This work is supported by the National Natural Science Foundation of China (82060341,81560304) and by the Academician Innovation Platform Scientific Research Project of Hainan Province (YSPTZX202134).

NOTE: A total of five samples of C. megacephala samples were used in this protocol-three fresh samples (Fresh 1, Fresh 2, and Fresh 3), one sample stored in alcohol for 2 years (Old 1), and one sample stored in dry sealed storage for 2 years protected from light only (Old 2). Samples must be labeled according to the experimental requirements.
1. General sample storage and preparations
<ol>
	<li>Sample selection and preparation 
	NOTE: Be sure to work in the fume hood when applying ethyl acetate to execute necrophagous flies. Remove the liquid from the surface of the fly before weighing.
	<ol>
		<li>Fresh samples: Place three collected fly samples in gas vials after killing them with ethyl acetate. Weigh and name the samples as Fresh 1, Fresh 2, and Fresh 3 and use them immediately in experiments. 
		NOTE: The fresh fly samples in this protocol had masses of 56.8 mg, 49.3 mg, and 52.1 mg.</li>
		<li>Old sample 1: Take out fly samples killed by ethyl acetate and stored in alcohol-filled centrifuge tubes for 2 years in airtight containment, protected from light at room temperature. Weigh the sample after adsorbing the surface liquid with filter paper; call it Old 1. 
		NOTE: The mass of Old 1 was 42.3 mg in this protocol.</li>
		<li>Old sample 2: Take out the fly sample killed by ethyl acetate and stored in a centrifuge tube for 2 years in airtight containment, protected from light at room temperature. Weigh and call it Old 2.</li>
	</ol>
	</li>
	<li>Preparation before extraction
	<ol>
		<li>Add a small amount of liquid nitrogen to cool a stainless steel container; wait until all liquid nitrogen has evaporated.</li>
		<li>Put a fly sample in the container; pour in the liquid nitrogen slowly to prevent the liquid nitrogen from splashing and impacting the insect sample.</li>
		<li>Freeze the samples in liquid nitrogen. Remove samples after the liquid nitrogen evaporates.</li>
		<li>Separate the thorax individually, place in a 2 mL centrifuge tube, and cut into the smallest possible slices. 
		NOTE: Cut the sample into small pieces so that it can be fully cleaved, and DNA can be released in large quantities.</li>
		<li>Repeat the above steps for each fly, individually freeze, and then remove to a new centrifuge tube to prevent DNA cross-contamination.</li>
	</ol>
	</li>
</ol>
2. DNA extraction
NOTE: All centrifugation steps must be carried out at room temperature (15-25 &#176;C) in a microcentrifuge. All steps must be performed in strict adherence to the principles of asepsis and to avoid cross-contamination.
<ol>
	<li>Tissue lysis
	<ol>
		<li>Add 180 &#181;L of tissue lysis buffer to a 2 mL centrifuge tube containing a clipped sample.</li>
		<li>Add 20 &#181;L of proteinase K. Mix thoroughly by vortexing at 3 000 rpm for 10 s and incubate at 56 &#176;C until the insect tissues are completely lysed. 
		NOTE: Add more Proteinase K should be if the tissue is not fully digested. Lysis is usually complete in 1-3h, also can extend lysis time overnight.</li>
	</ol>
	</li>
	<li>DNA precipitation
	<ol>
		<li>Vortex at 3,000 rpm for 15 s. Add 200 &#181;L lysis buffer to the sample, and mix thoroughly by vortexing at 3,000 rpm for 15 s.</li>
		<li>Add 200 &#181;L of ethanol (96-100%) and mix again thoroughly by vortexing at 3,000 rpm for 15 s. 
		NOTE: Lysis buffer and ethanol can be preadded together in one step to save time. A white precipitate may form on the addition of lysis buffer and ethanol.</li>
	</ol>
	</li>
	<li>Pipet the mixture into the DNA adsorption column placed in a 2 mL collection tube. Centrifuge at 6,000 &#215; g for 1 min. Discard flowthrough and collection tube.</li>
	<li>Place the DNA adsorption column from the previous step in a new 2 mL collection tube, add 500 &#181;L of protein removal buffer, and centrifuge at 6,000 &#215; g for 1 min. Discard flowthrough and collection tube.</li>
	<li>Transfer the DNA adsorption column to a new 2 mL collection tube, add 500 &#181;L of desalination buffer, and centrifuge at 20,000 &#215; g for 3 min to dry the DNA adsorption column membrane. Discard flowthrough and collection tube. 
	NOTE: This centrifugation step ensures the removal of any residual ethanol before the following elution. If there is any carryover of ethanol, centrifuge again at 20,000 &#215; g for 1 min.</li>
	<li>Place the DNA adsorption column in a clean 2 mL microcentrifuge tube, directly pipet 100 &#181;L of DNA elution buffer onto the column membrane, incubate at room temperature for 1 min, and then centrifuge at 6,000 &#215; g for 1 min to elute. 
	NOTE: Elution with 100 &#181;L (instead of 200 &#181;L) increases the final DNA concentration in the eluate but also decreases the overall DNA yield. To maximize the DNA yield, repeat elution once as described in step 2.8.</li>
	<li>Store the DNA samples at 4 &#176;C (up to 1 week) or -80 &#176;C for long-term storage.</li>
</ol>
3. DNA concentration detection
<ol>
	<li>Determine the values of OD 260 and OD 280 to compare DNA purity and nucleic acid concentration by microplate reader. Repeat three times on each sample.</li>
	<li>Determine the concentration of the extracted DNA by fluorometer using its companion kit, with three replicates for each sample.
	<ol>
		<li>Take 190 &#181;L of working solution into two 0.5 mL centrifuge tubes, take 10 &#181;L each of Standard #1 and Standard #2, add them to the working solutions, and keep them away from light for not less than 15 min. 
		NOTE: Standard #1 and Standard #2 are accurately calibrated for a certain concentration of DNA. Standard solutions should be accurately configured to ensure the formation of an accurate standard curve. Standard #1 is a 0.2 ng/&#181;L double-stranded DNA (dsDNA) sample; standard #2 is 2,000 ng/&#181;L. The working solution is a dye that binds specifically to dsDNA.</li>
		<li>Take 2 &#181;L of test DNA and mix it with 198 &#181;L of working solution in a 0.5 mL centrifuge tube, and keep away from light for not less than 15 min. 
		NOTE: If the DNA concentration is low, add 5 &#181;L of test DNA with 195 &#181;L of working solution.</li>
		<li>After 15 min, turn on the instrument and select dsDNA Concentration Measurement | Long Range. First, test Standard #1, and then, Standard #2 to obtain the standard curve. 
		NOTE: The standard solution must be used on the same day after it is configured; leaving it for too long will result in a large error in the standard curve.</li>
		<li>Place the samples to be tested in the assay wells one by one, adjust the DNA spiking volume to 2 &#181;L, repeat the measurement three times, take the average value, and record.</li>
	</ol>
	</li>
</ol>
4. PCR and electrophoretic detection
NOTE: The mitochondrial CO <img alt="Equation 1" src="/files/ftp_upload/66737/66737eq01v2.jpg" style="margin: auto;" /> gene sequence with a length of 278 bp was taken for PCR amplification with forward primer C1-J-2495: CAGCTACTTTATGAGCTTTAGG, and reverse primer C1-N-2800: CATTTCAAGCTGTGTAAGCATC8, and then 2% agarose gel electrophoresis done to verify the amplification effect and amplification products&#39; length was verified.
<ol>
	<li>Set up 20 &#181;L of the PCR amplification system by adding 10 &#181;L of 2x Taq mix, 1 &#181;L of each primer, 5 &#181;L of ddH2O, and 3 &#181;L of template DNA; mix well for 10 s in a centrifuge.</li>
	<li>Use the following PCR cycling parameters: predenaturation 95 &#176;C for 10 min; denaturation 95 &#176;C for 30 s, annealing 48 &#176;C for 30 s, extension 72 &#176;C for 45 s for a total of 40 cycles; and final extension 72 &#176;C for 10 min.</li>
	<li>Subject the products after PCR to 2% agarose gel electrophoresis, and after electrophoresis, place them on a gel imaging system for photo analysis.</li>
</ol>

Assessing DNA Purity and Concentration in Fresh and Old Necrophilic Fly Samples

<ol>
	<li>Amendt, J., Richards, C. S., Campobasso, C. P., Zehner, R., Hall, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forensic+entomology:+applications+and+limitations.">Forensic entomology: applications and limitations.</a> Forensic Sci Med Pathol. 7 (4), 379-392 (2011).</li><li>Wydra, J., Matuszewski, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+optimal+post-eclosion+interval+while+estimating+the+post-mortem+interval+based+on+an+empty+puparium.">The optimal post-eclosion interval while estimating the post-mortem interval based on an empty puparium.</a> Forensic Sci Med Pathol. 17 (2), 192-198 (2021).</li><li>Mazzanti, M., Alessandrini, F., Tagliabracci, A., Wells, J. D., Campobasso, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+degradation+and+genetic+analysis+of+empty+puparia:+genetic+identification+limits+in+forensic+entomology.">DNA degradation and genetic analysis of empty puparia: genetic identification limits in forensic entomology.</a> Forensic Sci Int. 195 (1-3), 99-102 (2010).</li><li>Odeniran, P. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=molecular+identification+and+distribution+of+Trypanosome-transmitting+Dipterans+from+cattle+settlements+in+Southwest+Nigeria.">molecular identification and distribution of Trypanosome-transmitting Dipterans from cattle settlements in Southwest Nigeria.</a> Acta Parasitol. 66 (1), 116-128 (2021).</li><li>Wells, J. D., Stevens, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+DNA-based+methods+in+forensic+entomology.">Application of DNA-based methods in forensic entomology.</a> Annu Rev Entomol. 53, 103-120 (2008).</li><li>Kotrba, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+barcoding+in+forensic+entomology-establishing+a+DNA+reference+library+of+potentially+forensic+relevant+arthropod+species.">DNA barcoding in forensic entomology-establishing a DNA reference library of potentially forensic relevant arthropod species.</a> J Forensic Sci. 64 (2), 593-601 (2019).</li><li>Weedon, M. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+SNP+chips+to+detect+rare+pathogenic+variants:+Retrospective,+population+based+diagnostic+evaluation.">Use of SNP chips to detect rare pathogenic variants: Retrospective, population based diagnostic evaluation.</a> BMJ. 372, 214 (2021).</li><li>Cai, J. -. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+availability+of+mitochondrial+DNA+cytochrome+oxidasegene+for+the+distinction+of+forensically+important+flies+in+China.">The availability of mitochondrial DNA cytochrome oxidasegene for the distinction of forensically important flies in China.</a> Acta Entomologica Sinica. 48 (3), 380-385 (2005).</li><li>Khayrova, A., Lopatin, S., Varlamov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obtaining+chitin,+chitosan+and+their+melanin+complexes+from+insects.">Obtaining chitin, chitosan and their melanin complexes from insects.</a> Int J Biol Macromol. 167, 1319-1328 (2021).</li><li>Guo, Y. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+DNA+extracting+methods+from+different+parts+of+common+necrophagous+flies.">Comparison of three DNA extracting methods from different parts of common necrophagous flies.</a> J Henan Univ Sci Tech (Med Sci). 36 (02), 130-133 (2018).</li><li>Du, H., Xie, H., Ma, M., Igarashi, Y., Luo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modified+methods+obtain+high-quality+DNA+and+RNA+from+anaerobic+activated+sludge+at+a+wide+range+of+temperatures.">Modified methods obtain high-quality DNA and RNA from anaerobic activated sludge at a wide range of temperatures.</a> J Microbiol Methods. 199, 106532 (2022).</li><li>Sukumaran, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concentration+determination+of+nucleic+acids+and+proteins+using+the+micro-volume+BioSpec-nano-spectrophotometer.">Concentration determination of nucleic acids and proteins using the micro-volume BioSpec-nano-spectrophotometer.</a> J Vis Exp. (48), e2699 (2011).</li><li>Masago, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+between+fluorimetry+(Qubit)+and+spectrophotometry+(NanoDrop)+in+the+quantification+of+DNA+and+RNA+extracted+from+frozen+and+FFPE+tissues+from+lung+cancer+patients:+A+real-world+use+of+genomic+tests.">Comparison between fluorimetry (Qubit) and spectrophotometry (NanoDrop) in the quantification of DNA and RNA extracted from frozen and FFPE tissues from lung cancer patients: A real-world use of genomic tests.</a> Medicina (Kaunas). 57 (12), 1375 (2021).</li><li>Ponti, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+value+of+fluorimetry+(Qubit)+and+spectrophotometry+(NanoDrop)+in+the+quantification+of+cell-free+DNA+(cfDNA)+in+malignant+melanoma+and+prostate+cancer+patients.">The value of fluorimetry (Qubit) and spectrophotometry (NanoDrop) in the quantification of cell-free DNA (cfDNA) in malignant melanoma and prostate cancer patients.</a> Clin Chim Acta. 479, 14-19 (2018).</li><li>Adams, Z. J., Hall, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+used+for+the+killing+and+preservation+of+blowfly+larvae,+and+their+effect+on+post-mortem+larval+length.">Methods used for the killing and preservation of blowfly larvae, and their effect on post-mortem larval length.</a> Forensic Sci Int. 138 (1-3), 50-61 (2003).</li><li>Fliegerova, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+DNA+extraction+and+sample+preservation+method+on+rumen+bacterial+population.">Effect of DNA extraction and sample preservation method on rumen bacterial population.</a> Anaerobe. 29, 80-84 (2014).</li><li>Rodrigues, B. L., Galati, E. A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+taxonomy+of+phlebotomine+sand+flies+(Diptera,+Psychodidae)+with+emphasis+on+DNA+barcoding:+A+review.">Molecular taxonomy of phlebotomine sand flies (Diptera, Psychodidae) with emphasis on DNA barcoding: A review.</a> Acta Trop. 238, 106778 (2023).</li></ol>

The authors declare that they have no competing financial interests.

DNA extraction is the most critical link in the molecular identification of necrophilous flies, and its extraction method and the quality of the extracted DNA directly affect subsequent detection. In this experiment, we successfully extracted DNA from necrophilous flies by using a common blood kit, without the need to purchase a special insect DNA extraction kit, which makes insect DNA extraction easier to accomplish.
The surface of flies is rich in chitin, especially in the larval and pupal s...

<a href="https://app.jove.com/t/6604">This corrects</a> the article <a href="https://dx.doi.org/10.3791/66737">10.3791/66737</a>

An erratum was issued for:&#160;<a href="https://www.jove.com/t/66737">DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples</a>. The Authors section was updated.

Erratum: DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples

The inference of the time of death has always been one of the key and difficult issues to be resolved in judicial practice. In the practice of forensic science, for a criminal case, determining postmortem interval plays a crucial role in deducing the time of the crime, locking in the suspect, and narrowing the scope of the investigation. Traditional methods of inferring the time of death are based primarily on early postmortem phenomena, which can generally only be used to infer the time of death within 24 h. However, the long time of death cannot be determined by postmortem phenomena. It is now generally recognized in the forensic science community that forensic entomology has the potential to be an effective method of inferring a longer time of death.
Necrophagous insects are named for their larvae that feed on corpses. Among them, whenever a corpse is present, the adult necrophilous flies will be the first to reach the corpse and lay their eggs or larvae. The larvae feed on corpse tissue and mature into pupae, which fledge into adults. Necrophilic flies play a huge role in the practice of forensic science because of their regular life cycle and geographic distribution, for example, deducting the time of death and determining the place of death1,2. However, the barrier to the use of necrophilous flies in forensic practice is species identification. Morphological methods are still used as the authoritative method for species identification of necrophilous flies. However, morphological species identification requires a high degree of insect integrity. If the flies were in different developmental stages, or due to morphological changes caused by environmental choices, those all make morphological examination more difficult. In particular, the morphology of pupae and pupal shells, which are most often found at the crime scene, is barely recognizable. This, together with the scarcity of morphological experts, makes huge difficulty to the identification of species morphologically. Therefore, the application of molecular biology methods for species identification of flies has emerged, which reduces the difficulty of morphological identification and is independent of developmental stage3,4,5,6,7.
The first step in species identification of necrophilous flies based on molecular biology methods is the efficient extraction of DNA, while specialized kits for insect DNA extraction are not commonly available currently. And how to use common blood kits for DNA extraction of necrophilic flies becomes more forensically relevant. Necrophilic flies found at crime scenes are often mutilated or have undergone decay and DNA degradation. Fly samples are not immediately available for DNA extraction after acquisition, or if possible, complete samples need to be retained due to evidence preservation requirements. Based on the above requirements, in this study, we applied the blood DNA kit based on proteinase K digestion, and selected three fresh Chrysomya megacephala (Diptera, Lepidoptera) samples (Figure 1), one old C. megacephala sample placed in alcohol for two years, and one C. megacephala sample placed in light-protected storage for two years, weighed each of the five samples, elected the insect thorax tissue for DNA extraction. Comparing the quality and purity of DNA extracted from the old and new samples, PCR amplification and electrophoresis of the extracted DNA were performed with necrophilic fly-specific primers located in the mitochondrial CO <img alt="Equation 1" src="/files/ftp_upload/66737/66737eq01v2.jpg" style="margin: auto;" /> gene sequence.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Buffer AE</td>
			<td>Qiagen</td>
			<td>172026832</td>
			<td>DNA elution buffer</td>
		</tr>
		<tr>
			<td>Buffer AL</td>
			<td>Qiagen</td>
			<td>172028374</td>
			<td>lysis buffer</td>
		</tr>
		<tr>
			<td>Buffer ATL</td>
			<td>Qiagen</td>
			<td>172028162</td>
			<td>tissue lysis buffer</td>
		</tr>
		<tr>
			<td>Buffer AW1</td>
			<td>Qiagen</td>
			<td>172028760</td>
			<td>protein removal buffer</td>
		</tr>
		<tr>
			<td>Buffer AW2</td>
			<td>Qiagen</td>
			<td>57203108</td>
			<td>desalination buffer</td>
		</tr>
		<tr>
			<td>C1-J-2495</td>
			<td>Taihe Biotechnology</td>
			<td>TW21109216</td>
			<td>forword primer</td>
		</tr>
		<tr>
			<td>C1-N-2800</td>
			<td>Taihe Biotechnology</td>
			<td>TW21109217</td>
			<td>reverse primer</td>
		</tr>
		<tr>
			<td>D2000 DNA ladder</td>
			<td>Real-Times(Beijing) Biotechnology</td>
			<td>RTM415</td>
			<td>Measure the position of electrophoretic bands</td>
		</tr>
		<tr>
			<td>DNeasy Mini spin column</td>
			<td>Qiagen</td>
			<td>166050343</td>
			<td>DNA adsorption column</td>
		</tr>
		<tr>
			<td>Dry Bath Incubator</td>
			<td>Miulab</td>
			<td>DKT200-2D</td>
			<td>used for heating</td>
		</tr>
		<tr>
			<td>MIX-30S Mini Mixer</td>
			<td>Miulab</td>
			<td>MUC881206</td>
			<td>oscillatory action</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Qiagen</td>
			<td>172026218</td>
			<td>Inactivation of intracellular nucleases and other proteins</td>
		</tr>
		<tr>
			<td>Qubit 3.0 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>2321611188</td>
			<td></td>
		</tr>
		<tr>
			<td>Speed Micro-Centrifuge</td>
			<td>Scilogex</td>
			<td>9013001121</td>
			<td>centrifuge</td>
		</tr>
		<tr>
			<td>Standard#1</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
		<tr>
			<td>Standard#2</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
		<tr>
			<td>Tanon 3500R Gel Imager</td>
			<td>Tanon</td>
			<td>16T5553R-455</td>
			<td>gel imaging</td>
		</tr>
		<tr>
			<td>Taq Mix Pro</td>
			<td>Monad</td>
			<td>00007808-140534</td>
			<td>PCR Mix</td>
		</tr>
		<tr>
			<td>Taq Mix Pro</td>
			<td>Monad</td>
			<td>00007808-140534</td>
			<td>PCR Mix</td>
		</tr>
		<tr>
			<td>Thermo Cycler</td>
			<td>Zhuhai Hema</td>
			<td>VRB020A</td>
			<td>ordinary PCR</td>
		</tr>
		<tr>
			<td>Working Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
	</tbody>
</table>

dna extraction and comparison between old and fresh necrophilic fly samples

A total of five samples of Chrysomya megacephala samples - three fresh samples, one sample stored in alcohol for 2 years, and one sample stored in dry sealed storage for 2 years protected from light only - were selected to investigate whether a blood DNA extraction kit could extract DNA from necrophilous flies and to determine whether alcohol could prolong the preservation of necrophilous flies&#39; DNA. First, the blood DNA extraction kit was used to extract DNA from their thorax tissues. Then, the DNA purity and concentration were examined using a microplate reader and a fluorometer. Finally, PCR amplification and electrophoresis of the extracted DNA were done with necrophilic fly-specific primers located in the mitochondrial CO I gene sequence. The results showed that the DNA purity of all samples was greater than 2.0. The DNA concentration was observed to be of the following order: fresh samples &#62; alcohol-preserved old samples &#62; untreated, old samples. All samples had specific electrophoretic bands after PCR amplification. In conclusion, a blood DNA extraction kit can be used to extract DNA from necrophilic flies successfully, and the DNA concentration of fresh fly samples is greater than that of old fly samples. The flies can be stored in alcohol for a long time.

Author Spotlight: Advancing DNA Extraction from Necrophilic Fly Samples using Simple Technique

DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples

Our particle aims to extract fly DNA simply and conveniently, and compare the DNA concentrations between new and old samples of necrophilic flies. We're trying investigating whether blood DNA extraction kits effectively extract DNA from fly, and is there a change between DNA concentrations from new and old sample of necrophilic flies? We provided a method for extracting fly DNA using ordinary blood test kits, which solved the problem of expensive and scarce insect extraction kits, and paved the way for molecular biology analysis of these sets.After solving the problem of extracting fly DNA, necrophilic flies to avert the time of death.

We used a microplate reader to measure the values of OD260 and OD280 of the extracted DNA solution and then obtained the OD260/OD280 values to evaluate the purity of the DNA. The OD260/OD280 of all fresh samples and old sample 1 was greater than 2. The OD260/OD280 of old sample 2 had a maximum value of 2.187 although the average was 1.753, and its three measurements fluctuated greatly due to the small (&#8804;0.01) values of both its OD280 and OD280 (Table 1). Based on the value of OD260 obtained, we est...

Read this Scientific Article Protocol about DNA Extraction and Comparison between Old and Fresh Necrophilic Fly Samples at JoVE.com

This article describes a protocol for fresh and old necrophilic fly DNA extraction using a modified common DNA extraction kit.

A total of five samples of Chrysomya megacephala samples - three fresh samples, one sample stored in alcohol for 2 years, and one sample stored in dry ...

dna-extraction-comparison-between-old-fresh-necrophilic-fly

Research

JoVE Journal

Medicine

Preparation of Necrophilic Fly Samples for DNA Extraction

To begin, sacrifice flies with ethyl acetate, and place the samples in three gas vials. Weigh the samples, and label them as fresh one, two, and three. Next, retrieve 2-year-old samples stored in alcohol filled centrifuge tubes, and absorb surface liquid with filter paper and weigh the samples.Also, retrieve 2-year-old samples stored in centrifuge tubes and weigh them. Then, add a small amount of liquid nitrogen to a stainless steel container, and wait until all liquid nitrogen has evaporated. Place a fly sample in the container, and slowly pour liquid nitrogen.Freeze the samples in liquid nitrogen, and remove them after the liquid nitrogen evaporates. Separate the thorax individually, followed by slicing each thorax. Place the slices in a two milliliter centrifuge tube.

DNA Extraction from Necrophilic Fly Samples

To begin place the clipped fly thorax samples in a two-milliliter centrifuge tube. Add 180 microliters of tissue lysis buffer to the tube, followed by 20 microliters of Proteinase K.Vortex thoroughly at 3, 000 RPM for 10 seconds and incubate at 56 degrees Celsius until tissues are lysed. After incubation, vortex the samples again for 15 seconds.Add 200 microliters of lysis buffer, and mix thoroughly by vortexing. Then add 200 microliters of ethanol and vortex again for 15 seconds. Next, place a DNA absorption column in a two-milliliter collection tube and pipette the mixture into the column.Centrifuge at 6, 000 G for one minute. Discard flow through and the collection tube. Place the column in a new tube and add 500 microliters of protein removal buffer.Centrifuge for one minute and discard the flow through. Transfer the column to a new tube. Add 500 microliters of desalination buffer and centrifuge at 20, 000 G for three minutes to dry the membrane.Then add 100 microliters of DNA elution buffer onto the membrane. Incubate a room temperature for one minute and then centrifuge at 6, 000 G for one minute to elute the DNA. Store the DNA samples as appropriate.

Qualitative and Quantitative Analysis of DNA Extracted from Fly Samples

To begin, extract DNA from fly samples using a DNA extraction kit. Then use a microplate reader to determine the values of OD260 and OD280 to compare DNA purity and nucleic acid concentration. Next, prepare fluorometer standard solutions by adding 190 microliters of working solution to two 0.5 milliliters centrifuge tubes.Then add 10 microliters each of standard one and standard two to the working solutions. Keep the tubes away from light for at least 15 minutes. Mix two microliters of test DNA with 198 microliters of working solution in a 0.5 milliliter centrifuge tube and keep the mixture in the dark for at least 15 minutes.After 15 minutes, turn on the fluorometer and select the dsDNA concentration measurement, long range setting. Test standard one and standard two to obtain the standard curve. Then place the samples to be tested in the assay wells.Adjust the DNA spiking volume to two microliters and perform the measurement. To visualize the DNA first set up 20 microliters of the PCR amplification reaction. Place the tubes in a thermal cycler and run the PCR cycles.After PCR, subject the products to 2%agarose gel electrophoresis. Then place the gel on a gel imaging system for photo analysis. Assessment of extracted DNA purity by Microplate reader showed that all fresh samples and old sample one had OD260 to OD280 ratios above two.In contrast, old sample two displayed a lower ratio. DNA concentration derived from OD260 readings was highest in fresh samples, followed by old sample one and lowest in old sample two. Electrophoretic analysis revealed bands in the range of 250 to 400 base pairs, which were more pronounced in fresh samples, compared to old ones.

272 Views.  Hainan Medical University, Hainan Provincial Academician Workstation (tropical forensic medicine).  This article describes a protocol for fresh and old necrophilic fly DNA extraction using a modified common DNA extraction kit.

Assessing DNA Purity and Concentration in Fresh and Old Necrophilic Fly Samples

Podsumowanie