+with+pediatric+hypertrophic+and+restrictive+cardiomyopathy.">Genetic background of Japanese patients with pediatric hypertrophic and restrictive cardiomyopathy.</a> Journal of Human Genetics. 63 (9), 989-996 (2018).</li><li>Gil, W. S., &#193;vila Vidal, L. A., V&#225;squez Salguero, M. A., Cajiao, M. B., Pe&#241;a, C. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+variant+affecting+the+myosin+light+chain+2+related+to+familial+hypertrophic+cardiomyopathy.">Genetic variant affecting the myosin light chain 2 related to familial hypertrophic cardiomyopathy.</a> Intractable &amp; Rare Diseases Research. 9 (4), 229-232 (2020).</li><li>Berge, K. E., Leren, T. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+of+hypertrophic+cardiomyopathy+in+Norway.">Genetics of hypertrophic cardiomyopathy in Norway.</a> Clinical Genetics. 86 (4), 355-360 (2014).</li><li>McNamara, J. W., Schuckman, M., Becker, R. C., Sadayappan, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+homozygous+intronic+variant+in+TNNT2+associates+with+feline+cardiomyopathy.">A novel homozygous intronic variant in TNNT2 associates with feline cardiomyopathy.</a> Frontiers in Physiology. 11, 608473 (2020).</li><li>Wang, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+transcriptome+analysis+of+atrial+septal+defect+identifies+dysregulated+genes+during+heart+septum+morphogenesis.">Comparative transcriptome analysis of atrial septal defect identifies dysregulated genes during heart septum morphogenesis.</a> Gene. 575, 303-312 (2016).</li><li>Andersen, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+yield,+interpretation,+and+clinical+utility+of+mutation+screening+of+sarcomere+encoding+genes+in+Danish+hypertrophic+cardiomyopathy+patients+and+relatives.">Diagnostic yield, interpretation, and clinical utility of mutation screening of sarcomere encoding genes in Danish hypertrophic cardiomyopathy patients and relatives.</a> Human Mutations. 30 (3), 363-370 (2009).</li><li>Nakashima, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lifelong+clinical+impact+of+the+presence+of+sarcomere+gene+mutation+in+Japanese+patients+with+hypertrophic+cardiomyopathy.">Lifelong clinical impact of the presence of sarcomere gene mutation in Japanese patients with hypertrophic cardiomyopathy.</a> Circulation Journal. 84 (10), 1846-1853 (2020).</li><li>Hu, L. R., Kontrogianni-Konstantopoulos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+analysis+of+myocardia+containing+the+Obscurin+R4344Q+mutation+linked+to+hypertrophic+cardiomyopathy.">Proteomic analysis of myocardia containing the Obscurin R4344Q mutation linked to hypertrophic cardiomyopathy.</a> Frontiers in Physiology. 11, 478 (2020).</li><li>Girolami, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+alpha-actinin+2+variant+associated+with+familial+hypertrophic+cardiomyopathy+and+juvenile+atrial+arrhythmias:+a+massively+parallel+sequencing+study.">Novel alpha-actinin 2 variant associated with familial hypertrophic cardiomyopathy and juvenile atrial arrhythmias: a massively parallel sequencing study.</a> Circulation. Cardiovascular Genetics. 7 (6), 741-750 (2014).</li><li>Salazar-Mendiguchia, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+p.(Cys150Tyr)+variant+in+CSRP3+is+associated+with+late-onset+hypertrophic+cardiomyopathy+in+heterozygous+individuals.">The p.(Cys150Tyr) variant in CSRP3 is associated with late-onset hypertrophic cardiomyopathy in heterozygous individuals.</a> European Journal of Medical Genetics. 63 (12), 104079 (2020).</li><li>Teekakirikul, P., Zhu, W., Huang, H. C., Fung, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypertrophic+cardiomyopathy:+An+overview+of+genetics+and+management.">Hypertrophic cardiomyopathy: An overview of genetics and management.</a> Biomolecules. 9 (12), 878 (2019).</li><li>Crossley, B. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+for+Sanger+sequencing+and+molecular+assay+monitoring.">Guidelines for Sanger sequencing and molecular assay monitoring.</a> Journal of Veterinary Diagnostic Investigation. 32 (6), 767-775 (2020).</li><li>Song, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+profile+in+Chinese+patients+with+hypertrophic+cardiomyopathy.">Mutations profile in Chinese patients with hypertrophic cardiomyopathy.</a> Clinica Chimica Acta. 351 (1-2), 209-216 (2005).</li><li>Marian, A. J., Braunwald, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypertrophic+cardiomyopathy:+Genetics,+pathogenesis,+clinical+manifestations,+diagnosis,+and+therapy.">Hypertrophic cardiomyopathy: Genetics, pathogenesis, clinical manifestations, diagnosis, and therapy.</a> Circulation Research. 121 (7), 749-770 (2017).</li><li>Cann, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotype-driven+molecular+autopsy+for+sudden+cardiac+death.">Phenotype-driven molecular autopsy for sudden cardiac death.</a> Clinical Genetics. 91 (1), 22-29 (2017).</li><li>Lafreniere-Roula, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Family+screening+for+hypertrophic+cardiomyopathy:+Is+it+time+to+change+practice+guidelines.">Family screening for hypertrophic cardiomyopathy: Is it time to change practice guidelines.</a> European Heart Journal. 40 (45), 3672-3681 (2019).</li><li>Winkelmann, D. A., Forgacs, E., Miller, M. T., Stock, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+drug-induced+allosteric+changes+to+human+beta-cardiac+myosin+motor+activity.">Structural basis for drug-induced allosteric changes to human beta-cardiac myosin motor activity.</a> Nature Communications. 6, 7974 (2015).</li><li>Garc&#237;a-Giustiniani, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotype+and+prognostic+correlations+of+the+converter+region+mutations+affecting+the+&#946;+myosin+heavy+chain.">Phenotype and prognostic correlations of the converter region mutations affecting the &#946; myosin heavy chain.</a> Heart (British Cardiac Society). 101 (13), 1047-1053 (2015).</li><li>Moore, J. R., Leinwand, L., Warshaw, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+cardiomyopathy+phenotypes+based+on+the+functional+impact+of+mutations+in+the+myosin+motor.">Understanding cardiomyopathy phenotypes based on the functional impact of mutations in the myosin motor.</a> Circulation Research. 111 (3), 375-385 (2012).</li><li>Majewski, J., Schwartzentruber, J., Lalonde, E., Montpetit, A., Jabado, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+can+exome+sequencing+do+for+you.">What can exome sequencing do for you.</a> Journal of Medical Genetics. 48 (9), 580-589 (2011).</li></ol>

The authors have no financial conflicts of interest to declare.

In this study, we describe one Chinese Han families with HCM. Genetics analysis revealed that a heterozygous MYH6 mutation p.G823E co-segregates with the disease in family members with autosomal dominant inheritance. To validate the pathogenicity of G823E mutation and discuss the underlying mechanisms, we created a C57BL/6N mouse model with G823E at mouse Myh7 locus by CRISPR/Cas9-mediated genome engineering.
Phenotypic characteristics of C57BL/6N-Myh7em1(G823E) knockin mice were ev...

Hypertrophic cardiomyopathy (HCM, OMIM: 613690) is the most common cardiomyopathy in China, with an estimated incidence of 0.2%, affecting 150,000 people1,2.
The pathological anatomical feature that characterizes HCM is asymmetric ventricular hypertrophy, which often involves the ventricular outflow tract and/or interventricular septum3. The clinical manifestation is exertional dyspnea, fatigue, and chest pain. The individual phenotype of HCM has variability ranging from clinically insidious to severe heart failure. Patients with HCM require medical treatment, heart transplantation, life support equipment, and multidisciplinary follow-up4.
In the past century, PCR technology has changed the way we study DNA5. A DNA sequencing method for clinical diagnosis was discovered by Sanger and colleagues6. The Sanger technique was subsequently applied to the Human Genome Project, but this approach was costly and time-consuming7. The advent of whole-genome sequencing (WGS) brought insights into human genetic disease to new heights, but it remained prohibitive in terms of cost. Whole-exome sequencing (WES) technology has long been used to detect germline variants8 and has been successful in identifying somatic driver mutations in the exome of various cancers9. The detection of DNA exons or coding regions by WES can be used to reveal pathogenic variants in most Mendelian diseases. Today, with the decreasing cost of sequencing, WGS is expected to become an important tool in genomics research and can be widely used in the detection of pathogenic variants in the genome.
WES technology has also been used in inherited cardiomyopathy to identify pathogenic variants to further elucidate the etiology. Emerging evidence has implicated that genes coding sarcomere structural protein gene mutations, such as MYH710, MYH611, MYBPC312, MYL213, MYL314, TNNT215, TNNI316, TNNC117, and TPM118 are responsible for the genetic etiology of HCM. Awareness of pathogenic variants in rare disease-causing genes (e.g., obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN, OMIM: 608616)19, acting alpha 2 (ACTN2, OMIM: 102573)20, and cysteine and glycine rich protein 3 (CSRP3, OMIM: 600824)21) has also been associated with HCM. Current genetic studies have identified multiple distinct pathogenic variants in the sarcomeric protein gene in approximately 40%-60% of HCM patients, and genetic testing in HCM patients revealed that most pathogenic variants occur in the myosin heavy chain (MYH7) and myosin-binding protein C (MYBPC3). However,the genetic basis for HCM remains elusive. Exploring the pathogenicity of these variations that underlie the human HCM patients remains a major challenge22.
In this study, we report a pathogenic variant in MYH7 in a Chinese Han family with HCM by WES. In order to verify the pathogenicity of this variant, we established a C57BL/6N-Myh7em1(G823E) knockin mice using the CRISPR/Cas9 system. We also discuss plausible mechanisms of this variant.

<table><tbody><tr><td>0.5&amp;times;TBE</td><td>Shanghai Sangon</td><td></td><td></td></tr><tr><td>2&amp;times; Taq Master Mix (Dye Plus)</td><td>Nanjing Novizan Biotechnology Co., Ltd.</td><td></td><td></td></tr><tr><td>Agarose</td><td>Regu</td><td></td><td></td></tr><tr><td>Anesthesia machine for small animals</td><td>Reward Life Technology Co., Ltd.</td><td>R500</td><td></td></tr><tr><td>BEDTools</td><td></td><td>2.16.1</td><td></td></tr><tr><td>Cas9 in vitro digestion method to detect gRNA target efficiency kit</td><td>Viewsolid Biotechnology Co., Ltd.</td><td>VK007</td><td></td></tr><tr><td>DNA Marker</td><td>Thermo Fisher Scientific</td><td></td><td></td></tr><tr><td>DNA stabilizer</td><td>Shanghai Seebio Biotechnology Co., Ltd.</td><td>DNAstable LD</td><td>prevent DNA degradation</td></tr><tr><td>Electric paraffin microtome</td><td>Shenyang Hengsong Technology Co., Ltd.</td><td>HS-S7220-B</td><td></td></tr><tr><td>GATK</td><td></td><td>v3.5</td><td></td></tr><tr><td>Gentra Puregene blood kit</td><td>Santa Clara</td><td></td><td></td></tr><tr><td>Glass slide, coverslip</td><td>Jiangsu Invotech Biotechnology Co., Ltd.</td><td></td><td></td></tr><tr><td>Hematoxylin staining solution, Eosin staining solution</td><td>Shanghai Biyuntian Biotechnology Co., Ltd.</td><td>C0107-500ml, C0109</td><td></td></tr><tr><td>HiSeq X-ten platform</td><td>Illumina</td><td></td><td>perform sequencing on the captured libraries</td></tr><tr><td>Injection of chorionic gonadotropin</td><td>Livzon Pharmaceutical Group Inc.</td><td></td><td></td></tr><tr><td>Injection of pregnant mare serum gonadotropin</td><td>Livzon Pharmaceutical Group Inc.</td><td></td><td></td></tr><tr><td>Isoflurane</td><td>Local suppliers</td><td></td><td>inhalation anesthesia</td></tr><tr><td>Microinjection microscope</td><td>Nikon</td><td>ECLIPSE Ts2</td><td></td></tr><tr><td>NanoDrop</td><td>Thermo Fisher Scientific</td><td>2000</td><td></td></tr><tr><td>Paraffin Embedding Machine</td><td>Shenyang Hengsong Technology Co., Ltd.</td><td>HS-B7126-B</td><td></td></tr><tr><td>Picard</td><td></td><td>(2.2.4) 20</td><td></td></tr><tr><td>Proteinase K</td><td>Merck KGaA</td><td></td><td></td></tr><tr><td>samtools</td><td></td><td>1.3</td><td></td></tr><tr><td>Sequencer</td><td>Applied Biosystems</td><td>ABI 3500</td><td></td></tr><tr><td>Stereomicroscope</td><td>Nikon</td><td>SMZ745T</td><td></td></tr><tr><td>SureSelect Human All Exon V6</td><td>Agilent Technology Co., Ltd.</td><td></td><td>exome probe</td></tr><tr><td>T7 ARCA mRNA Kit</td><td>New England BioLabs, Inc.</td><td>NEB-E2065S</td><td></td></tr><tr><td>Temperature box</td><td>BINDER GmbH</td><td>KBF-S Solid.Line</td><td></td></tr><tr><td>Trizma Hydrochloride Solution</td><td>Sigma, Merck KGaA</td><td>No. T2663</td><td></td></tr><tr><td>Veterinary ultrasound system</td><td>Royal Philips</td><td>CX50</td><td></td></tr></tbody></table>

investigating the pathogenesis of myh7 mutation gly823glu in familial hypertrophic cardiomyopathy using a mouse model

Familial hypertrophic cardiomyopathy (HCM, OMIM: 613690) is the most common cardiomyopathy in China. However, the underlying genetic etiology of HCM remains elusive.
We previously identified a myosin heavy chain 7 (MYH7) gene heterozygous variant, NM_000257.4: c.G2468A (p.G823E), in a large Chinese Han family with HCM. In this family, variant G823E cosegregates with an autosomal dominant disorder. This variant is located in the lever arm domain of the neck region of the MYH7 protein and is highly conserved among homologous myosins and species. To verify the pathogenicity of the G823E variant, we produced a C57BL/6N mouse model with a point mutation (G823E) at the mouse MYH7 locus with CRISPR/Cas9-mediated genome engineering. We designed gRNA targeting vectors and donor oligonucleotides (with targeting sequences flanked by 134 bp of homology). The p.G823E (GGG to GAG) site in the donor oligonucleotide was introduced into exon 23 of MYH7 by homology-directed repair. A silenced p.R819 (AGG to CGA) was also inserted to prevent gRNA binding and re-cleavage of the sequence after homology-directed repair. Echocardiography revealed left ventricular posterior wall (LVPW) hypertrophy with systole in MYH7 G823E/- mice at 2 months of age. These results were likewise validated by histological analysis (Figure 3).
These results demonstrate that the G823E variant plays an important role in the pathogenesis of HCM. Our findings enrich the spectrum of MYH7 variants linked to familial HCM and may provide guidance for genetic counseling and prenatal diagnosis in this Chinese family.

Clinical profile of the families 
The family pedigrees of HCM were obtained and are shown in Figure 2. All the documented family members were diagnosed with HCM at enrollment.
In the family (Figure 2A), the proband was patient III-7, who was diagnosed with HCM and left ventricular outflow tract obstruction (LVOTO) at 46 years old and underwent cardiac surgery. Patient III-3 had minor HCM that did not require surgical treatment. P...

Watch this Scientific Journal Video about Investigating the Pathogenesis of MYH7 Mutation Gly823Glu in Familial Hypertrophic Cardiomyopathy using a Mouse Model at JoVE.com

Investigating the Pathogenesis of MYH7 Mutation Gly823Glu in Familial Hypertrophic Cardiomyopathy using a Mouse Model

Based on the familial hereditary cardiomyopathy family found in our clinical work, we created a C57BL/6N mouse model with a point mutation (G823E) at the mouse MYH7 locus through CRISPR/Cas9-mediated genome engineering to verify this mutation.

Familial hypertrophic cardiomyopathy (HCM, OMIM: 613690) is the most common cardiomyopathy in China. However, the underlying genetic etiology of HCM ...

investigating-pathogenesis-myh7-mutation-gly823glu-familial

Research

JoVE Journal

Genetics

3.0K Views.  the Second Affiliated Hospital of Guangzhou University of Chinese Medicine. Dit protocol is belangrijk omdat het een demonstratie van echografie bij kleine dieren kan bieden. Deze techniek kan inzicht geven in de ontdekking van pathogene genen bij erfelijke cardiomyopathie. Bevestig de knockin muizen horizontaal op het platform en kantel het platform 30 graden vertroetel naar de knockin muis.Verwijder haar op de voorste borstwand van de knockin muizen met behulp van een ontharingscrème plaats de sonde verticaal met de bult naar het hoofd van het dier gericht....

Video: Investigating the Pathogenesis of MYH7 Mutation Gly823Glu in Familial Hypertrophic Cardiomyopathy using a Mouse Model

Delivery of Modified mRNA in a Myocardial Infarction Mouse Model

Myocardial infarction (MI) is a leading cause of morbidity and mortality in the Western world. In the past decade, gene therapy has become a promising treatment option for heart disease, owing to its efficiency and exceptional therapeutic effects. In an effort to repair the damaged tissue post-MI, various studies have employed DNA-based or viral gene therapy but have faced considerable hurdles due to the poor and uncontrolled expression of the delivered genes, edema, arrhythmia, and cardiac hypertrophy. Synthetic modified mRNA (modRNA) presents a novel gene therapy approach that offers high, transient, safe, nonimmunogenic, and controlled mRNA delivery to the heart tissue without any risk of genomic integration. Due to these remarkable characteristics combined with its bell-shaped pharmacokinetics in the heart, modRNA has become an attractive approach for the treatment of heart disease. However, to increase its effectiveness in vivo, a consistent and reliable delivery method needs to be followed. Hence, to maximize modRNA delivery efficiency and yield consistency in modRNA use for in vivo applications, an optimized method of preparation and delivery of modRNA intracardiac injection in a mouse MI model is presented. This protocol will make modRNA delivery more accessible for basic and translational research.

This protocol presents a simple and coherent way to transiently upregulate a gene of interest using modRNA after myocardial infarction in mice.

Myocardial infarction (MI) is a leading cause of morbidity and mortality in the Western world. In the past decade, gene therapy has become a promising ...

An Approach to Study Shape-Dependent Transcriptomics at a Single Cell Level

Different types of cardiac hypertrophy have been associated with an increased volume of cardiac myocytes (CMs), along with changes in CM morphology. While the effects of cell volume on gene expression are well known, the effects of cell shape are not well understood. This paper describes a method that has been designed to systematically analyze the effects of CM morphology on gene expression. It details the development of a novel single-cell trapping strategy that is then followed by single-cell mRNA sequencing. A micropatterned chip has also been designed, which contains 3000 rectangular-shaped fibronectin micropatterns. This makes it possible to grow CMs in distinct length:width aspect ratios (AR), corresponding to different types of heart failure (HF). The paper also describes a protocol that has been designed to pick up single cells from their pattern, using a semi-automated micro-pipetting cell picker, and individually inject them into a separate lysis buffer. This has made it possible to profile the transcriptomes of single CMs with defined geometrical morphotypes and characterize them according to a range of normal or pathological conditions: hypertrophic cardiomyopathy (HCM) or afterload/concentric versus dilated cardiomyopathy (DCM) or preload/eccentric. In summary, this paper presents methods for growing CMs with different shapes, which represent different pathologies, and sorting these adherent CMs based on their morphology at a single-cell level. The proposed platform provides a novel approach to high throughput and drug screening for different types of HF.

This paper presents methods for growing cardiac myocytes with different shapes, which represent different pathologies, and sorting these adherent cardiac myocytes based on their morphology at a single cell level. The proposed platform provides a novel approach to high throughput and drug screening for different types of heart failure.

Different types of cardiac hypertrophy have been associated with an increased volume of cardiac myocytes (CMs), along with changes in CM morphology. While ...

Transverse Aortic Constriction in Mice

Transverse aortic constriction (TAC) in the mouse is a commonly used experimental model for pressure overload-induced cardiac hypertrophy and heart failure.1 TAC initially leads to compensated hypertrophy of the heart, which often is associated with a temporary enhancement of cardiac contractility. Over time, however, the response to the chronic hemodynamic overload becomes maladaptive, resulting in cardiac dilatation and heart failure.2 The murine TAC model was first validated by Rockman et al.1, and has since been extensively used as a valuable tool to mimic human cardiovascular diseases and elucidate fundamental signaling processes involved in the cardiac hypertrophic response and heart failure development. When compared to other experimental models of heart failure, such as complete occlusion of the left anterior descending (LAD) coronary artery, TAC provides a more reproducible model of cardiac hypertrophy and a more gradual time course in the development of heart failure. Here, we describe a step-by-step procedure to perform surgical TAC in mice. To determine the level of pressure overload produced by the aortic ligation, a high frequency Doppler probe is used to measure the ratio between blood flow velocities in the right and left carotid arteries.3, 4 With surgical survival rates of 80-90%, transverse aortic banding is an effective technique of inducing left ventricular hypertrophy and heart failure in mice.

Transverse aortic constriction (TAC) in the mouse is a commonly used experimental model to study mechanisms underlying cardiac hypertrophy and heart failure development. Here, we describe procedures to constrict the aorta to create a reproducible degree of cardiac hypertrophy in mice.

Transverse aortic constriction (TAC) in the mouse is a commonly used experimental model for pressure overload-induced cardiac hypertrophy and heart ...

Biology

A Phenotyping Regimen for Genetically Modified Mice Used to Study Genes Implicated in Human Diseases of Aging

Age-related diseases are becoming increasingly prevalent and the burden continues to grow as our population ages. Effective treatments are necessary to lessen the impact of debilitating conditions but remain elusive in many cases. Only by understanding the causes and pathology of diseases associated with aging, can scientists begin to identify potential therapeutic targets and develop strategies for intervention. The most common age-related conditions are neurodegenerative disorders such as Parkinson's disease and blindness. Age-related macular degeneration (AMD) is the leading cause of blindness in the elderly. Genome wide association studies have previously identified loci that are associated with increased susceptibility to this disease and identified two regions of interest: complement factor H (CFH) and the 10q26 locus, where the age-related maculopathy susceptibility 2 (ARMS2) and high-temperature requirement factor A1 (HtrA1) genes are located. CFH acts as a negative regulator of the alternative pathway (AP) of the complement system while HtrA1 is an extracellular serine protease. ARMS2 is located upstream of HtrA1 in the primate genome, although the gene is absent in mice. To study the effects of these genes, humanized knock-in mouse lines of Cfh and ARMS2, knockouts of Cfh, HtrA1, HtrA2, HtrA3 and HtrA4 as well as a conditional neural deletion of HtrA2 were generated. Of all the genetically engineered mice produced only mice lacking HtrA2, either systemically or in neural tissues, displayed clear phenotypes. In order to examine these mice thoroughly and systematically, an initial phenotyping schedule was established, consisting of a series of tests related to two main diseases of interest: AMD and Parkinson's. Genetically modified mice can be subjected to appropriate experiments to identify phenotypes that may be related to the associated diseases in humans. A phenotyping regimen with a mitochondrial focus is presented here alongside representative results from the tests of interest.

A reverse-genetics approach to understanding gene families associated with human disease is presented, using mouse as a model system, and the subsequent mouse phenotyping schedule is described. Because mice defective in a gene of interest, HtrA2, manifested Parkinsonian symptoms, the phenotyping regimen is focused on identifying neurological defects.

Age-related diseases are becoming increasingly prevalent and the burden continues to grow as our population ages. Effective treatments are necessary to ...

Medicine

Echocardiographic and Histological Examination of Cardiac Morphology in the Mouse

An increasing number of genetically modified mouse models has become available in recent years. Moreover, the number of pharmacological studies performed in mice is high. Phenotypic characterization of these mouse models also requires the examination of cardiac function and morphology. Echocardiography and magnetic resonance imaging (MRI) are commonly used approaches to characterize cardiac function and morphology in mice. Echocardiographic and MRI equipment specialized for use in small rodents is&#160;expensive and requires a dedicated space. This protocol describes cardiac measurements in mice using a clinical echocardiographic system with a 15 MHz human vascular probe. Measurements are performed on anesthetized adult mice. At least three image sequences are recorded and analyzed for each animal in M-mode in the parasternal short-axis view. Afterwards, cardiac histological examination is performed, and cardiomyocyte diameters are determined on hematoxylin-eosin- or wheat germ agglutinin (WGA)-stained paraffin sections. Vessel density is determined morphometrically after Pecam-1 immunostaining. The protocol has been applied successfully to pharmacological studies and different genetic animal models under baseline conditions, as well as after experimental myocardial infarction by the permanent ligation of the left anterior descending coronary artery (LAD). In our experience, echocardiographic investigation is limited to anesthetized animals and is feasible in adult mice weighing at least 25 g.

Echocardiographic examination is frequently used in mice. Expensive high-resolution ultrasound devices have been developed for this purpose. This protocol describes an affordable echocardiographic procedure combined with histological morphometric analyses to determine cardiac morphology.

An increasing number of genetically modified mouse models has become available in recent years. Moreover, the number of pharmacological studies performed ...

Isolation, Culture, and Functional Characterization of Adult Mouse Cardiomyoctyes

The use of primary cardiomyocytes (CMs) in culture has provided a powerful complement to murine models of heart disease in advancing our understanding of heart disease. In particular, the ability to study ion homeostasis, ion channel function, cellular excitability and excitation-contraction coupling and their alterations in diseased conditions and by disease-causing mutations have led to significant insights into cardiac diseases. Furthermore, the lack of an adequate immortalized cell line to mimic adult CMs, and the limitations of neonatal CMs (which lack many of the structural and functional biomechanics characteristic of adult CMs) in culture have hampered our understanding of the complex interplay between signaling pathways, ion channels and contractile properties in the adult heart strengthening the importance of studying adult isolated cardiomyocytes. Here, we present methods for the isolation, culture, manipulation of gene expression by adenoviral-expressed proteins, and subsequent functional analysis of cardiomyocytes from the adult mouse. The use of these techniques will help to develop mechanistic insight into signaling pathways that regulate cellular excitability, Ca2+ dynamics and contractility and provide a much more physiologically relevant characterization of cardiovascular disease.

Here we describe the isolation of adult mouse cardiomyoctyes using a Langendorff perfusion system. The resulting cells are Ca2+-tolerant, electrically quiescent and can be cultured and transfected with adeno- or lentiviruses to manipulate gene expression. Their functionality can also be analyzed using the MMSYS system and patch clamp techniques.

The use of primary cardiomyocytes (CMs) in culture has provided a powerful complement to murine models of heart disease in advancing our understanding of ...

Induction and Characterization of Pulmonary Hypertension in Mice using the Hypoxia/SU5416 Model

Pulmonary Hypertension (PH) is a pathophysiological condition, defined by a mean pulmonary arterial pressure exceeding 25 mm Hg at rest, as assessed by right heart&#160;catheterization. A broad spectrum of diseases can lead to PH, differing in their etiology, histopathology, clinical presentation, prognosis, and response to&#160;treatment. Despite significant progress in the last years, PH remains an uncured disease. Understanding the underlying mechanisms can pave the way for the development of new therapies. Animal models are important research tools to achieve this goal. Currently, there are several models available for recapitulating PH. This protocol describes a two-hit mouse PH model. The stimuli for PH development are hypoxia and the injection of SU5416, a vascular endothelial growth factor (VEGF) receptor antagonist. Three weeks after initiation of Hypoxia/SU5416, animals develop pulmonary vascular remodeling imitating the histopathological changes observed in human PH (predominantly Group 1). Vascular remodeling in the pulmonary circulation results in the remodeling of the right&#160;ventricle (RV). The procedures for measuring RV pressures (using the open chest method), the morphometrical analyses of the RV (by dissecting and weighing both cardiac ventricles) and the histological assessments of the remodeling (both pulmonary by assessing vascular remodeling and cardiac by assessing RV cardiomyocyte hypertrophy and fibrosis) are described in detail. The advantages of this protocol are the possibility of the application both in wild type and in genetically modified mice, the relatively easy and low-cost implementation, and the quick development of the disease of interest (3 weeks). Limitations of this method are that mice do not develop a severe phenotype and PH is reversible upon return to normoxia. Prevention, as well as therapy studies, can easily be implemented in this model, without the necessity of advanced skills (as opposed to surgical rodent models).

This protocol describes the induction of pulmonary hypertension (PH) in mice based on the exposure to hypoxia and the injection of a VEGF receptor antagonist. The animals develop PH and right ventricular (RV) hypertrophy 3 weeks after the initiation of the protocol. The functional and morphometrical characterization of the model is also presented.

Pulmonary Hypertension (PH) is a pathophysiological condition, defined by a mean pulmonary arterial pressure exceeding 25 mm Hg at rest, as assessed by ...

Investigating HFpEF Pathophysiology in a Hyperlipidemia&#45;Induced Mouse Model

A Murine Model of Hyperlipidemia&#45;Induced Heart Failure with Preserved Ejection Fraction

The pathophysiology of heart failure with preserved ejection fraction (HFpEF) driven by lipotoxicity is incompletely understood. Given the urgent need for animal models that accurately mimic cardio-metabolic HFpEF, a hyperlipidemia-induced murine model was developed by reverse engineering phenotypes seen in HFpEF patients. This model aimed to investigate HFpEF, focusing on the interplay between lipotoxicity and metabolic syndrome. Hyperlipidemia was induced in wild-type (WT) mice on a 129J strain background through bi-weekly intraperitoneal injections of poloxamer-407 (P-407), a block co-polymer that blocks lipoprotein lipase, combined with a single intravenous injection of adeno-associated virus 9-cardiac troponin T-low-density lipoprotein receptor (AAV9-cTnT-LDLR). Extensive assessments were conducted between 4 and 8 weeks post-treatment, including echocardiography, blood pressure recording, whole-body plethysmography, echocardiography (ECG) telemetry, activity wheel monitoring (AWM), and biochemical and histological analyses. The LDLR/P-407 mice exhibited distinctive features at four weeks, including diastolic dysfunction, preserved ejection fraction, and increased left ventricular wall thickness. Notably, blood pressure and renal function remained within normal ranges. Additionally, ECG and AWM revealed heart blocks and reduced activity, respectively. Diastolic function deteriorated at eight weeks, accompanied by a significant decline in respiratory rates. Further investigation into the double treatment model revealed elevated fibrosis, wet/dry lung ratios, and heart weight/body weight ratios. The LDLR/P-407 mice exhibited xanthelasmas, ascites, and cardiac ischemia. Interestingly, sudden deaths occurred between 6 and 12 weeks post-treatment. The murine HFpEF model offers a valuable and promising experimental resource for elucidating the intricacies of metabolic syndrome contributing to diastolic dysfunction within the context of lipotoxicity-mediated HFpEF.

Author Spotlight: Exploring the Relationship Between Lipotoxicity and HFpEF 

This protocol presents a detailed approach to replicating a murine model of hyperlipidemia-induced heart failure with preserved ejection fraction (HFpEF). The design combines the administration of adeno-associated virus 9-cardiac troponin T-low-density lipoprotein receptor (AAV9-cTnT-LDLR) and poloxamer-407 (P-407).

The pathophysiology of heart failure with preserved ejection fraction (HFpEF) driven by lipotoxicity is incompletely understood. Given the urgent need for ...

Removal of an Internal Translational Start Site from mRNA While Retaining Expression of the Full-Length Protein

The CRISPR-Cas9 gene-editing system, based on genome repair mechanisms, enables the generation of gene-modified mouse models more quickly and easily relative to traditional homologous recombination. The CRISPR-Cas9 system is particularly attractive when a single-point mutation is desired. The gap junction protein, Connexin 43 (Cx43), is encoded by gene Gja1, which has a single coding exon and cannot be spliced. However, Gja1 produces not only full-length Cx43 protein but up to six N-terminus truncated isoforms by a process known as internal translation, the result of ribosomal translation initiation at internal AUG (Methionine) start sites. GJA1-20k is the most commonly generated truncated isoform of Cx43 initiated at the AUG codon at position 213 of Gja1 mRNA. Because residue 213 occurs at the end of the last transmembrane domain of Cx43, GJA1-20k is effectively the 20 kDa C-terminus tail of Cx43 as an independent protein. Previous investigators identified, in cells, that a critical role of GJA1-20k is to facilitate trafficking of full-length Cx43 gap junction hemichannels to the plasma membrane. To examine this phenomenon in vivo, a mutant mouse with a Gja1 point-mutation was generated that replaces the ATG (Methionine) at residue 213 with TTA (Leucine, M213L mutation). The result of M213L is that Gja1 mRNA and full-length Cx43 are still generated, yet the translation of Gja1-20k is significantly reduced. This report focuses on choosing the restriction enzyme site to develop a one amino acid mutated (Gja1M213L/M213L) mouse model. This protocol describes genetically modified mice by the CRISPR-Cas9 system and rapid genotyping by combining PCR and restriction enzyme treatments.

The present protocol describes a single M213L mutation in Gja1 that retains full-length Connexin43 generation but prevents translation of the smaller GJA1-20k internally translated isoform.

The CRISPR-Cas9 gene-editing system, based on genome repair mechanisms, enables the generation of gene-modified mouse models more quickly and easily ...

Murine Model for Diabetic Cardiomyopathy via High-Fat Diet and STZ Injection

Modeling and Evaluation of Murine Diabetic Cardiomyopathy Model

The underlying pathophysiological mechanisms of diabetic cardiomyopathy (DbCM), a leading cause of mortality among patients with type 2 diabetes mellitus (T2DM), remain poorly understood. The myocardial toxicity associated with T2DM is attributed to factors such as lipotoxicity, glucotoxicity, oxidative stress, reduced cardiac efficiency, and lipoapoptosis. Compared to rats, mice offer greater accessibility, cost-effectiveness, and broader applicability for animal experiments. Insulin resistance and impaired insulin secretion are crucial factors in the pathophysiology of T2DM. We introduce a novel nongenetic murine model that replicates the progression of human DbCM induced by a combination of high-fat diet (HFD) feeding and streptozotocin (STZ) injection. In this study, we used wild-type C57BL/6J mice, administering an HFD regimen for 12 weeks, followed by intraperitoneal injections of STZ for an additional 12 weeks to induce characteristic manifestations of T2DM. We conducted oral glucose tolerance tests and measured serum insulin concentrations to confirm the development of insulin resistance and insufficient insulin secretion. Cardiac structure and function were rigorously assessed through noninvasive transthoracic echocardiography. Pathological characteristics were evaluated through Masson's trichrome staining and wheat germ agglutinin (WGA) staining, revealing pathological features related to DbCM. Therefore, we provide a robust and versatile method for establishing a nongenetic murine model of DbCM.

This protocol outlines a method for inducing diabetic cardiomyopathy through a combination of high-fat diet feeding and streptozotocin injection. This approach aims to provide a reliable framework for scientific investigation into diabetic cardiomyopathy and to explore potential avenues for clinical treatment applications.

The underlying pathophysiological mechanisms of diabetic cardiomyopathy (DbCM), a leading cause of mortality among patients with type 2 diabetes mellitus ...

Investigating the Pathogenesis of MYH7 Mutation Gly823Glu in Familial Hypertrophic Cardiomyopathy using a Mouse Model

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video