Name: methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum
Uploaded: 2015-12-04T14:00:00.000+00:00
Duration: 10 min 22 s
Description: Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: Isolation of Small-sized RNAs from P. falciparum During the IDC
<ol>
	<li>Obtain malaria parasites in asexual culture29. 
	NOTE: The required culture size will vary based upon the desired application; however, a 10 ml culture at 3-5% parasitemia and 5% hematocrit provides ample RNA for real-time PCR (RT-PCR). The technique was initially optimized for asynchronous cultures, but when specific time points during the infection cycle are desired, ring-stage parasites can be synchronized by sorbitol synchronization no later than 10-12 hr post-invasion. Synchronization should be repeated after one cycle (approximately 48 hr)29 .</li>
	<li>Pool infected cells together (~5 x 109 RBCs at 3-5% parasitemia) and fill cold PBS to the top of the tube and centrifuge at 800 x g for 5 min without brake to pellet the red cells.</li>
	<li>After centrifugation, remove the supernatant carefully using an aspirating pipette, attached to a vacuum, since the erythrocytic pellet is easy to dislodge. Wash the pellet once more with cold 1x PBS.</li>
	<li>Resuspend cell pellet in cold 0.15% saponin (in 1x PBS) and place on ice for 30 min.</li>
	<li>Centrifuge cells at 1,500 x g for 12 min at 4 &#176;C, remove supernatant (which will be dark red in color) and resuspend pellet in cold PBS. Repeat this step once more. 
	NOTE: In order to ensure that the microRNAs present were reflective of microRNAs within parasites, and not erythrocytic contamination, a number of parasite isolation conditions were tested: 1) saponin lysis, 2) saponin lysis combined with RNaseA treatment of host cell miRNAs and 3) Methyl-beta-cyclodextrin treatment to remove the parasite from the host erythrocyte. All treatments gave similar results.</li>
	<li>Lyse the isolated parasite pellet using the recommended 600 &#181;l of lysis buffer. This volume of lysis buffer is sufficient for cultures up to ~30 ml at 2% hematocrit and 5% parasitemia. 
	NOTE: For larger parasite cultures, this volume can be increased. It is important to ensure complete lysis of the parasite pellet by thorough vortexing for at least 1 min. Also, for ease of extraction, the lysed samples can be transferred to a 1.7 ml microcentrifuge tube.</li>
	<li>Add 60 &#181;l, or 1/10 volume of the lysis buffer used in step 6, of homogenate additive (2 M sodium acetate, pH 4).</li>
	<li>Leave samples on ice for 10 min.</li>
	<li>Add 600 &#181;l, or a volume equal to the amount of lysis buffer added in step 6, of acid phenol choloroform to each sample and vortex for 1 min.</li>
	<li>Separate the aqueous and organic phases by centrifuging the samples at 10,000 x g for 5 min. This spin is longer than that suggested by the kit to ensure that all hemoglobin/hemozoin is in the organic phase.</li>
	<li>Collect the upper (aqueous) layer and transfer it to a fresh tube. Repeat steps 9 and 10 if the aqueous phase is white or (more likely) brown in color, which suggests protein contamination.</li>
	<li>Determine the volume of the resulting supernatant by pipette and then add 1.25 volumes of 100% ethanol (~800 &#181;l) and mix by inverting the 1.7 ml microcentrifuge tube 5 times.</li>
	<li>Pass each sample through a provided RNA-binding filter cartridge (several different of which are available commercially) by either centrifugation at 14,000 x g for 1 min or by using a vacuum manifold.</li>
	<li>Wash the filter cartridge with 700 &#181;l of the miRNA wash buffer 1 using a microcentrifuge, spinning at 14,000 x g for 1 min.</li>
	<li>Wash the filter cartridge with 500 &#181;l wash buffer 2/3 twice by centrifuging at 14,000 x g for 1 min each.</li>
	<li>Elute RNA with 100 &#181;l DEPC-water, which has been preheated to 95 &#186;C, in two washes of 50 &#181;l, centrifuging at 14,000 x g for 1 min each. Measure the concentration of RNA via UV absorbance at 260nm. 
	NOTE: An RNA gel (either TBE-urea acrylamide or denaturing formaldehyde agarose gel) can be used to assess the size distribution of the isolated RNAs. 
	NOTE: This RNA is suitable for analysis by microarray, RNA-sequencing, northern blot and ribonuclease protection assay.</li>
</ol>
2: Quantitation of Small-sized RNAs from P. falciparum During the IDC
<ol>
	<li>Determine the concentration of individual samples isolated in step 1 using UV spectrophotometry at 260 nm.</li>
	<li>Generate real-time PCR primers for the desired RNA species. For miRNA alone, we used premade miRNA qPCR assays, while for mRNAs or fusion miRNA-mRNA we designed primers for SYBR green. For the fusion RNAs, the forward primer was the miRNA sequence itself (miR-451: AAACCGTTACCATTACTGAGTT), while the reverse was a gene-specific primer ~100 bp downstream of the miRNA in the mRNA sequence (PKA-R: ATCGAACATGCTGTGAACAT).</li>
	<li>Make cDNA from the RNA samples using either a hairpin primer for miRNAs (use 20-40 ng of RNA) alone or random hexamers for mRNA and/or miRNA-mRNA fusion species (using 1 &#181;g of RNA). Mix RNA and primers for 5 min at 65 &#176;C, then cool to room temperature. Afterwards, add reverse transcriptase mix (0.5 &#181;l reverse transcriptase, 0.5 &#181;l RNase inhibitor, 1 &#181;l dNTPs (2.5 mM each), 4 &#181;l 5x buffer, 2 &#181;l 0.1M DTT, 1 &#181;l H2O).
	<ol>
		<li>Run samples on a thermocycler capable of detecting either SYBR green or TaqMan probes. SYBR green quantitative PCR30 for specific genes was run as a 3-step PCR, 95 &#176;C for 15 sec, lowest primer annealing temperature minus 5 &#176;C for 30 sec, and 68 &#176;C for 30 sec, for 40 cycles, using a commercial SYBR green master mix. miRNA real-time PCR was run as a two-step PCR, 95 &#176;C for 15 sec and 60 &#176;C for 1 min, for 40 cycles.</li>
		<li>Quantify assays using the &#916;&#916;Ct method and normalize them against either Rab GTPase (PF08_0110) or 18S rRNA 31.</li>
	</ol>
	</li>
</ol>
3: Introduction of Small RNAs into Malaria Parasites
<ol>
	<li>Pellet 300 &#181;l of red blood cells per transfection (250 &#181;l of RBCs, approximately 1.5 x 109 cells, will ultimately be used) in complete malaria media by centrifugation at 800 x g for 5 min at brake 1.</li>
	<li>Wash the erythrocytes twice with RPMI and resuspend in complete cytomix (120 mM KCl; 0.15 mM CaCl2; 10 mM K2HPO4/KH2PO4, pH 7.6; 25 mM HEPES, pH 7.6; 2 mM EGTA, pH 7.6; 5 mM MgCl2; pH adjusted with KOH) at 50% hematocrit after centrifuging at 800 x g for 5 min at brake 1.</li>
	<li>Transfer the cells to a 0.2 cm electroporation cuvette.</li>
	<li>Add 10 &#181;g, or appropriate amount, of custom synthetic oligonucleotides to the cuvettes and resuspend the cultures.</li>
	<li>Adjust the electroporator to 310 V/950 &#181;F and deliver a pulse to each cuvette.</li>
	<li>Resuspend the 300 &#181;l of RBCs within the cuvette in pre-warmed complete malaria media and plate them in 24 well plates and incubate at 37&#160;&#176;C in an airtight container with malaria blood gas mix (3% O2, 5% CO2).</li>
	<li>After 4 hr, infect transfected RBCs with synchronized late trophozoites to an approximate final parasitemia of 1%.</li>
	<li>Add freshly transfected RBCs every 4-6 days to infected cultures and determine the % parasitemia by FACS using YoYo-1 staining, as indicated in section 4.</li>
</ol>
4: Determination of Erythrocyte microRNAs Effect Upon Parasite Infection Rate
<ol>
	<li>Take 100 &#181;l of resuspended culture by micropipettor and place in a 1.7 ml microcentrifuge tube. Wash twice with 1 ml of 1x PBS and centrifuge in a tabletop microcentrifuge by centrifugation at 800 x g for 5 min.</li>
	<li>Resuspend pellet in 1 ml of 0.025% glutaraldehyde. Incubate samples for 20 min at RT. 
	NOTE: samples can be stored here for several weeks at 4 &#176;C. Afterwards, pellet the infected RBCs by centrifugation at 800 x g for 5 min. Wash twice with 1 ml of 1x PBS.</li>
	<li>Resuspend pellet in 1 ml of 0.015% saponin. Incubate at 4 &#176;C for 15 min. Pellet infected RBCs by centrifugation at 800 x g for 5 min. Wash twice with 1 ml of 1x PBS. Repeat.4.3. Resuspend cells in 1 ml of 1x PBS containing 1 &#181;l (1,000X) DNA stain.</li>
	<li>Determine the degrees of parasitemia on a flow cytometer, at 488 nM excitation and ~530 nM (FL-1) emission.</li>
	<li>First, gate the flow cytometer based upon FSC and SSC to focus on RBCs. Then measure the degrees of parasitemia (infected RBCs) in the gated RBC by fluorescence in the FL-1 channel. 
	NOTE: later stage parasites are 10X more fluorescent than earlier stage parasites, and ~100X above uninfected RBCs. Also, collecting at low speed tends to reduce noise. Finally, this approach has been compared to 3H-hypoxanthine incorporation and Giemsa staining, both as reported previously13, and all techniques gave similar results.</li>
</ol>
5: Biotin-tagging and Elution of miRNA-mRNA Fusion Products
<ol>
	<li>Directly order custom synthetic RNA oligonucleotides with desthiobiotin (Db-) covalently linked to the 5&#39; end.</li>
	<li>Transfect uninfected RBCs with Desthiobiotin-conjugated (Db-) miRNA and unmodified miRNA (negative control), as indicated in step 3.</li>
	<li>Infect transfected RBCs with P. falciparum parasites to a starting parasitemia of 0.5% (step 1.1).</li>
	<li>Extract parasite RNA 4 days (96 hr) later as described above in step 1.</li>
	<li>Incubate 10 &#181;g of parasite RNA with 50 &#181;l packed streptavidin beads, added via micropipette, and rotate on a microcentrifuge tube rotator for 1 hour at 4 &#176;C.</li>
	<li>Pellet the beads at 800 x g for 30 sec and wash with 20 mM KCl and 1/1,000 RNase Inhibitor.</li>
	<li>Elute RNAs from the beads by competition with 2 mM biotin and with 200 &#181;l RNA capture elution buffer (20 mM KCl, 1/1,000 RNase Inhibitor and 2 mM biotin) at 4 &#176;C overnight with rotation.</li>
	<li>Determine the degree of enrichment of indicated P. falciparum transcripts using SYBR green qRT-PCR, and microRNA enrichment (positive control) by TaqMan qPCR as indicated in step 2.</li>
</ol>
6: Polysome Separation to Determine the Ribosomal Occupancy of P. falciparum
<ol>
	<li>Place 5 ml of 15% sucrose solution (400 mM potassium acetate, 25 mM potassium HEPES, pH 7.2, 15 mM magnesium acetate, 200 &#181;M cycloheximide, 1 mM DTT, 1 mM PMSF, 40 U/ml RNase Inhibitor, and 15% sucrose) into a SW41 ultracentrifuge tube (14 x 89 mm).</li>
	<li>Using a 5 ml syringe, add 5 ml of 50% sucrose solution (400 mM potassium acetate, 25 mM potassium HEPES, pH 7.2, 15 mM magnesium acetate, 200 &#181;M cycloheximide, 1 mM DTT, 1 mM PMSF, 40 U/ml RNase Inhibitor, and 50% sucrose) underneath the 15% sucrose using a long steel needle, then remove the needle.</li>
	<li>Seal the top of the gradient tube with Parafilm, tilt the tube slowly onto its side, in a stable position to prevent rolling, so it is lying horizontally on the tabletop. Keep the tube on its side for at least 2 hr. While waiting, start with step 6.5.</li>
	<li>After 2 hr, slowly tilt the tube back upright and transfer the tube to ice, allowing it to cool for at least 15 min prior to sample loading (step 14).</li>
	<li>Collect enough Plasmodium-infected blood stage culture to generate 100-500 &#181;g of total RNA, or roughly a 100 ml asynchronous culture at 3-5% parasitemia. Add 1/10th that volume of culture medium containing 10x (2 mM) cycloheximide (CHX) and incubate at 37 &#176;C for 10 min.
	<ol>
		<li>Pellet cultures by centrifugation at 500 x g for 7 min with the centrifuge (brake 1), then wash twice with room temperature 1x PBS containing 200 &#181;M CHX. Resuspend the parasite cultures in 1x PBS containing 200 &#181;M CHX and store on ice.</li>
	</ol>
	</li>
	<li>Estimate the volume of the RBC pellet. Add lysis buffer (400 mM potassium acetate, 25 mM potassium HEPES, pH 7.2, 15 mM magnesium acetate, 200 &#181;M CHX, 1 mM DTT, 1 mM PMSF, 40 U/ml RNase Inhibitor, 1% (v/v) IGEPAL CA-630, and 0.5% (w/v) DOC) to the RBC pellet to a final volume of 4.25 ml. Incubate the lysate at 4 &#176;C for 10 min while rotating.</li>
	<li>Transfer the lysate to microcentrifuge tubes, and then centrifuge the samples in a microcentrifuge at 16,000 x g and 4 &#176;C for 10 min.</li>
	<li>Prepare sucrose cushions by pipetting 1.25 ml of cold 0.5 M sucrose cushion solution (400 mM potassium acetate, 25 mM potassium HEPES, pH 7.2, 15 mM magnesium acetate, 200 &#181;M cycloheximide, 1 mM DTT, 1 mM PMSF, 40 U/ml RNase Inhibitor, and 0.5 M sucrose) into a SW55 ultracentrifuge tube (13 x 51 mm).</li>
	<li>Carefully layer 3.75 ml of lysate supernatant (from step 7) on top of the sucrose cushion using a syringe and small (~27) gauge needle. Store the remaining lysate (~500 &#181;l) at -80 &#176;C to extract total RNA levels, as indicated in section 1.</li>
	<li>Load the samples into an ultracentrifuge rotor, pre-chilled to 4 &#176;C, which can hold 13.2 ml tubes. Centrifuge the samples at 366,000 x g and 4 &#176;C for 146 min.</li>
	<li>Using a pipette, transfer the supernatant into a 15mL conical tube. Store the supernatant at -80 &#176;C for RNA isolation of free (unbound by ribosomes) RNAs.</li>
	<li>Resuspend the ribosome pellet in 500 &#181;l of ribosome resuspension buffer (400 mM potassium acetate, 25 mM potassium HEPES, pH 7.2, 15 mM magnesium acetate, 200 &#181;M cycloheximide, 1 mM DTT, 1 mM PMSF, and 40 U/ml RNase Inhibitor) by pipetting for 5 min.</li>
	<li>Centrifuge the samples in a microcentrifuge at 16,000 x g and 4&#160;&#176;C for 10 min.</li>
	<li>While keeping the gradient from step #4 on ice, remove the Parafilm, then carefully layer the ribosome suspension on top of the gradient using a syringe and small (~27) gauge needle.</li>
	<li>Load the tube into a pre-chilled ultracentrifuge rotor and centrifuge the loaded gradients at 200,000 x g and 4&#160;&#176;C for 180 min. When the spin is completed, store centrifuged gradients at 4 &#176;C until ready to load onto the fractionator.</li>
	<li>Load an empty ultracentrifuge tube into the gradient fractionator (this can be a tube used in a previous run), then wash with RNAse-free water for 5 min at 100 x 10 speed.</li>
	<li>During the wash in step 6.16, set the sensitivity of the UV absorbance detector. A good starting sensitivity is 0.2, but this may have to be adjusted in later runs depending on the A254 signal (which varies based on parasite number, etc.).</li>
	<li>Once the detector sensitivity is set, set the baseline signal to zero while water is flowing through the detector.</li>
	<li>After washing the fraction collector, reverse the fluid flow until the lines are empty and then remove the empty ultracentrifuge tube.</li>
	<li>Run 60% sucrose solution through the fractionator until it exits the needle apparatus.</li>
	<li>Insert the tube containing the first gradient at the top of the loading chamber and tighten the seal, taking care not to over-tighten. Then, pierce the bottom of the tube with the needle.</li>
	<li>Reset the fluid flow speed to 12.5 x 10 (controlled by the flow speed control knob on the front of the pump), then set the automated fraction collector to collect 18 sec fractions (~330 &#181;l/fraction) in microcentrifuge tubes.</li>
	<li>Start forward flow of the 60% sucrose solution.</li>
	<li>When the first drop of the gradient solution drops into the microcentrifuge tube, immediately begin both fraction collection and live recording of the A254 signal.</li>
	<li>Once a sharp drop is observed in the A254 signal, corresponding to the interface between the 50% and 60% sucrose solutions, stop both the fluid flow and A254 recording.</li>
	<li>Store the gradient fractions at -80&#160;&#176;C for later use.</li>
	<li>Reverse the fluid flow at 100 x 10 speed until the 60% sucrose solution empties out of the ultracentrifuge tube.</li>
	<li>If there are additional gradients to fractionate, remove the empty ultracentrifuge tube from the loading chamber and restart from step 6.21. If all samples are completed, wash the apparatus as was performed in steps 6.16 and 6.19.</li>
</ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HbS is one of the most common hemoglobin variants in malaria endemic areas, largely because it provides protection against severe malaria caused by P. falciparum. The techniques needed to characterize the role of human microRNA in the gene regulation of P. falciparum are detailed throughout this manuscript. By extracting total RNA in such a way as to include all small RNAs, and by performing a relatively straightforward parasite lysis procedure, these fusion RNAs were able to be identified through a var...

Malaria, caused by apicomplexan parasites of the genus Plasmodium, is the most common human parasitic disease, globally infecting approximately 200 million people each year and causing around 600,000 deaths1. Of the five Plasmodium species that infect humans, the most relevant to human disease are P. falciparum and P. vivax, due to their widespread distributions and potential for severe malaria complications. The life cycle of the malaria parasite requires infection of both mosquitoes and humans. When an infected mosquito bites a human, the parasites travel through the bloodstream to the liver, where an initial round of replication occurs. After merozoites rupture from the host hepatocyte, they infect nearby red blood cells, initiating either asexual or sexual replication. The asexual stage of replication, which lasts 48 hr in P. falciparum, is the focus of this study since it is both the source of most malaria symptoms and is easily recapitulated in vitro.
While a number of public health initiatives, including improved anti-malarial therapies, have somewhat reduced the burden of malaria globally, the continuing emergence of drug resistant parasites presents a problem for malaria control efforts. One area which may suggest new therapeutic approaches is the study on how various genetic variants confer resistance to malaria. In malaria-endemic regions, a variety of erythrocytic polymorphisms are quite common2,3. These mutations, with sickle cell being perhaps the most prominent, are often associated with substantial resistance to the onset of symptomatic malaria infection4. The underlying mechanisms by which they cause erythrocytes to resist malaria infection are incompletely understood. Parasitized erythrocytes with hemoglobin mutations are subject to enhanced phagocytosis through enhanced cellular rigidity and dehydration, which is associated with decreased invasion by P. falciparum5. The HbC allele also affects protein expression at the erythrocyte surface and with the remodeling of the cytoskeleton, further inhibiting parasite development6,7. Finally, P. falciparum grows poorly within homozygous sickle (HbSS) erythrocytes8,9 in vitro, suggesting intrinsic erythrocytic factors of malaria resistance. However, while all of these mechanisms appear to play a role, they do not fully explain the mechanisms behind sickle cell resistance to malaria.
One potential set of erythrocytic factors which remain poorly understood is the large pool of miRNA present within mature erythrocytes. MicroRNAs are small non-coding RNAs, 19-25 nt in size, which mediate translation and/or stability of target mRNAs by base pairing within the 3&#39; UTR. They have been implicated in the control of mammalian immune responses, including the suppression of virus replication10, and were shown to confer resistance to viruses in plants They have also been shown to regulate several erythrocytic processes, including erythropoiesis11,12 and iron metabolism13. Previous studies identified an abundant and diverse population of erythrocytic miRNAs, whose expression was dramatically altered in HbSS erythrocytes14,15. Since mature erythrocytes lack active transcription and translation, the functional role of these erythrocyte miRNAs remains unclear. As significant material exchange occurs between the host cell and P. falciparum during the intraerythrocytic developmental cycle (IDC)16, it was speculated that the altered miRNA profile within HbS erythrocytes may directly contribute to cell-intrinsic malaria resistance.
These studies ultimately led to the development of a pipeline to isolate, identify and functionally study the role of human miRNA within the malaria parasite, P. falciparum, which indicated that those host/human miRNAs ultimately covalently fuse and then translationally repress parasite mRNA transcripts17. This provided an example of the first cross-species chimeric transcripts formed by trans-splicing and implicates that this miRNA-mRNA fusion could be occurring in other species, including other parasites. All trypanosome mRNAs are trans-spliced with a splice-leader (SL) to regulate the separation of polycistronic transcripts18. Since P. falciparum lacks orthologs for Dicer/Ago19,20, it is possible that erythrocyte miRNAs hijack similar SL machinery in P. falciparum to integrate into target genes. Recent studies in P. falciparum have in fact indicated the presence of 5&#39; splice leader sequences21. This study details the methods that led to the discovery of human-parasite miRNA-mRNA fusion transcripts, including both transcriptomic and translational regulation techniques. The overall goals of these methods are to investigate the effects of small RNAs in the gene regulation, phenotypes and translation potential of P. falciparum transcripts.
The initial identification of human-parasite chimeric transcripts relied upon usage of RNA analysis techniques, such as real-time PCR, transcriptome sequencing and EST library capture, which included both total and small RNAs, rather than using techniques which only isolated small RNAs. Isolating all RNA together in one large pool, rather than separately, allowed the identification of both translocated human small RNAs in the parasite as well as the presence of these small RNA sequences as part of a larger sequence. This then required an analysis of the translation state of these fusion mRNAs to determine the functional consequences of these fusions.
While extensive efforts on characterization of the parasite&#39;s genome and transcriptome have added to the understanding of the parasite&#39;s biology22-25, far less is known about the translational regulation of the mRNA transcriptome across the life cycle of P. falciparum26. This limited understanding of the parasite&#39;s proteome has hindered both understanding of the parasite&#39;s biology and the ability to identify new targets for the next generation of anti-malarial therapeutics. This gap in the understanding of the parasite&#39;s cellular biology has persisted largely due to the lack of adequate techniques to investigate translational regulation in P. falciparum. One recent paper described the use of ribosomal footprinting of P. falciparum to determine the global translation status21. One well established measurement of translational potential of transcripts is the number of associated ribosomes determined by polysome profiling. However, when this technique is applied to P. falciparum, it is unable to recover most polysomes and captures predominantly monosomes. Recently, several groups27,28 have optimized P. falciparum polysome techniques by lysing the erythrocyte and parasite simultaneously to preserve the polysomes and characterize the ribosomal occupancy and translational potential of these malaria parasites during their asexual development in host red cells28.
Collectively, these methods demonstrate that the observed fusion of human miRNA and parasite mRNAs modulates parasite protein translation of those fusion mRNAs, which was demonstrated using previously reported methods27, and is a major determinant of malaria resistance in HbAS and HbSS erythrocytes17. These methods would be useful in any system looking to identify and functionally explore RNA splicing events, whether those fusion RNAs are within P. falciparum or other eukaryotic systems.

<table><tbody><tr><td>&lt;strong&gt;REAGENTS-All reagents must be RNAse-free.&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Diethyl pyrocarbonate</td><td>Sigma</td><td>D5758</td><td>DEPC</td></tr><tr><td>DEPC-treated water (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Yoyo-1 DNA fluorescent dye</td><td>Thermo Fisher</td><td></td><td></td></tr><tr><td>Gene Pulser II electroporator</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>0.2 cm Electroporation cuvettes</td><td></td><td></td><td></td></tr><tr><td>4 M potassium acetate</td><td>Mallinckrodt</td><td>6700</td><td></td></tr><tr><td>2 M potassium HEPES</td><td>Sigma</td><td>H0527</td><td>pH 7.2</td></tr><tr><td>1 M magnesium acetate</td><td>Sigma</td><td>M-2545</td><td></td></tr><tr><td>1 M dithiothreitol</td><td>Research Products International</td><td>D11000</td><td>DTT</td></tr><tr><td>100 mM phenylmethylsulfonate fluoride</td><td>Sigma</td><td>P7626</td><td>PMSF, dissolved in isopropanol</td></tr><tr><td>10% (v/v) Igepal CA-630</td><td>Sigma-Aldrich</td><td>I3021</td><td></td></tr><tr><td>10% (w/v) sodium deoxycholate</td><td>Sigma</td><td>D-6750</td><td>DOC</td></tr><tr><td>Cycloheximide</td><td>Sigma</td><td>C-7698</td><td>CHX</td></tr><tr><td>Sucrose</td><td>Mallinckrodt</td><td>8360-04</td><td></td></tr><tr><td>RNAseOUT (Invitrogen, cat. no. 100000840)</td><td>Invitrogen</td><td>100000840</td><td></td></tr><tr><td>RPMI-1640 w/ L-glutamine</td><td>Cellgro</td><td>10-040-CV</td><td></td></tr><tr><td>10% AlbuMAX I</td><td>Invitrogen</td><td>11020-039</td><td>w/v in sterile water</td></tr><tr><td>Gentamicin</td><td>Gibco</td><td>15750-060</td><td></td></tr><tr><td>HT supplement (100x) (Invitrogen, cat. no. 11067030)</td><td></td><td></td><td></td></tr><tr><td>45% (w/v) sucrose (Sigma, cat no. G8769)</td><td></td><td></td><td></td></tr><tr><td>1 M HEPES buffer (Gibco, cat. no. 15630-080)</td><td></td><td></td><td></td></tr><tr><td>1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td><td></td><td></td><td></td></tr><tr><td>Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td><td></td><td></td><td></td></tr><tr><td>Glass slides (VWR, cat. no. 48311-702)</td><td></td><td></td><td></td></tr><tr><td>Giemsa stain (50X) (VWR, cat no. m708-01)</td><td></td><td></td><td></td></tr><tr><td>mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td><td></td><td></td><td></td></tr><tr><td>5&#039; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td><td></td><td></td><td></td></tr><tr><td>Biotin powder (Sigma-Aldrich)</td><td></td><td></td><td></td></tr><tr><td>1 M Potassium Chloride</td><td></td><td></td><td></td></tr><tr><td>Streptavidin Sepharose High Performance Beads (GE Healthcare)</td><td></td><td></td><td></td></tr><tr><td>Ribosome resuspension buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Lysis buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>0.5 M sucrose cushion (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>60% (w/v) sucrose chase solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Plasmodium cell culture media (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>RNA capture Wash Buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>RNA Elution Buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;REAGENT SETUP&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmodium cell culture media&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>500 ml RPMI-1640 w/ L-glutamine</td><td></td><td></td><td></td></tr><tr><td>0.5 ml gentamicin</td><td></td><td></td><td></td></tr><tr><td>5 ml HT supplement</td><td></td><td></td><td></td></tr><tr><td>2.5 ml 45% glucose</td><td></td><td></td><td></td></tr><tr><td>25 ml 10% AlbuMAX I</td><td></td><td></td><td></td></tr><tr><td>12.5 ml 1 M HEPES</td><td></td><td></td><td></td></tr><tr><td>Sterile filter with 0.2 mm vacuum filter flask.</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmodium cell culture media containing 10x CHX&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as Plasmodium cell culture media above, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>2 mM cycloheximide</td><td></td><td></td><td></td></tr><tr><td>Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;1x PBS containing cycloheximide&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 &lt;sup&gt;O&lt;/sup&gt;C until use.</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Ribosome resuspension buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>400 mM potassium acetate</td><td></td><td></td><td></td></tr><tr><td>25 mM potassium HEPES, pH 7.2</td><td></td><td></td><td></td></tr><tr><td>15 mM magnesium acetate</td><td></td><td></td><td></td></tr><tr><td>200 mM cycloheximide (add fresh)</td><td></td><td></td><td></td></tr><tr><td>1 mM DTT (add fresh)</td><td></td><td></td><td></td></tr><tr><td>1 mM PMSF (add fresh)</td><td></td><td></td><td></td></tr><tr><td>40 U/ml RNaseOUT (add fresh)</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Lysis buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as ribosome resuspension buffer above, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>1% (v/v) Igepal CA-630</td><td></td><td></td><td></td></tr><tr><td>0.5% (w/v) DOC</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Sucrose solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td><td></td><td></td><td></td></tr><tr><td>15% (w/v) sucrose to make 15% sucrose gradient solution</td><td></td><td></td><td></td></tr><tr><td>50% (w/v) sucrose to make 50% sucrose gradient solution</td><td></td><td></td><td></td></tr><tr><td>0.5 M sucrose to make 0.5 M sucrose cushion</td><td></td><td></td><td></td></tr><tr><td>As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td><td></td><td></td><td></td></tr><tr><td>The 60% sucrose chase solution requires only sucrose and water, no other components</td><td></td><td></td><td></td></tr><tr><td>60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;RNA Capture Wash Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>20 mM&amp;nbsp; KCl</td><td></td><td></td><td></td></tr><tr><td>5 unit/ml Rnase Out (Invitrogen)</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;RNA Capture Elution Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as RNA Capture Wash Buffer, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>2 mM Biotin</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;EQUIPMENT&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td><td></td><td></td><td></td></tr><tr><td>SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td><td></td><td></td><td></td></tr><tr><td>Ultra-Clear&lt;sup&gt;TM&lt;/sup&gt; &amp;frac12; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td><td></td><td></td><td></td></tr><tr><td>Polyallomer 9/16 x 3 &amp;frac12; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td><td></td><td></td><td></td></tr><tr><td>L8-80M ultracentrifuge (Beckman)</td><td></td><td></td><td></td></tr><tr><td>Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)</td><td></td><td></td><td></td></tr><tr><td>1 ml syringe with 27 G&amp;frac12; needle (Becton Dickinson, cat no. 309623)</td><td></td><td></td><td></td></tr><tr><td>5 ml syringe (Becton Dickinson, cat. no. 309646)</td><td></td><td></td><td></td></tr><tr><td>Parafilm</td><td></td><td></td><td></td></tr><tr><td>Tube rotator, end-over-end</td><td></td><td></td><td></td></tr><tr><td>Microcentrifuge, refrigerated</td><td></td><td></td><td></td></tr><tr><td>Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td><td></td><td></td><td></td></tr><tr><td>TracerDAQ (Measurement Computing)</td><td></td><td></td><td></td></tr><tr><td>Eppendorf 5810R centrifuge</td><td></td><td></td><td></td></tr><tr><td>Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td><td></td><td></td><td></td></tr></tbody></table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The molecular basis of this resistance, which is known to be multifactorial, remains incompletely understood. Recent studies found that the differential expression of erythrocyte microRNAs, once translocated into malaria parasites, affect both gene regulation and parasite growth. These miRNAs were later shown to inhibit mRNA translation by forming a chimeric RNA transcript via 5&#39; RNA fusion with discreet subsets of parasite mRNAs. Here, the techniques that were used to study the functional role and putative mechanism underlying erythrocyte microRNAs on the gene regulation and translational potential of P. falciparum, including the transfection of modified synthetic microRNAs into host erythrocytes, will be detailed.&#160; Finally, a polysome gradient method is used to determine the extent of translation of these transcripts. Together, these techniques allowed us to demonstrate that the dysregulated levels of erythrocyte microRNAs contribute to cell-intrinsic malaria resistance of sickle erythrocytes.

Global profiling of human microRNA in P. falciparum
The techniques presented here were used to extract microRNAs from parasites in a variety of conditions. One thing to note is that RNA extractions for uninfected RBCs were performed as indicated in32, which often served as a reference point for the microRNA data presented in both this article and the original study29. Those previous studies also demonstrated that HbSS erythrocytes possessed far greater levels of ...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

8.8K Views.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Video: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

Genetics

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biochemistry

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For a long time, the gene expression studies were dominated by research on the transcriptional level. However, the steady-state levels of mRNAs do not correlate well with protein production, and the translatability of mRNAs varies greatly depending on the conditions. In some organisms, like the parasite Leishmania, the protein expression is regulated mostly at the translational level. Recent studies demonstrated that protein translation dysregulation is associated with cancer, metabolic, neurodegenerative and other human diseases. Polysome profiling is a powerful method to study protein translation regulation. It allows to measure the translational status of individual mRNAs or examine translation on a genome-wide scale. The basis of this technique is the separation of polysomes, ribosomes, their subunits and free mRNAs during centrifugation of a cytoplasmic lysate through a sucrose gradient. Here, we present a universal polysome profiling protocol used on three different models - parasite Leishmania major, cultured human cells and animal tissues. Leishmania cells freely grow in suspension and cultured human cells grow in adherent monolayer, while mouse testis represents an animal tissue sample. Thus, the technique is adapted to all of these sources. The protocol for the analysis of polysomal fractions includes detection of individual mRNA levels by RT-qPCR, proteins by Western blot and analysis of ribosomal RNAs by electrophoresis. The method can be further extended by examination of mRNAs association with the ribosome on a transcriptome level by deep RNA-seq and analysis of ribosome-associated proteins by mass spectroscopy of the fractions. The method can be easily adjusted to other biological models.

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

The overall goal of polysome profiling technique is analysis of translational activity of individual mRNAs or transcriptome mRNAs during protein synthesis. The method is important for studies of protein synthesis regulation, translation activation and repression in health and multiple human diseases.

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

An Assay for Quantifying Protein-RNA Binding in Bacteria

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding of an RNA binding protein (RBP) to the initiation region of the mRNA, which interferes with ribosome binding. In the presented method, we utilize this blocking phenomenon to quantify the binding affinity of RBPs to their cognate and non-cognate binding sites. To do this, we insert a test binding site in the initiation region of a reporter mRNA and induce the expression of the test RBP. In the case of RBP-RNA binding, we observed a sigmoidal repression of the reporter expression as a function of RBP concentration. In the case of no-affinity or very low affinity between binding site and RBP, no significant repression was observed. The method is carried out in live bacterial cells, and does not require expensive or sophisticated machinery. It is useful for quantifying and comparing between the binding affinities of different RBPs that are functional in bacteria to a set of designed binding sites. This method may be inappropriate for binding sites with high structural complexity. This is due to the possibility of repression of ribosomal initiation by complex mRNA structure in the absence of RBP, which would result in lower basal reporter gene expression, and thus less-observable reporter repression upon RBP binding.

In this method, we quantify the binding affinity of RNA binding proteins (RBPs) to cognate and non-cognate binding sites using a simple, live, reporter assay in bacterial cells. The assay is based on repression of a reporter gene.

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding ...

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes.
The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1.
Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types.

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization FISH

Fluorescent in situ hybridization (FISH) to identify mRNA transcripts in individual cells allows analysis of polygenic activity such as the simultaneous transcription of more than one member of the var multigene family in Plasmodium falciparum infected erythrocytes 1. The technique is adaptable and can be used on different types of genes, cells and organisms.

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 ...

Biology

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

Malaria remains one of the most devastating diseases worldwide and, to date, the African region is still responsible for 94% of all cases worldwide. This parasitic disease requires a protozoan parasite, an Anopheles mosquito vector, and a vertebrate host. The Anopheles genus comprises more than 500 species, of which 60 are known as vectors of the parasite. The Plasmodium parasite genus consists of 250 species, and 48 of these are involved in disease transmission. Furthermore, the Plasmodium falciparum parasite has contributed toward an estimated 99.7% of malaria cases in sub-Saharan Africa in recent years. 
Gametocytes form part of the sexual stage of the parasite and are ingested by the female mosquito upon feeding on an infected human host. Further development of the parasite within the mosquito is enhanced by favorable environmental conditions in the midgut of the mosquito. Here, the fusion of the female and male gametes takes place, and the motile ookinetes originate. The ookinetes enter the midgut epithelium of the mosquito, and mature ookinetes form oocysts, which, in turn, produce motile sporozoites. These sporozoites migrate to the mosquito's salivary glands and are injected as a mosquito takes a blood meal. 
For drug discovery purposes, mosquitoes were artificially infected with gametocyte-infected blood in the standard membrane feeding assay (SMFA). To detect infection within the mosquito and/or to assess the efficacy of antimalarial compounds, the midguts of the female mosquitoes were removed post infection and were stained with mercurochrome. This method was used to enhance the visual detection of oocysts under the microscope for the accurate determination of oocyst prevalence and intensity.

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

The standard membrane feeding assay (SMFA) is regarded as the gold standard for the assessment and identification of potential antimalarial compounds. This artificial feeding system is used to infect mosquitoes to further evaluate the effects of such compounds on the intensity and prevalence of the Plasmodium falciparum parasite.

Malaria remains one of the most devastating diseases worldwide and, to date, the African region is still responsible for 94% of all cases worldwide. This ...

Polysome Fractionation and Analysis of Mammalian Translatomes on a Genome-wide Scale

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. Accordingly, dysregulation of mRNA translation is considered to play a major role in a variety of pathological states including cancer. Ribosomes also host chaperones, which facilitate folding of nascent polypeptides, thereby modulating function and stability of newly synthesized polypeptides. In addition, emerging data indicate that ribosomes serve as a platform for a repertoire of signaling molecules, which are implicated in a variety of post-translational modifications of newly synthesized polypeptides as they emerge from the ribosome, and/or components of translational machinery. Herein, a well-established method of ribosome fractionation using sucrose density gradient centrifugation is described. In conjunction with the in-house developed &#8220;anota&#8221; algorithm this method allows direct determination of differential translation of individual mRNAs on a genome-wide scale. Moreover, this versatile protocol can be used for a variety of biochemical studies aiming to dissect the function of ribosome-associated protein complexes, including those that play a central role in folding and degradation of newly synthesized polypeptides.

Ribosomes play a central role in protein synthesis. Polyribosome (polysome) fractionation by sucrose density gradient centrifugation allows direct determination of translation efficiencies of individual mRNAs on a genome-wide scale. In addition, this method can be used for biochemical analysis of ribosome- and polysome-associated factors such as chaperones and signaling molecules.

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. ...

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown to allow to selective translation of specific mRNAs, which typically encode for proteins required for a particular stress response. Identification of these mRNAs, as well as the characterization of regulatory mechanisms responsible for selective translation has been at the forefront of molecular biology for some time. Polysome profiling is a cornerstone method in these studies. The goal of polysome profiling is to capture mRNA translation by immobilizing actively translating ribosomes on different transcripts and separate the resulting polyribosomes by ultracentrifugation on a sucrose gradient, thus allowing for a distinction between highly translated transcripts and poorly translated ones. These can then be further characterized by traditional biochemical and molecular biology methods. Importantly, combining polysome profiling with high throughput genomic approaches allows for a large scale analysis of translational regulation.

The ability of cells to adapt to stress is crucial for their survival. Regulation of mRNA translation is one such adaptation strategy, providing for rapid regulation of the proteome. Here, we provide a standardized polysome profiling protocol to identify specific mRNAs that are selectively translated under stress conditions.

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown ...

An Easy Method for Plant Polysome Profiling

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues. A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After centrifugation, six fractions are directly collected from the bottom to the top of the gradient, without piercing the ultracentrifugation tube. During collection, the absorbance at 260 nm is read continuously to generate a polysome profile that gives a snapshot of global translational activity. Fractions are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis thaliana seedlings and adult plants, Nicotiana benthamiana, Solanum lycopersicum, and Oryza sativa leaves.

This protocol describes an easy method to extract and fractionate transcripts from plant tissues on the basis of the number of bound ribosomes. It allows a global estimate of translation activity and the determination of the translational status of specific mRNAs.

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the ...

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

Quantitative Immunofluorescence to Measure Global Localized Translation

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

An Assay for Quantifying Protein-RNA Binding in Bacteria

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

Polysome Fractionation and Analysis of Mammalian Translatomes on a Genome-wide Scale

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

An Easy Method for Plant Polysome Profiling