The authors acknowledge that the land they performed this research on is the traditional, ancestral, and unceded territory of the xwm&#601;&#952;kw&#601;y&#787;&#601;m (Musqueam) Nation. The land it is situated on has always been a place of learning for the Musqueam people, who for millennia have passed on in their culture, history, and traditions from one generation to the next on this site. We encourage others to learn more about the native lands in which they live and work at https://native-land.ca. The authors acknowledge support from the Natural&#160;Sciences and Engineering Council of Canada (NSERC) Canadian Graduate Scholarships - Master&#39;s (N.P.), Michael Smith Health Research BC Trainee Award (RT-2023-3174, to MH), Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Grants Program (RGPIN-2019-04591 to C.T., RGPIN-2016-04282 to LCO), Canadian Institute for Advanced Research / Humans and the Microbiome (FL-001253 Appt 3362, to C.T.), Michael Smith Foundation for Health Research Scholar Award (18239, to C.T.), Canadian Institutes for Health Research (PJT-159458 to LCO) and the Canadian Foundation for Innovation (34673 to LCO and 38277 to CT). We are grateful for technical support from the UBC Centre for Disease Modelling and ubcFLOW, which is supported by the UBC GREx Biological Resilience Initiative, and to members of the Osborne and Tropini labs for critical discussions and evaluation of the manuscript. Figure 1A and Figure 2A were created using Biorender.com.

Exploring Gut Phage-Bacteria Dynamics in Murine Models Using T4 Phage

The authors have nothing to disclose.

The study of phages in the microbiome presents a significant challenge compared to their bacterial counterparts. Specifically, phages do not contain a conserved phylogenetic marker common to all phages akin to the 16S and 18S ribosomal subunits that allow for the ease in sequencing and identification of prokaryotic and eukaryotic species, respectively42. However, with advances in next generation sequencing approaches, including increasing read lengths, throughput and decreasing costs, comes the ra...

Bacteriophages, or phages, are viruses that infect and kill bacteria with species and strain-level specificity1. Phages play important roles within complex bacterial communities such as the gut microbiota, where they have been implicated in regulating population dynamics and driving bacterial fitness2. Throughout the last decade, there has been renewed interest in phage research owing to the rise of antimicrobial resistant pathogens3, and the potential for phage therapy as an alternative treatment strategy. In recent years, lytic phage cocktails have been used intravenously with some success in serious, antibiotic-resistant bacterial septic infections in humans3,4. Oral phage therapy has also been proposed as a potential alternative to antibiotics to treat intestinal infections and inflammation. Furthermore, phages have been implicated in the success of fecal filtrate transplants (FFT), which are fecal microbiota preparations that have been filtered to remove bacteria, in the treatment of recurrent Clostridioides difficile infection (rCDI)5,6, inflammatory bowel disorders (IBD)7,8&#160;and necrotizing enterocolitis in pre-term pigs9. Given these results, it is important to consider interactions both between phages and the gut microbiota, and phages and the mammalian host, as the addition of novel phages into a preexisting community may have indirect effects on the community as a whole, and not only its target bacteria2,10.
The study of phage interactions with their target bacteria in vitro has proven useful for understanding the mechanisms and impacts of phage and bacteria interactions in the gut. In this setting, it has been shown that Escherichia coli-specific T4 phages of the order Caudovirales require immunoglobulin (Ig)-like domains located within highly antigenic outer capsid (Hoc) proteins on the virion surface to adhere to intestinal mucus11. Additionally, transwell assays have shown that T4 phages are capable of interacting with epithelial cell cultures and translocating through cell layers by macropinocytosis12,13. These results support the hypothesis that phages can interact with their metazoan host, even though they are incapable of infecting eukaryotic cells. These models, while useful, lack the full range of complex interactions that occur in a gut ecosystem that are required for a comprehensive exploration of the tripartite interaction between phages, bacteria and the metazoan host.
Mouse models are an important tool for investigating phages within complex environments. A desirable application of phage administration is as an alternative strategy to treat antimicrobial resistant infections or pathobionts associated with chronic inflammatory diseases, including IBD. However, emerging literature suggests that phage behavior in vitro does not fully represent in vivo functions. Buttimer et al.14&#160;demonstrated that a phage cocktail was able to deplete the targeted bacteria in a simplified human microbiota consortium in vitro, but could not be replicated in vivo in gnotobiotic mice colonized with the same bacteria-phage consortium. Furthermore, in a conventional mouse microbiome, T7 phage led to selective depletion of its target gut bacteria, although gradual recovery was observed over time, indicative of evolved resistance15. Other studies have demonstrated co-existence of orally administered phages and their target bacterial strains in vivo2,16. Indeed, beyond phage/bacteria co-existence, phage administration led to widespread changes in overall microbiota community composition and function2,16. This is relevant in disease settings as several studies have found associations between increased relative abundance of Caudovirales and IBD7,8,17&#160;that were independent of changes in bacterial abundance7. It remains unknown whether this is a driver or consequence of disease pathogenesis.
The historic focus of phage investigation has been around the relationship between a phage and its target bacterium. However, it is also important to consider potential interactions between phage and the mucosa, epithelium, and immune system of the metazoan host. These interactions all play an important role in the overall response to intestinal phage infection. To demonstrate this, phages have been studied using germ-free (GF) mice to elucidate their impact on the immune system without interference by the microbiota8. In this system, phage nucleic acids were detected by Toll-like receptors (TLRs) located within endosomes of phagocytic immune cells (macrophages and dendritic cells). This activated downstream signaling and stimulated T cell dependent production of interferon (IFN)-&#947;8&#160;or type I IFNs18. Moreover, Fluckiger et al.19&#160;implicated memory CD8+ T cells in the recognition of phage-encoded (prophage) antigens, which resulted in T cell cross-reactivity with tumor antigens, resulting in reduced tumor burden. Finally, phage-specific antibody production has been documented in mouse studies where phages were delivered to animal models in a continual manner through drinking water8,20, or by repeated oral gavage over several months20, demonstrating the capacity for phage proteins to promote humoral immune responses. Although these modes of phage inoculation allow for optimal and continual priming of the immune system, they may not represent the naturally occurring interactions between phages and the intestinal environment, nor the kinetics of orally applied phage therapy. Thus far, a limited number of studies have examined the interactions of phage with a single bacterial species in monocolonized mouse models21. However, monocolonized mice proved critical in deciphering microbe-specific effects of individual species on gastrointestinal (GI) tract and immune development22,23,24, and they may yet prove useful in understanding tripartite interactions between phages, their target bacteria, and the metazoan host.
Excitingly, there is still much to learn about the interactions between intestinal phage and gut commensal bacteria, as well as the interactions that occur between the metazoan host and the phages that reside within it. This protocol provides a set of procedures to study isolated T4 phage and its&#160;bacterial counterpart, E. coli (K-12, BW25113), using a gnotobiotic mouse model. These standardized procedures also provide a foundation for optimizing other phage/bacteria dyads by adapting the growth parameters to the pairs of interest. The methods described here outline: (1) Preparation of T4 phage and vehicle lysates for oral gavage of mice; (2) Oral administration of T4 phage to E. coli monocolonized gnotobiotic mice; (3) Monitoring T4 phage levels in mouse feces and tissues over time.
For the representative results presented here, purified T4 phage lysates were propagated from phage bank stocks maintained by the Rohwer Lab. The Phage-on-Tap method for propagating T4 phage was adapted25, as referenced in this protocol. The method yields high titer, endotoxin-low phage stocks within three days. Utilizing this approach, 10 mL of &#8805; 1010&#160;plaque forming units (pfu)/mL of T4 phage with &#60; 0.5 endotoxin units (EU)/mL were&#160;routinely collected. The recommended endotoxin levels for oral or intravenous administration into mice are &#8804; 20 EU/mL and &#8804; 5 EU/kg/h (or 0.1 EU administered over 1 h for a 20 g mouse), respectively, making this a suitable method of phage preparation for in vivo inoculation. All phage stocks were stored at 4 &#176;C in saline magnesium (SM) phage buffer (recipe provided in step 1.1.5.1). E. coli was cultivated in LB media. For various phage-bacteria pairs, diverse culture media and growth conditions may be adapted from this protocol. Phages can also be sourced from the environment, such as wastewater, marine water, soil and intestinal contents and can be isolated and purified as per Sambrook and Russell26&#160;prior to preparation using the appropriate growth and propagation conditions for each phage-host pair of interest25. Alternatively, phages can be obtained from commercial sources (see Table of Materials) or from phage banks.

<table><tbody><tr><td>1-octanol (99%)</td><td>Thermofisher</td><td>CAAAA15977-AP</td><td></td></tr><tr><td>50 ml PES Steriflip Sterile Disposable Vacuum Filter Units</td><td>Millipore Sigma&amp;nbsp;</td><td>SCGP00525</td><td></td></tr><tr><td>Agarose (Low-EEO/Multi-Purpose/Molecular Biology Grade)</td><td>Fisher BioReagents&amp;nbsp;</td><td>BP160-500</td><td></td></tr><tr><td>Amicon&amp;reg; 100kDa Ultra-15 centrifugal filter device, Ultracel-100</td><td>Millipore Sigma</td><td>UFC910008</td><td></td></tr><tr><td>BD Microtainer&amp;reg; Tubes, SST</td><td>BD Medical</td><td>365967</td><td></td></tr><tr><td>Bioexclusion airtight cages (ISO cages)&amp;nbsp;</td><td>Techiplast</td><td>1245ISOCAGE</td><td></td></tr><tr><td>C1000 Touch&amp;trade; Thermal Cycler with 96-Well Fast Reaction Module</td><td>BioRad</td><td>1851196</td><td></td></tr><tr><td>Calcium Chloride Dihydrate (White Crystals to Powder)</td><td>Fisher BioReagents</td><td>BP510-500</td><td></td></tr><tr><td>Cap Locks For 1.5ML Tube 100/pk</td><td>Andwin Scientific&amp;nbsp;</td><td>16812612</td><td></td></tr><tr><td>Chloroform (Ethanol as Preservative/Certified ACS)</td><td>Fisher</td><td>C298-500</td><td></td></tr><tr><td>Copper coated steel beads (4.5 mm)</td><td>Crosman Corporation</td><td>0767</td><td></td></tr><tr><td>DNeasy Blood &amp;amp; Tissue Kit (50)</td><td>Thermo Scientific&amp;nbsp;</td><td>69504</td><td></td></tr><tr><td>DreamTaq Green PCR Master Mix (2X)</td><td>Thermo Scientific&amp;nbsp;</td><td>K1081</td><td></td></tr><tr><td>Ethylenediaminetetraacetic acid (EDTA) disodium salt solution, for molecular biology, 0.5 M in H2O</td><td>Sigma Aldrich</td><td>E7889</td><td></td></tr><tr><td>Fisher BioReagents&amp;trade; Agar, Powder / Flakes, Fisher BioReagents&amp;trade;&amp;nbsp;</td><td>Fisher Bioreagents</td><td>BP1423-500</td><td></td></tr><tr><td>Fisher BioReagents&amp;trade; Microbiology Media: LB Broth (Powder) - Lennox&amp;nbsp;</td><td>Fisher Bioreagents</td><td>BP1427-500</td><td></td></tr><tr><td>GeneRuler 100 bp DNA Ladder</td><td>Thermo Scientific&amp;nbsp;</td><td>SM0241</td><td></td></tr><tr><td>Green FastMix&amp;reg; qPCR mix, 1250 rxns</td><td>QuantaBio</td><td>95072-012</td><td></td></tr><tr><td>HEPA filters for isocage lids, AUTOCLAVABLE H14 FILTERS FOR ISO LINE- IRRADIATED</td><td>Techiplast</td><td>UISOHEPAXTBOX-300</td><td></td></tr><tr><td>Magnesium sulfate heptahydrate</td><td>Fisher BioReagents</td><td>BP213-1</td><td></td></tr><tr><td>MaxQ 6000 Incubated Shaker</td><td>Thermo Scientific&amp;nbsp;</td><td>8354-30-0009</td><td></td></tr><tr><td>Microbiology Media: LB Broth (Powder) - Lennox</td><td>Fisher BioReagents</td><td>BP1427-500</td><td></td></tr><tr><td>Microcentrifuge Tubes with Locking Snap Cap, 2ml</td><td>Fisher</td><td>14-666-315</td><td></td></tr><tr><td>Parafilm sealing film</td><td>Bemis</td><td>PM-996</td><td></td></tr><tr><td>Phage stocks</td><td>Carolina Biological Supply&amp;nbsp;</td><td>n/a</td><td></td></tr><tr><td>PicoLab&amp;reg; Mouse Diet 20 EXT</td><td>LabDiet</td><td>5R58</td><td></td></tr><tr><td>Pierce&amp;trade; Chromogenic Endotoxin Quant Kit</td><td>Thermo Scientific&amp;nbsp;</td><td>A39552S</td><td></td></tr><tr><td>RNase A (17,500 U)</td><td>Qiagen</td><td>19101</td><td></td></tr><tr><td>RNase-free DNase Set</td><td>Qiagen&amp;nbsp;</td><td>79254</td><td></td></tr><tr><td>Sodium Bicarbonate (Fine White Powder)</td><td>Fisher Chemical</td><td>BP328-500</td><td></td></tr><tr><td>Sodium Chloride (Crystalline/Certified ACS)</td><td>Fisher Chemical</td><td>S271</td><td></td></tr><tr><td>Sonicator (probe model CL-18; power source model FB50)</td><td>Fisher scentific&amp;nbsp;</td><td>n/a</td><td></td></tr><tr><td>Sterile flexible film isolator&amp;nbsp;</td><td>Class Biologically Clean&amp;nbsp;</td><td>n/a</td><td></td></tr><tr><td>SYBR&amp;trade; Safe DNA Gel Stain</td><td>Invitrogen</td><td>S33102</td><td></td></tr><tr><td>T100 Thermal Cycler&amp;nbsp;</td><td>BioRad</td><td>1861096</td><td></td></tr><tr><td>T4 phage primer, forward (CCACACATAGCGCGAGTATAA)</td><td>IDT</td><td>n/a</td><td></td></tr><tr><td>T4 phage primer, forward (GAAACTCGGTCAGGCTATCAA)</td><td>IDT</td><td>n/a</td><td></td></tr><tr><td>TissueLyser II&amp;nbsp;</td><td>Qiagen&amp;nbsp;</td><td>85300</td><td></td></tr><tr><td>Tris-HCl, 1M Solution, pH 8.0, Molecular Biology Grade, Ultrapure</td><td>Thermo Scientific&amp;nbsp;</td><td>AAJ22638AE</td><td></td></tr><tr><td>Water, (DNASE, RNASE free)</td><td>Fisher BioReagents</td><td>BP2484100</td><td></td></tr></tbody></table>

t4 bacteriophage and e. coli interaction in the murine intestine: a prototypical model for studying host-bacteriophage dynamics in vivo

Bacteriophages (phages) are viruses that infect bacteria with species- and strain-level specificity and are the most abundant biological entities across all known ecosystems. Within bacterial communities, such as those found in the gut microbiota, phages are implicated in regulating microbiota population dynamics and driving bacterial evolution. There has been renewed interest in phage research in the last decade, in part due to the host-specific killing capabilities of lytic phages, which offer a promising tool to counter the increasing threat of antimicrobial resistant bacteria. Furthermore, recent studies demonstrating that phages adhere to intestinal mucus suggest they may have a protective role in preventing bacterial invasion into the underlying epithelium. Importantly, like bacterial microbiomes, disrupted phageomes have been associated with worsened outcomes in diseases such as inflammatory bowel disease. Previous studies have demonstrated that phages can modulate the microbiome of animals and humans through fecal filtrate transplants, benefiting the host&#39;s health. With this recent wave of research comes the necessity to establish and standardize protocols for studying phages in the context of the gut microbiome. This protocol provides a set of procedures to study isolated T4 phages and their bacterial host, Escherichia coli,&#160;in the context of the murine gastrointestinal tract. The methods described here outline&#160;how to start from a phage lysate, administer it to mice and assess effects on bacterial host and phage levels.&#160;This protocol can be modified and applied to other phage-bacterial pairs and provides a starting point for studying host-phage dynamics in vivo.

To investigate the interactions between the T4 phage/E. coli dyad in the murine intestine, T4 phage and vehicle lysates were prepared, cleaned, and purified (Figure 1A). T4 phage lysates were titered by plaque assay and diluted to 2 x 107 pfu/mL (2 x 106 pfu/mouse) in SM buffer. Vehicle lysates were also titered to confirm no viable phage presence and diluted in the same volume of SM buffer as the T4 phage lysate. Endotoxin levels were quantified in diluted lys...

Watch this Scientific Journal Video about Author Spotlight: Investigating Bacteriophage-Induced Immune Responses in Gnotobiotic Mice at JoVE.com

Author Spotlight: Investigating Bacteriophage-Induced Immune Responses in Gnotobiotic Mice

Bacteriophages (phages), viruses that infect bacteria, are an integral component of the gut microbiome. Though these symbiotic inhabitants drive bacterial fitness and population dynamics, little is understood about how they impact gut homeostasis and disease. This protocol studies isolated T4 phages within a mouse model, adaptable to other phage-bacterial pairs.

T4 Bacteriophage and E. coli Interaction in the Murine Intestine: A Prototypical Model for Studying Host-Bacteriophage Dynamics In Vivo

Bacteriophages (phages) are viruses that infect bacteria with species- and strain-level specificity and are the most abundant biological entities across ...

t4-bacteriophage-e-coli-interaction-murine-intestine-prototypical

Research

JoVE Journal

Immunology and Infection

1.5K Views.  University of British Columbia. Ons onderzoek heeft tot doel de tripartiete interacties tussen bacteriofagenbacteriën en het immuunsysteem van zoogdieren te begrijpen in de context van de darm, gnotobiotische muizendarm. We hopen inzicht te krijgen in deze interacties onder gezondheids- en ziekteomstandigheden om het belang van het darmmicrobioom beter te begrijpen. Recente ontwikkelingen hebben aangetoond dat bacteriofagen kunnen worden gedetecteerd door het immuunsysteem van zoogdieren.Er is gesuggereerd dat de me...

Video: Auteur in de schijnwerpers: onderzoek naar door bacteriofagen geïnduceerde immuunresponsen bij gnotobiotische muizen

Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus

In response to viral infection, a host develops various defensive responses, such as activating innate immune signaling pathways that lead to antiviral cytokine production1,2. In order to colonize the host, viruses are obligate to evade host antiviral responses and manipulate signaling pathways. Unraveling the host-virus interaction will shed light on the development of novel therapeutic strategies against viral infection.
Murine &gamma;HV68 is closely related to human oncogenic Kaposi's sarcoma-associated herpesvirus and Epsten-Barr virus3,4. &gamma;HV68 infection in laboratory mice provides a tractable small animal model to examine the entire course of host responses and viral infection in vivo, which are not available for human herpesviruses. In this protocol, we present a panel of methods for phenotypic characterization and molecular dissection of host signaling components in &gamma;HV68 lytic replication both in vivo and ex vivo. The availability of genetically modified mouse strains permits the interrogation of the roles of host signaling pathways during &gamma;HV68 acute infection in vivo. Additionally, mouse embryonic fibroblasts (MEFs) isolated from these deficient mouse strains can be used to further dissect roles of these molecules during &gamma;HV68 lytic replication ex vivo.
Using virological and molecular biology assays, we can pinpoint the molecular mechanism of host-virus interactions and identify host and viral genes essential for viral lytic replication. Finally, a bacterial artificial chromosome (BAC) system facilitates the introduction of mutations into the viral factor(s) that specifically interrupt the host-virus interaction. Recombinant &gamma;HV68 carrying these mutations can be used to recapitulate the phenotypes of &gamma;HV68 lytic replication in MEFs deficient in key host signaling components. This protocol offers an excellent strategy to interrogate host-pathogen interaction at multiple levels of intervention in vivo and ex vivo.
Recently, we have discovered that &gamma;HV68 usurps an innate immune signaling pathway to promote viral lytic replication5. Specifically, &gamma;HV68 de novo infection activates the immune kinase IKK&beta; and activated IKK&beta; phosphorylates the master viral transcription factor, replication and transactivator (RTA), to promote viral transcriptional activation. In doing so, &gamma;HV68 efficiently couples its transcriptional activation to host innate immune activation, thereby facilitating viral transcription and lytic replication. This study provides an excellent example that can be applied to other viruses to interrogate host-virus interaction.

We describe a protocol to identify key roles of host signaling molecules in lytic replication of a model herpesvirus, gamma herpesvirus 68 (&gamma;HV68). Utilizing genetically modified mouse strains and embryonic fibroblasts for &gamma;HV68 lytic replication, the protocol permits both phenotypic characterization and molecular interrogation of virus-host interactions in viral lytic replication.

In response to viral infection, a host develops various defensive responses, such as activating innate immune signaling pathways that lead to antiviral ...

Following Cell-fate in E. coli After Infection by Phage Lambda

The system comprising bacteriophage (phage) lambda and the bacterium E. coli has long served as a paradigm for cell-fate determination1,2. Following the simultaneous infection of the cell by a number of phages, one of two pathways is chosen: lytic (virulent) or lysogenic (dormant)3,4. We recently developed a method for fluorescently labeling individual phages, and were able to examine the post-infection decision in real-time under the microscope, at the level of individual phages and cells5. Here, we describe the full procedure for performing the infection experiments described in our earlier work5. This includes the creation of fluorescent phages, infection of the cells, imaging under the microscope and data analysis. The fluorescent phage is a "hybrid", co-expressing wild- type and YFP-fusion versions of the capsid gpD protein. A crude phage lysate is first obtained by inducing a lysogen of the gpD-EYFP (Enhanced Yellow Fluorescent Protein) phage, harboring a plasmid expressing wild type gpD. A series of purification steps are then performed, followed by DAPI-labeling and imaging under the microscope. This is done in order to verify the uniformity, DNA packaging efficiency, fluorescence signal and structural stability of the phage stock. The initial adsorption of phages to bacteria is performed on ice, then followed by a short incubation at 35&deg;C to trigger viral DNA injection6. The phage/bacteria mixture is then moved to the surface of a thin nutrient agar slab, covered with a coverslip and imaged under an epifluorescence microscope. The post-infection process is followed for 4 hr, at 10 min interval. Multiple stage positions are tracked such that ~100 cell infections can be traced in a single experiment. At each position and time point, images are acquired in the phase-contrast and red and green fluorescent channels. The phase-contrast image is used later for automated cell recognition while the fluorescent channels are used to characterize the infection outcome: production of new fluorescent phages (green) followed by cell lysis, or expression of lysogeny factors (red) followed by resumed cell growth and division. The acquired time-lapse movies are processed using a combination of manual and automated methods. Data analysis results in the identification of infection parameters for each infection event (e.g. number and positions of infecting phages) as well as infection outcome (lysis/lysogeny). Additional parameters can be extracted if desired.

Following Cell-fate in E. coli After Infection by Phage Lambda

This article describes the procedure for preparing a fluorescently-labeled version of bacteriophage lambda, infection of E. coli bacteria, following the infection outcome under the microscope, and analysis of infection results.

The system comprising bacteriophage (phage) lambda and the bacterium E. coli has long served as a paradigm for cell-fate determination1,2. Following the ...

Induction of Graft-versus-host Disease and In Vivo T Cell Monitoring Using an MHC-matched Murine Model

Graft-versus-host disease (GVHD) is the limiting barrier to the broad use of bone marrow transplant as a curative therapy for a variety of hematological deficiencies. GVHD is caused by mature alloreactive T cells present in the bone marrow graft that are infused into the recipient and cause damage to host organs. However, in mice, T cells must be added to the bone marrow inoculum to cause GVHD. Although extensive work has been done to characterize T cell responses post transplant, bioluminescent imaging technology is a non-invasive method to monitor T cell trafficking patterns in vivo. 
Following lethal irradiation, recipient mice are transplanted with bone marrow cells and splenocytes from donor mice. T cell subsets from L2G85.B6 (transgenic mice that constitutively express luciferase) are included in the transplant. By only transplanting certain T cell subsets, one is able to track specific T cell subsets in vivo, and based on their location, develop hypotheses regarding the role of specific T cell subsets in promoting GVHD at various time points. At predetermined intervals post transplant, recipient mice are imaged using a Xenogen IVIS CCD camera. Light intensity can be quantified using Living Image software to generate a pseudo-color image based on photon intensity (red = high intensity, violet = low intensity). 
Between 4-7 days post transplant, recipient mice begin to show clinical signs of GVHD. Cooke et al.1 developed a scoring system to quantitate disease progression based on the recipient mice fur texture, skin integrity, activity, weight loss, and posture. Mice are scored daily, and euthanized when they become moribund. Recipient mice generally become moribund 20-30 days post transplant. 
Murine models are valuable tools for studying the immunology of GVHD. Selectively transplanting particular T cell subsets allows for careful identification of the roles each subset plays. Non-invasively tracking T cell responses in vivo adds another layer of value to murine GVHD models.

Induction of Graft-versus-host Disease and In Vivo T Cell Monitoring Using an MHC-matched Murine Model

Murine bone marrow transplantation is a widely used technique to study immunological mechanisms governing graft-versus-host disease in humans. The ability to monitor T cell trafficking patterns in vivo allows for detailed analysis of the development and perpetuation of T cell responses during graft-versus-host disease.

Graft-versus-host disease (GVHD) is the limiting barrier to the broad use of bone marrow transplant as a curative therapy for a variety of hematological ...

Culturing Microglia from the Neonatal and Adult Central Nervous System

Microglia are the resident macrophage-like cells of the central nervous system (CNS) and, as such, have critically important roles in physiological and pathological processes such as CNS maturation in development, multiple sclerosis, and spinal cord injury. Microglia can be activated and recruited to action by neuronal injury or stimulation, such as axonal damage seen in MS or ischemic brain trauma resulting from stroke. These immunocompetent members of the CNS are also thought to have roles in synaptic plasticity under non-pathological conditions. We employ protocols for culturing microglia from the neonatal and adult tissues that are aimed to maximize the viable cell numbers while minimizing confounding variables, such as the presence of other CNS cell types and cell culture debris. We utilize large and easily discernable CNS components (e.g. cortex, spinal cord segments), which makes the entire process feasible and reproducible. The use of adult cells is a suitable alternative to the use of neonatal brain microglia, as many pathologies studied mainly affect the postnatal spinal cord. These culture systems are also useful for directly testing the effect of compounds that may either inhibit or promote microglial activation. Since microglial activation can shape the outcomes of disease in the adult CNS, there is a need for in vitro systems in which neonatal and adult microglia can be cultured and studied.

We outline methods for the efficient and quick isolation/culture of viable microglia from the neonatal cerebral cortex and adult spinal cord. The dissection and plating of cortical microglia can be accomplished within 90 minutes, with the subsequent microglial harvest taking place ~ 10 days following the initial dissection.

Microglia are the resident macrophage-like cells of the central nervous system (CNS) and, as such, have critically important roles in physiological and ...

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

The investigation of the intracellular protein levels of bacterial species is of importance to understanding the pathogenic mechanisms of diseases caused by these organisms. Here we describe a procedure for protein extraction from Burkholderia species based on mechanical lysis using glass beads in the presence of ethylenediamine tetraacetic acid and phenylmethylsulfonyl fluoride in phosphate buffered saline. This method can be used for different Burkholderia species, for different growth conditions, and it is likely suitable for the use in proteomic studies of other bacteria. Following protein extraction, a two-dimensional (2-D) gel electrophoresis proteomic technique is described to study global changes in the proteomes of these organisms. This method consists of the separation of proteins according to their isoelectric point by isoelectric focusing in the first dimension, followed by separation on the basis of molecular weight by acrylamide gel electrophoresis in the second dimension. Visualization of separated proteins is carried out by silver staining.

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Members of the Burkholderia genus are pathogens of clinical importance. We describe a method for total bacterial protein extraction, using mechanical disruption, and 2-D gel electrophoresis for subsequent proteomic analysis.

The investigation of  the intracellular protein levels of bacterial species is of importance to  understanding the pathogenic mechanisms of diseases ...

Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression System

A new generation of cell-free transcription-translation (TXTL) systems, engineered to have a greater versatility and modularity, provide novel capabilities to perform basic and applied sciences in test tube reactions. Over the past decade, cell-free TXTL has become a powerful technique for a broad range of novel multidisciplinary research areas related to quantitative and synthetic biology. The new TXTL platforms are particularly useful to construct and interrogate biochemical systems through the execution of synthetic or natural gene circuits. In vitro TXTL has proven convenient to rapidly prototype regulatory elements and biological networks as well as to recapitulate molecular self-assembly mechanisms found in living systems. In this article, we describe how infectious bacteriophages, such as MS2 (RNA), &#934;&#935;174 (ssDNA), and T7 (dsDNA), are entirely synthesized from their genome in one-pot reactions using an all Escherichia coli, cell-free TXTL system. Synthesis of the three coliphages is quantified using the plaque assay. We show how the yield of synthesized phage depends on the biochemical settings of the reactions. Molecular crowding, emulated through a controlled concentration of PEG 8000, affects the amount of synthesized phages by orders of magnitudes. We also describe how to amplify the phages and how to purify their genomes. The set of protocols and results presented in this work should be of interest to multidisciplinary researchers involved in cell-free synthetic biology and bioengineering.

Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression System

A new generation of cell-free transcription-translation platforms has been engineered to construct biochemical systems in vitro through the execution of gene circuits. In this article, we describe how bacteriophages, such as MS2, &#934;&#935;174, and T7, are synthesized from their genome using an all E. coli cell-free TXTL system.

A new generation of cell-free transcription-translation (TXTL) systems, engineered to have a greater versatility and modularity, provide novel ...

Bioengineering

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome (HUS), colonize to the intestinal tract of humans. To study the detailed mechanism of EHEC colonization in vivo, it is essential to have animal models to monitor and quantify EHEC colonization. We demonstrate here a mouse-EHEC colonization model by transforming the bioluminescent expressing plasmid to EHEC to monitor and quantify EHEC colonization in living hosts. Animals inoculated with bioluminescence-labeled EHEC show intense bioluminescent signals in mice by detection with a non-invasive in vivo imaging system. After 1 and 2 days post infection, bioluminescent signals could still be detected in infected animals, which suggests that EHEC colonize in hosts for at least 2 days. We also demonstrate that these bioluminescent EHEC locate to mouse intestine, specifically in the cecum and colon, from ex vivo images. This mouse-EHEC colonization model may serve as a tool to advance the current knowledge of the EHEC colonization mechanism.

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

A detailed protocol of a mouse model for enterohemorrhagic E. coli (EHEC) colonization by using bioluminescence-labeled bacteria is presented. The detection of these bioluminescent bacteria by a non-invasive in vivo imaging system in live animals can advance our current understanding of EHEC colonization.

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome ...

Bacteriophage Effectiveness for Biocontrol of Foodborne Pathogens Evaluated via High-Throughput Settings

Bacterial pathogens continually challenge food safety systems worldwide. With increasing concerns about the emergence of heat- and sanitizer-resistant bacteria, novel antibacterial agents, are urgently needed. A bacteriophage-based biocontrol strategy is the therapeutic use of phages to control bacterial pathogens in agricultural settings. Phage biocontrol is increasingly accepted as a sustainable technology, effective at decontaminating foodborne pathogens. To ensure effective biocontrol outcomes, systematic screening of phage combinations against targeted bacteria under required environmental conditions is crucial. Antibacterial efficacy of phage cocktails may be affected by phage genera and combination, targeted bacterial strains, the multiplicity of infection, temperature, and time. To formulate a phage cocktail with superior efficacy, the proposed method was to systematically evaluate the effectiveness of individual phages and phage cocktails in killing foodborne bacterial pathogens under targeted conditions. Bacterial killing efficacy was monitored by measuring optical density at desired temperatures and durations. Superior phage efficacy was determined by complete inhibition of bacterial growth. The proposed method is a robust, evidence-based approach to facilitate formulating phage cocktails with superior antibacterial efficacy.

This protocol describes a robust method for using high-throughput settings to screen the antibacterial efficacy of bacteriophage cocktails.

Bacterial pathogens continually challenge food safety systems worldwide. With increasing concerns about the emergence of heat- and sanitizer-resistant ...

Using Bacterial LPS to Eliminate Bacteriophages from Salmonella Cultures

Bacteriophage Removal from Infected Salmonella Cultures

Bacteriophages, or simply phages, play a vital role in microbial environments, impacting bacterial populations and shaping their evolution and interactions. These organisms are viruses that infect and replicate within bacterial hosts. Phages are ubiquitous on Earth, highly diverse, and very abundant. While bacteriophages have valuable roles in different environments and are a key area of research in microbiology and ecology, their presence can be undesirable in certain industrial processes or products. Considering the abundance and ubiquity of bacteriophages on Earth, the design of procedures for the removal of bacteriophages from bacterial cultures is crucial in diverse laboratory and industrial applications to preserve the integrity of the cultures and ensure accurate experimental results or product quality. Here, we have fine-tuned a protocol to eliminate the bacteriophages from infected Salmonella enterica cultures, using a strategy based on the use of lipopolysaccharides (LPS) located in the outer membrane of Gram-negative bacteria. Bacterial LPS plays an important role in host recognition by phages, and we make use of this property to design an effective procedure for the removal of phages, which use LPS as a receptor, in Salmonella bacterial cultures.

Author Spotlight: Efficiently Eliminating Bacteriophages from Infected Salmonella Cultures Using Lipopolysaccharides

Bacteriophages, ubiquitous and diverse on Earth, infect and replicate within bacterial hosts, playing a crucial role in microbial ecosystems. Despite their importance, their presence may disrupt industrial processes. We have developed a method using bacterial lipopolysaccharides to eliminate bacteriophages from Salmonella cultures.

Bacteriophages, or simply phages, play a vital role in microbial environments, impacting bacterial populations and shaping their evolution and ...

Biology

Phage Transduction: A Method to Transfer Ampicillin Resistance from Donor to Recipient E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1 
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases Laboratories, Boston, MA
Transduction is a form of genetic exchange between bacteria that utilizes bacteriophages, or phages, a class of virus that infects exclusively prokaryotic organisms. This form of DNA transfer, from one bacterium to another by way of a phage, was discovered in 1951 by Norton Zinder and Joshua Ledererg, who termed the process &#34;transduction&#34; (1). Bacteriophages were first discovered in 1915 by British bacteriologist Frederick Twort, then independently discovered again in 1917 by French-Canadian microbiologist Felix d&#39;Herelle (2). Since then, the structure and function of these phages have been widely characterized (3), dividing these phages into two classes. The first of these classes are the lytic phages which upon infection multiply within the host bacterium, disrupting the bacterial metabolism, lysing the cell, and releasing progeny phage (4). As a result of this anti-bacterial activity and the increasing prevalence of antibiotic-resistant bacteria, these lytic phages have recently proved useful as a substitute treatment for antibiotics. The second of these classes are the lysogenic phages which can either multiply within the host via the lytic cycle or enter a quiescent state in which their genome is integrated into that of the host (Figure 1), a process known as lysogeny, with the ability for phage production to be induced in multiple later generations (4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10517/10517fig1.jpg" /> 
Figure 1: Infection of host cell by bacteriophage. Adsorption by the phage to the bacterial cell wall via interactions between the tail fibers and receptor (purple). Once on the cell surface, the phage is irreversibly attached to the bacterial cell using the base plate (black) which is moved to the cell wall by the contractile sheath (yellow). Phage genome (red) then enters the cell and integrates into the host cell genome.
While bacterial transduction is a naturally occurring process, using modern technology it has been manipulated for the transfer of genes into bacteria in the laboratory setting. By inserting genes of interest into the genome of a lysogenic phage, such as phage, one is able to transfer these genes into the genomes of bacteria and consequently express them within these cells. While other methods of gene transfer, such as transformation, use a plasmid for gene transfer and expression, the insertion of the phage genome into that of the recipient bacterium not only has the potential to confer new traits to this bacterium, but also allows for naturally occurring mutations and other factors of the cellular environment to alter the function of the transferred gene.
Compared to other methods of horizontal gene transfer, such as conjugation, transduction is fairly flexible in the criteria required for donor and recipient cells. Any genetic element that can fit inside the genome of the phage being used can be transferred from any strain of donor bacteria to any strain of recipient bacteria as long as both are permissive to the phage, requiring the expression of necessary phage receptors on the cell surfaces. Once this gene is moved out of the donor genome and packaged into the phage, it can be transferred to the recipient. Following transduction, it is necessary to select for recipient bacteria that contain the gene of interest have to be selected for. This could be done by use of a genetic marker, such as a FLAG-tag or polyhistidine-tag, to mark the gene of interest, or the intrinsic function of the gene, in the case of genes that encode for antibiotic resistance. Additionally, PCR could be used to further confirm successful transduction. By using primers for a region within the gene of interest and comparing signal to a positive control, bacteria that has the gene of interest, and a negative control, bacteria that underwent the same steps as the transduction reaction with no phage. While bacterial transduction is a useful tool in molecular biology, it has and continues to play an important role in the evolution of bacteria, particularly with regard to the recent rise of antibiotic resistance.
In this experiment, bacterial transduction was used to transfer the gene encoding for resistance to the antibiotic ampicillin from the W3110 strain of E.coli to the J53 strain via the P1 bacteriophage (5). This experiment consisted of two main steps. First, the preparation of P1 phage containing the ampicillin resistance gene from the donor strain. Second, the transfer of this gene to the recipient strain by transduction with the P1 phage (Figure 1). Once carried out, the successful transfer of the ampicillin resistance gene could be determined by qPCR (Figure 2). If transduction was successful, the J53 strain of E. coli would be resistant to ampicillin, and the gene conferring this resistance detectable by qPCR. If unsuccessful, there would be no detection of the ampicillin resistance gene and ampicillin would still function as an effective antibiotic against the J53 strain.

<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10517/10517fig2.jpg" /> 
Figure 2: The confirmation of successful transduction by qPCR. By comparing the Cq values detected for the gene of interest from the transduction reaction and the negative control reaction, and normalizing these values against a housekeeping gene, one was able to confirm that bacterial transduction was successful.

Phage Transduction: Transferring Ampicillin Resistance in E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases ...

T4 Bacteriophage and E. coli Interaction in the Murine Intestine: A Prototypical Model for Studying Host-Bacteriophage Dynamics In Vivo

Samenvatting

Meer video's verkennen