Name: methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum
Uploaded: 2015-12-04T14:00:00.000+00:00
Duration: 10 min 22 s
Description: Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: P. Küçük ebatlı RNA İzolasyonu IDC Sırasında Falciparum <ol><li> Eşeysiz kültüründe 29 sıtma parazitleri edinin. NOT: Gerekli kültür boyutu istenen başvuru üzerine göre değişir; Bununla birlikte,% 3-5 parazitemi ve% 5 hematokrit bir 10 ml kültür, gerçek zamanlı PCR (RT-PCR) için yeterli RNA içerir. Tekniği başlangıçta asenkron kültürler için optimize edilmiş, ancak enfeksiyon döngüsü sırasında belirli bir zaman noktaları arzu edildiğinde, halka sahne parazitler geç 10-12 saat işgal sonrası daha sorbitol senkronizasyonu ile senkronize edilebilir. Senkronizasyon bir devir (yaklaşık 48 saat) 29 sonra tekrar edilmelidir. </li><li> Havuz enfekte hücreler bir araya (~ 5 x 10 9 eritrositler% 3-5 parasitemia at) ve kırmızı pelet hücreleri frensiz 5 dakika boyunca 800 xg&#39;de tüp ve santrifüj üstüne soğuk PBS doldurun. </li><li> Santrifüj işleminden sonra, ekli, dikkatli bir aspirasyon pipet kullanarak süpernatant kaldırmakbir vakuma, eritrosit pelet yana çıkarmak kolaydır. Soğuk 1x PBS ile bir kez daha topak yıkayın. </li><li> 30 dakika boyunca buz üzerinde tekrar süspansiyon hücre (1x PBS içinde) soğuk% 0.15 saponin içinde pelet ve yer. </li><li> 4 ° C&#39;de 12 dakika süreyle 1500 xg&#39;de Santrifüj hücreleri, soğuk PBS süpernatant (renkli koyu kırmızı olacak) ve tekrar süspansiyon pelet çıkarın. Bir kez daha bu adımı yineleyin. NOT: Bu mikroRNAlar parazit olan mikroRNA yansıtıcı olup eritrosit kirlenme olmasını sağlamak için, parazit, tecrit koşulları bir takım test edilmiştir: 1) bir saponin liziz, 2) bir saponin liziz RnazA konakçı hücre miRNA&#39;ların tedavisi ve 3 ile birlikte ) Metil-beta-siklodekstrin tedavi konak eritrositlerinden parazit kaldırmak için. Tüm tedaviler benzer sonuçlar verdi. </li><li> Lyse lizis tamponu tavsiye 600 ul kullanarak izole parazit pelet. Liziz tamponu Bu birim ~% 2 hematokrit ile% 5 parazitemi 30 mi kadar kültürler için yeterlidir. NOT: Daha büyük parazit kültürleri için, bu hacim artırılabilir. En az 1 dakika boyunca tam bir vorteks ile parazit pelet tamamen parçalama sağlamak için önemlidir. Ayrıca, ekstre kolaylığı için, lize numuneleri 1,7 ml mikrosantrifüj tüpüne transfer edilebilir. </li><li> Homojenat, ilave madde (2 M sodyum asetat, pH 4) arasında, 60 ul ya da aşama 6&#39;da kullanılan parçalama tamponu 1/10 hacim. </li><li> 10 dakika boyunca buz üzerinde örneklerin bırakın. </li><li> 600 ul veya her biri 1 dakika numune ve vorteks asit fenol choloroform arasında, Aşama 6&#39;da ilave lizis tamponu miktarına eşit bir hacim. </li><li> 5 dakika boyunca 10.000 x g&#39;de santrifüjleme ile örnekleri, sulu ve organik fazlar ayırın. Bu durum döner tüm hemoglobin / hemozoin organik fazda olmasını sağlamak için daha uzun kit önerdiği daha uzundur. </li><li> Üst (sulu) tabakayı toplayın ve yeni bir tüp aktarın. Sulu faz yanlısı anlaşılacağı renk (daha büyük olasılıkla) kahverengi, beyaz ya da tekrarlayın 9 ve 10 numaralı adımlarıtein kirlenme. </li><li> Pipetle elde edilen üstte kalan sıvı kısmın hacmi tayin edilir ve daha sonra% 100 etanol (~ 800 | il), 1.25 birimleri eklemek 1,7 ml mikrosantrifüj tüpü 5 kez ters yüz edilerek karıştırılır. </li><li> 1 dakika süre ile ya da vakum manifoldu kullanılarak 14.000 x g&#39;de santrifüjleme ile, ya bir mesafede RNA bağlayıcı filtre kartuşundan her bir örnek (ticari olarak temin edilebilir çeşitli olan) geçirin. </li><li> MiRNA 700 ul tampon 1 1 dakika için 14,000 xg&#39;de iplik, bir mıkro kullanarak yıkama ile filtre kartuşunu yıkayın. </li><li> Iki kez 1 dakika her biri için 14.000 x g&#39;de santrifüjleme ile 500 ul yıkama tamponu ile filtre kartuşunu 2/3 yıkayın. </li><li> 1 dakika her biri için 14.000 x g santrifüj, 50 ul iki yıkamalarda, 95 ° C &#39;ısıtılmış olan 100 ul DEPC su ile Elute RNA. 260 nm&#39;de UV absorbansı ile RNA konsantrasyonu ölçümü. NOT: RNA jel (TBE üre-akrilamid veya denatüre edici formaldehit agaroz jel olarak) olabilir be izole RNA&#39;ların büyüklük dağılımını değerlendirmek için kullanılan. NOT: Bu RNA mikrodizinin RNA-dizisi, Northern blot ve ribonükleaz koruma deneyi ile analiz için uygundur. </li></ol> 2: P. Küçük ebatlı RNA&#39;ların kantitasyonu IDC Sırasında Falciparum <ol><li> 260 nm&#39;de UV spektrofotometrisi kullanılarak adım 1 &#39;de izole edilmiş tek tek örneklerinin konsantrasyonunu belirler. </li><li> İstenilen RNA türleri için real-time PCR primerleri oluşturun. MRNAların ya da füzyon miRNA mRNA biz SYBR yeşil için primerler dizayn ederken miRNA için yalnız biz, önceden hazırlanmış miRNA qPCR deneyleri kullanılır. Ters mRNA dizisi (: ATCGAACATGCTGTGAACAT PKA-R) &#39;de miRNA&#39;nın alt bir gen spesifik primer ~ 100 bp iken: Füzyon RNA&#39;lar için, ileri primer MiRNA dizisi, (AAACCGTTACCATTACTGAGTT miR-451) idi. </li><li> Kullanarak, RNA numuneleri, ya mRNA ve / veya miRNA için miRNA&#39;ların (RNA 20-40 ng kullanımı), tek başına veya rastgele heksamerler bir firkete primeri cDNA sağlayın-mRNA füzyon türleri (RNA&#39;nın 1 | ig kullanılarak). Oda sıcaklığına kadar daha sonra soğuk, 65 ° C &#39;de 5 dakika süre ile, RNA ve primerler karıştırın. Daha sonra, ters transkriptaz karışımı ekleyin (0.5 ul ters transkriptaz, 0.5 ul RNaz inhibitörü, 1 ul dNTP (her biri 2.5 mM), 4 ul 5x tamponu, 2 ul 0.1 M DTT, 1 ul H2O). <ol><li> SYBR yeşil veya TaqMan probu ya saptayabilen bir termo Run örnekler. Spesifik genlerin PCR 30 kantitatif yeşil SYBR using, 40 çevrim için, bir 3-aşama PCR, 15 sn için 95 ° C, en primer tavlama sıcaklığı eksi 30 saniye için 5 ° C olarak çalışır, ve 30 saniye süreyle 68 ° C olan Ticari SYBR yeşil master miks. MiRNA gerçek zamanlı PCR, 40 çevrim için, 1 dakika süre ile, iki aşamalı bir PCR gibi 15 sn için 95 ° C ve 60 ° C çalıştırıldı. </li><li> ΔΔCt yöntemiyle tahlilleri sayısal olarak ve her iki Rab GTPaz (PF08_0110) ya da 18S rRNA 31 karşı normalize. </li></ol></li></ol> 3: GirişSıtma Parazitler içine Küçük RNA&#39;lar <ol><li> Transfeksiyon başına kırmızı kan hücrelerinin 300 ul Pelet freni 1, 5 dakika boyunca 800 x g&#39;de santrifüj ile tam bir sıtma medya (eritrosit 250 ul, yaklaşık 1.5 x 10 9 hücreleri, sonuçta kullanılacağı). </li><li> RPMI ve tam cytomix (120 mM KCI içinde tekrar süspansiyon ile iki kez yıkanır, eritrositleri, 0,15 mM CaCl2, 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7.6; 25 mM HEPES, pH 7.6, 2 mM EGTA, pH 7.6; 5 mM MgCl2; fren 1, 5 dakika boyunca 800 x g&#39;de santrifüje tabi tutulmasımn ardından% 50 hematokrit) KOH ile ayarlandı. </li><li> 0.2 cm elektroporasyon küvetine hücreleri aktarın. </li><li> Küvetler özel sentetik oligonükleotidlerin, 10 ug veya uygun miktarda ekleyin ve kültürleri tekrar süspansiyon. </li><li> 310 V / 950 iF için elektro-ayarlayın ve her küvete bir darbe teslim. </li><li> Önceden ısıtılmış tam mal olarak küvetin içinde eritrosit 300 ul yeniden süspansearia araçları ve 24 yuvalı plakalar içinde onları plaka ve sıtma kan gazı karışımı ile hava geçirmez bir kapta 37 ° C&#39;de inkübe (% 3 O 2,% 5 CO2). </li><li> 4 saat sonra,% 1 yaklaşık son parazitemi senkronize geç trofozoitleri ile transfekte eritrositlerde bulaştırmak. </li><li> Enfekte kültürlere, her 4-6 gün taze olarak transfekte eritrositlerde ekleyin ve bölüm 4 de belirtildiği gibi, YOYO-1 lekelemesi kullanılarak FACS ile% paraziteminin belirler. </li></ol> 4: Parazit Enfeksiyon Oranı üzerine Eritrosit mikroRNAlar Etkisinin Belirlenmesi <ol><li> 1.7 ml mikrosantrifüj tüpü içinde mikropipetöre sabit ve yerine göre yeniden süspanse kültürü 100 ul al. 5 dakika boyunca 800 x g&#39;de santrifüj ile bir masa üstü mikrosantrifüj 1 1x PBS ilave edildi ve santrifüj ile iki kez yıkanır. </li><li> % 0.025 glutaraldehit 1 ml süspanse pelet. Oda sıcaklığında 20 dakika boyunca inkübe edin. Not: örnekler 4 ° C&#39;de birkaç hafta muhafaza edilebilir. Daha sonra, enfekte R pelet5 dakika boyunca 800 x g&#39;de santrifüj ile BC ler. 1x 1 ml PBS ile iki kez yıkanır. </li><li> % 0.015 saponin 1 ml süspanse pelet. 15 dakika boyunca 4 ° C&#39;de inkübe edilir. Pelet 5 dakika boyunca 800 x g&#39;de santrifüj ile RBC bulaştırılır. 1x 1 ml PBS ile iki kez yıkanır. Repeat.4.3. 1x PBS 1 ul (1,000X), DNA leke ihtiva eden 1 ml içinde süspanse hücreleri. </li><li> 488 nM eksitasyon, bir akış sitometresi üzerinde parazitemi derece belirlemek ~ 530 nM (FL-1) emisyonu. </li><li> İlk olarak, kapı FSC ve SSC dayalı sitometresi akış eritrosit odaklanmak. Sonra FL-1 kanal floresan kapı RBC parazitemya derecelerde (enfekte eritrositler) ölçün. NOT: Daha sonra sahne parazitler erken evre parazitler daha 10X daha floresan, ve bulaşmamış eritrosit yukarıda ~ 100X. Aynı zamanda, düşük hızda toplama gürültü azaltma eğilimi gösterir. Son olarak, bu yaklaşım 3H-Hipoksantin Kuruluş ve Giemsa boyama, daha önce 13 rapor hem de ve tüm teknikler gav kıyasla olmuşturbenzer sonuçlar e. </li></ol> 5: miRNA-mRNA Fusion Ürünlerinin Biotin-etiketleme ve Elution <ol><li> Doğrudan kovalent 5 &#39;ucuna operatif şekilde bağlanmış destiyobiyotin ile özel sentetik RNA oligonükleotidleri (DB) sipariş. </li><li> Aşama 3&#39;te gösterildiği gibi, destiobiyotin-konjüge edilmiş (DB) miRNA&#39;nın ve modifiye edilmemiş miRNA (negatif kontrol) ile birlikte enfekte olmamış eritrositlerde transfekte. </li><li> P. ile transfekte eritrositlerde Infect falsiparum% 0.5 (adım 1.1) bir başlangıç ​​parazitemya için parazitleri. </li><li> Aşama 1 &#39;de yukarıda tarif edildiği gibi parazit RNA daha sonra 4 gün (96 saat) ekstrakte edin. </li><li> Streptavidin boncuk dolu 50 ul parazit RNA 10 ug inkübe, mikropipet vasıtasıyla ilave edilmiş ve 4 ° C &#39;de 1 saat süre ile, bir mikrosantrifüj tüpü rotator döndürün. </li><li> 30 saniye için 800 x g&#39;de boncuk Pelet ve 20 mM KCI, 1/1000 RNaz inhibitörü ile yıkayın. </li><li> 2 mM biyotin ve 200 ul RNA yakalama elüsyon tamponu (20 mM KCI, 1/1 ile karşılaştırma yoluyla boncuklar Elute RNA&#39;lar4 ° C&#39;de, 000 RNaz inhibitör ve 2 mM biyotin) ° C sıcaklıkta gece boyunca rotasyon ile. </li><li> Belirtilen P. zenginleştirme derecesini belirlemek Adım 2&#39;de gösterildiği gibi, SYBR yeşil QRT-PCR ve TaqMan qPCR mikroRNA zenginleştirme (pozitif kontrol) ile falciparum transkript. </li></ol> 6: P. Ribosomal Kişiler belirleme Polizom Ayırma Falciparum <ol><li> 5 ml% 15 sukroz çözeltisi (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase inhibitör ve% 15 sükroz yerleştirin ) Bir SW41 bir ultra santrifüj tüpüne (14 x 89 mm) içine. </li><li> 5 ml&#39;lik bir şırınga kullanarak, 5 ml% 50 sukroz çözeltisi (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase ekleme Önleyici ve uzun çelik iğne kullanılarak% 15 sukroz altında% 50 sukroz), sonra iğneyi çıkarın. </li><li&gt; Parafilm ile gradyan tüpün üst Seal haddeleme önlemek için sabit pozisyonda, onun yüzüne yavaşça tüp eğin, böylece masa üzerine yatay olarak yalan söylüyor. En az 2 saat boyunca yan tüp tutun. Beklerken, adım 6.5 ile başlar. </li><li> 2 saat sonra, yavaş yavaş, dik boru eğme ve önceden örnek yükleme en az 15 dakika (aşama 14) için soğumasına izin buz tüp aktarın. </li><li> 100-500 toplam RNA ug veya% 3-5 parazitemi kabaca 100 ml&#39;lik asenkron kültürünü oluşturmak için yeterli Plasmodium enfekte olan kan sahne kültürü toplayın. 10x (2 mM) sikloheksimid (CHX) ihtiva eden kültür ortamına bu hacim inci 1/10 ilave edin ve 10 dakika boyunca 37 ° C&#39;de inkübe edin. <ol><li> Santrifüj Pelet kültürler santrifüj ile 7 dakika (fren 1) için 500 xg&#39;de sonra PBS 200 uM CHX içeren 1x oda sıcaklığı ile iki kez yıkayın. 200 uM CHX içeren 1x PBS içinde parazit kültürleri yeniden süspanse ve buz üzerinde saklayın. </li></ol></li&gt; <li> RBC pelet hacmi tahmin edin. Liziz tamponu (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM CHX, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase inhibitör,% 1 (h / h) IGEPAL CA ekleme -630, ve% 0.5 4.25 ml nihai hacme kadar RBC pelet DOC) (w / v). 4 ° C&#39;de inkübe lizat Dönerken 10 dakika süreyle ° C. </li><li> Mikrosantrifüj tüplerine lizat transferi ve daha sonra 16,000 x g&#39;de 4 ° C&#39;de ve bir mikrosantrfuj örnekleri santrifüj 10 dakika boyunca ° C. </li><li> 0.5 M, soğuk sükroz tampon çözeltisi (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase ve 1.25 mi pipetleme sükroz yastıkları hazırlayın Bir SW55 bir ultra santrifüj tüpüne (13 x 51 mm) içine inhibitör ve 0.5 M sükroz). </li><li> Dikkatle bir şırınga ve küçük (~ 27) iğne kullanılarak sakaroz yastık üstünde (aşama 7&#39;den) lizat süpernatant 3.75 ml katman. StorBölüm 1 &#39;de gösterildiği gibi, e -80 ° C de geri kalan lisat (~ 500 | il), toplam RNA düzeyini elde etmek için. </li><li> 4 önceden soğutulmuş bir ultrasantrifüjdeki rotora içine örnekleri yükleyin 13.2 ml tüpler tutabilir ° C. 366,000 x g&#39;de örnekleri santrifüj ve 146 dakika boyunca 4 ° C. </li><li> Bir pipet kullanarak, bir 15 mL konik tüp içine süpernatant aktarın. Serbest (ribozomlar tarafından bağlı olmayan) RNA&#39;lar RNA izolasyonu için -80 ° C&#39;de süpernatan saklayın. </li><li> Ribozom yeniden süspansiyon tamponu (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, ve 40 U / ml RNase İnhibitörü) 500 ul ribozom pelletini 5 dakika boyunca pipetleme. </li><li> 16.000 x g&#39;de, 4 ° C&#39;de bir mikrosantrfuj örnekleri santrifüj &#160; 10 dakika boyunca ° C. </li><li> Buz üzerinde adım # 4 den degrade tutarken, sonra dikkatlice degrade usi üstünde ribozom süspansiyon tabaka, Parafilm kaldırmakng bir şırınga ve küçük (~ 27) iğne. </li><li> Önceden soğutulmuş bir ultra santrifüj tüpü rotor içine yükleyin ve 200,000 x g ve 180 dakika boyunca 4 ° C &#39;de yüklü gradyanlar santrifüj. Spin tamamlandığında, mağaza 4&#39;te degradeler santrifüj Hazır olana kadar ° C kincinin üzerine yüklemek için. </li><li> Gradyan kısımlara içine boş bir ultra santrifüj tüpüne (bu, önceki bir çalışmada kullanılan tüp olabilir) takın ve 100 x 10 hızda 5 dakika boyunca düzgün miktarlan RNAse bulunmayan su ile yıkayınız. </li><li> Adımda 6.16 yıkama sırasında, UV absorbans dedektörün hassasiyetini ayarlamak. İyi bir başlangıç ​​hassasiyeti 0,2, ancak bu, daha sonra (parazit sayısı, vs göre değişir olan) bir 254 sinyaline göre çalışır ayarlanabilir gerekebilir. </li><li> Dedektör hassasiyeti ayarlandıktan sonra su detektörü akan iken, sıfıra taban sinyalini ayarlayın. </li><li> Çizgiler daha sonra rem boş ve kadar fraksiyon toplayıcı yıkadıktan sonra, sıvı akışını tersineBoş ultrasantrifüjdeki tüpü ove. </li><li> Iğne aparatı çıkıncaya kadar kincinin ile% 60 sukroz solüsyonu çalıştırın. </li><li> Sıkın üzerinde dikkat çekici, yükleme odasının üstündeki ilk degrade içeren tüp takın ve mühür sıkın. Daha sonra, iğne ile, tüpün alt kısmını delmek. </li><li> (Pompanın önündeki akış hızı kontrol düğmesi ile kontrol) 12.5 x 10 sıvı akış hızı Reset sonra 18 sn kesirler toplamak için otomatik fraksiyon toplayıcı ayarlamak (~ 330 ul / fraksiyon) mikrosantrifüj tüplerinde. </li><li> Ileri% 60 sukroz çözeltisi akışını başlatın. </li><li> Degrade çözümünün ilk açılan mikrosantrifüj tüp içine düştüğünde, hemen fraksiyon toplama ve A 254 sinyalin canlı kayıt, hem başlar. </li><li> Keskin bir düşüş% 50 ve% 60 sükroz çözeltiler arasındaki ara yüze karşılık gelen bir 254 sinyalinde bir gözlenmiştir, sıvı akışı ve bir 254 durdurulmasına </sub&gt; kaydı. </li><li> Gradyan kesirler de saklayın -80 &#160; Daha sonra kullanmak üzere ° C. </li><li> % 60 sakaroz çözeltisini ultrasantrifüjdeki tüp dışarı boşaltır kadar 100 x 10 hızında sıvı akışını tersine. </li><li> Damıtmak için ek degrade varsa, yükleme odasından boş ultrasantrifüjdeki tüp kaldırmak ve adım 6.21 den yeniden başlatın. Tüm numuneler tamamlandığında ise adımlarla 6.16 ve 6.19 gerçekleştirildi gibi aparat yıkayın. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HbS o P. neden olduğu şiddetli sıtmaya karşı koruma sağlar, çünkü büyük ölçüde, sıtmanın endemik bölgelerde en yaygın hemoglobin varyantları biridir Falciparum. Teknikleri P. gen regülasyonu insan microRNA rolünü karakterize etmek gerekli Falciparum Bu yazının boyunca ayrıntılı olarak verilmektedir. Tüm küçük RNA&#39;ların içerecek şekilde toplam RNA ekstre edilmesi ve oldukça basit bir parazit lizis prosedürü uygulayarak olarak, bu füzyon RNA&#39...

Cinsi Plasmodium apicomplexan parazitlerin neden Sıtma, Her yıl dünya çapında yaklaşık 200 milyon kişiyi enfekte ve yaklaşık 600.000 kişinin ölümüne neden olan 1, en ​​yaygın insan parazitik bir hastalıktır. İnsanları enfekte eden beş Plasmodium türleri arasında, insan hastalığı ile en çok ilgili P. ve P. falciparum Şiddetli sıtma komplikasyonlar için onların yaygın dağılımları ve potansiyel nedeniyle Vivax. Sıtma parazitinin yaşam döngüsü sivrisinekler ve insanlarda hem de enfeksiyon gerektirir. Virüslü bir sivrisinek bir insanı ısırdığında, parazitler replikasyon başlangıç ​​yuvarlak meydana karaciğer, kan dolaşımı yoluyla seyahat. Ev sahibi hepatosit gelen merozoitler kopma sonra, aseksüel veya cinsel ya çoğaltma başlatarak, yakındaki kırmızı kan hücreleri enfekte. P. 48 saat sürer replikasyon aseksüel aşaması, en mal kaynağı hem beri falciparum, bu çalışmanın odak noktasıaria semptom ve kolayca in vitro değinmeyecek. Gelişmiş anti-sıtma terapileri de dahil olmak üzere kamu sağlığı girişimlerinin, bir dizi biraz küresel sıtma yükünü azalttık ederken, ilaca dirençli parazitlerin devam çıkması sıtma kontrolü çabaları için bir sorun oluşturur. Yeni tedavi yaklaşımları önerebilir bir alan genetik varyantlar sıtmaya karşı direnç kazandıran nasıl çeşitli üzerinde çalışmadır. Sıtmanın endemik olduğu bölgelerde, eritrosit polimorfizmleri çeşitli 2,3 oldukça yaygındır. Orak hücre belki de en belirgin olduğu bu mutasyonlar, semptomatik sıtma enfeksiyonu 4 başlamasından büyük bir direnç ile ilişkilidir. Onlar sıtma enfeksiyonu karşı eritrositler nedeni olan altta yatan mekanizmalar tam olarak anlaşılamamıştır. Hemoglobin mutasyonları ile parazitlenmiş eritrositler gelişmiş hücresel katılık ve dehidratasyon yoluyla geliştirilmiş fagositoz tabi olanP. azalarak işgali ile ilişkili 5 Falciparum. HbS, HbC allelin de eritrosit yüzeyine ve hücre iskeleti yeniden modellenmesi, daha da parazit gelişimini inhibe 6,7 protein ekspresyonunu etkilemektedir. Son olarak, P. Falciparum homozigot orak içinde kötü büyür (HbSS) sıtma direnci içsel faktörler eritrosit düşündüren, in vitro 8,9 eritrosit. Bu mekanizmaların her bir rol oynuyor gibi görünmektedir Ancak, tam sıtma orak hücre direnci arkasında mekanizmalarını açıklar yoktur. Yeterince anlaşılamamıştır eritrosit faktörlerden biri potansiyel seti olgun eritrositler içinde miRNA mevcut büyük havuzudur. MikroRNA&#39;lar 3 &#39;UTR içindeki baz çiftlemesi, çeviri ve / veya hedef mRNA stabilitesini aracılık 19-25 nt küçük boyutlu kodlayıcı olmayan RNA&#39;lar, bulunmaktadır. Bu bastırma-o dahil olmak üzere, memeli bağışıklık tepkilerinin kontrolünde implike edilmiştirf virüs replikasyonu, 10, ve bitkilerde virüslere karşı direnç gösterilmiştir Ayrıca eritropoezi 11,12 ve demir metabolizması 13 dahil olmak üzere birçok eritrosit süreçleri düzenleyen gösterilmiştir. Önceki çalışmalar ifadesi dramatik HBSS değiştirilmiş 14,15 eritrosit eritrosit miRNA&#39;lar, bir bol ve çeşitli nüfus tespit edilmiştir. Olgun eritrositler aktif transkripsiyon ve çeviri yoksun olduğundan, bu eritrosit miRNA&#39;lar fonksiyonel rolü belirsizliğini korumaktadır. Önemli malzeme değişimi konak hücreye ve P. arasında oluşur gibi intraerythrocytic gelişim döngüsü (IDC) 16 sırasında falciparum, bu HbS eritrositler içinde değişmiş miRNA profil doğrudan hücre içsel sıtma direncine katkıda bulunabilir iddia edildi. Bu çalışmalar sonunda, izole tespit ve fonksiyonel m olan, insan miRNA&#39;nın rolünü araştırmak için bir boru hattı geliştirilmesine yol açmıştıralaria parazit P. Bu konak / insan miRNA&#39;lar sonuçta kovalent sigorta ve sonra translasyon parazit mRNA transkriptleri 17 bastırmak olduğunu belirtti falciparum. Bu şekilde trans-ekleme ile oluşturulan ilk çapraz tür kimerik transkript bir örnek Resim ve miRNA mRNA füzyon diğer parazitler gibi diğer türlerde de meydana geliyor olabilir bir şekilde gösterir. Tüm tripanosom mRNAlar trans-splayslanmış bir bağlayıcı lideri (SL) ile polisistronik transkript 18 ayrılmasını düzenleyen bulunmaktadır. P. yana falciparum Dicer / Önce 19,20 için ortologlarını yoksun, bu eritrosit miRNA&#39;lar P. benzer SL makineleri kaçırmak mümkündür falsiparum hedef genlerin entegre. P. Son çalışmalar falsiparum Aslında 5 &#39;lider sekansların bağlantı 21 mevcudiyetine işaret vardır. Bu çalışma transkriptomik ve transla de dahil olmak, insan-parazit miRNA-mRNA füzyon transkriptleri keşfine yol açtı yöntemleri ayrıntılarıtional regülasyon teknikleri. Bu yöntemlerin genel amaçları P. gen regülasyonu, fenotipleri ve çeviri potansiyelinin küçük RNA&#39;ların etkilerini araştırmak için vardır Falciparum transkript. İnsan-parazit kimerik transkript ilk tanımlama gibi oldukça sadece küçük RNA&#39;lar izole teknikleri kullanarak daha toplam hem de küçük RNA&#39;lar dahil real-time PCR, transcriptome sıralama ve EST kütüphane yakalama gibi RNA analiz tekniklerinin kullanımı üzerine dayanıyordu. Büyük bir havuzda birlikte tüm RNA İzolasyon, ayrı ayrı olarak daha parazit hem transloke insan küçük RNA belirlenmesini yanı sıra daha büyük bir sekansın bir parçası olarak, bu küçük bir RNA dizilerinin varlığının sağladı. Bu daha sonra bu füzyonların fonksiyonel sonuçlarını belirlemek için bu füzyon mRNA&#39;ların çeviri devletin bir analizini gerekli. Parazitin genom bir karakterizasyonu kapsamlı çabalar ikend transcriptome parazitin biyoloji 22-25 anlayışına eklemiş, çok daha az P. yaşam döngüsü boyunca mRNA transcriptome öteleme yönetmelik hakkında bilinen Falciparum 26. Parazitin proteom Bu sınırlı anlayış parazitin biyoloji anlayışını ve anti-sıtma terapötik nesil için yeni hedefler belirlemek için yeteneği hem de engellemiştir. Parazitin hücre biyolojisi anlayış bu boşluk P. translasyonel düzenlemeyi incelemek için yeterli tekniklerin olmaması nedeniyle büyük ölçüde devam etmiştir Falciparum. Yakın zamanda kağıt P. ribozomal ayak izi kullanımını tarif Falciparum küresel çeviri durumunu belirlemek için 21. Transkript öteleme potansiyelinin biri iyi kurulmuş ölçüm Polizom profilleme tarafından belirlenen ilgili ribozomların sayısıdır. Bununla birlikte, ne bu teknik, P. uygulanır Falciparum &lt;/ em&gt;, en Polisomlar kurtarmak edemiyor ve ağırlıklı olarak monosomes yakalar. Son zamanlarda, çeşitli gruplar 27,28 P. optimize Polisomlar korumak ve ev sahibi kırmızı hücrelerin 28 kendi aseksüel gelişimi sırasında bu sıtma parazitlerinin ribozomal doluluk ve translasyonel potansiyelini karakterize etmek aynı zamanda eritrosit ve parazit parçalama yoluyla falsiparum Polizom teknikleri. Topluca, bu yöntemler, insan miRNA ve parazit mRNA&#39;larının gözlenen füzyon daha önce bildirilen yöntemler kullanılarak 27 gösterilmiştir olanlar füzyon mRNA&#39;lann, parazit protein çevirisini modüle ve HBA sıtma direncinin önemli bir belirleyicisidir ve HbSS 17 eritrosit göstermektedir. Bu yöntemler, bu füzyon RNA&#39;lar P. içinde olup olmadığını, RNA ekleme olaylarını tanımlamak ve fonksiyonel keşfetmek isteyen herhangi bir sisteme yararlı olacaktır falciparum ya da olmasın diğer ökaryotik sistemlerde.

<table><tbody><tr><td>&lt;strong&gt;REAGENTS-All reagents must be RNAse-free.&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Diethyl pyrocarbonate</td><td>Sigma</td><td>D5758</td><td>DEPC</td></tr><tr><td>DEPC-treated water (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Yoyo-1 DNA fluorescent dye</td><td>Thermo Fisher</td><td></td><td></td></tr><tr><td>Gene Pulser II electroporator</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>0.2 cm Electroporation cuvettes</td><td></td><td></td><td></td></tr><tr><td>4 M potassium acetate</td><td>Mallinckrodt</td><td>6700</td><td></td></tr><tr><td>2 M potassium HEPES</td><td>Sigma</td><td>H0527</td><td>pH 7.2</td></tr><tr><td>1 M magnesium acetate</td><td>Sigma</td><td>M-2545</td><td></td></tr><tr><td>1 M dithiothreitol</td><td>Research Products International</td><td>D11000</td><td>DTT</td></tr><tr><td>100 mM phenylmethylsulfonate fluoride</td><td>Sigma</td><td>P7626</td><td>PMSF, dissolved in isopropanol</td></tr><tr><td>10% (v/v) Igepal CA-630</td><td>Sigma-Aldrich</td><td>I3021</td><td></td></tr><tr><td>10% (w/v) sodium deoxycholate</td><td>Sigma</td><td>D-6750</td><td>DOC</td></tr><tr><td>Cycloheximide</td><td>Sigma</td><td>C-7698</td><td>CHX</td></tr><tr><td>Sucrose</td><td>Mallinckrodt</td><td>8360-04</td><td></td></tr><tr><td>RNAseOUT (Invitrogen, cat. no. 100000840)</td><td>Invitrogen</td><td>100000840</td><td></td></tr><tr><td>RPMI-1640 w/ L-glutamine</td><td>Cellgro</td><td>10-040-CV</td><td></td></tr><tr><td>10% AlbuMAX I</td><td>Invitrogen</td><td>11020-039</td><td>w/v in sterile water</td></tr><tr><td>Gentamicin</td><td>Gibco</td><td>15750-060</td><td></td></tr><tr><td>HT supplement (100x) (Invitrogen, cat. no. 11067030)</td><td></td><td></td><td></td></tr><tr><td>45% (w/v) sucrose (Sigma, cat no. G8769)</td><td></td><td></td><td></td></tr><tr><td>1 M HEPES buffer (Gibco, cat. no. 15630-080)</td><td></td><td></td><td></td></tr><tr><td>1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td><td></td><td></td><td></td></tr><tr><td>Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td><td></td><td></td><td></td></tr><tr><td>Glass slides (VWR, cat. no. 48311-702)</td><td></td><td></td><td></td></tr><tr><td>Giemsa stain (50X) (VWR, cat no. m708-01)</td><td></td><td></td><td></td></tr><tr><td>mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td><td></td><td></td><td></td></tr><tr><td>5&#039; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td><td></td><td></td><td></td></tr><tr><td>Biotin powder (Sigma-Aldrich)</td><td></td><td></td><td></td></tr><tr><td>1 M Potassium Chloride</td><td></td><td></td><td></td></tr><tr><td>Streptavidin Sepharose High Performance Beads (GE Healthcare)</td><td></td><td></td><td></td></tr><tr><td>Ribosome resuspension buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Lysis buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>0.5 M sucrose cushion (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>60% (w/v) sucrose chase solution (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>Plasmodium cell culture media (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>RNA capture Wash Buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>RNA Elution Buffer (see REAGENT SETUP)</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;REAGENT SETUP&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmodium cell culture media&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>500 ml RPMI-1640 w/ L-glutamine</td><td></td><td></td><td></td></tr><tr><td>0.5 ml gentamicin</td><td></td><td></td><td></td></tr><tr><td>5 ml HT supplement</td><td></td><td></td><td></td></tr><tr><td>2.5 ml 45% glucose</td><td></td><td></td><td></td></tr><tr><td>25 ml 10% AlbuMAX I</td><td></td><td></td><td></td></tr><tr><td>12.5 ml 1 M HEPES</td><td></td><td></td><td></td></tr><tr><td>Sterile filter with 0.2 mm vacuum filter flask.</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmodium cell culture media containing 10x CHX&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as Plasmodium cell culture media above, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>2 mM cycloheximide</td><td></td><td></td><td></td></tr><tr><td>Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;1x PBS containing cycloheximide&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 &lt;sup&gt;O&lt;/sup&gt;C until use.</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Ribosome resuspension buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>400 mM potassium acetate</td><td></td><td></td><td></td></tr><tr><td>25 mM potassium HEPES, pH 7.2</td><td></td><td></td><td></td></tr><tr><td>15 mM magnesium acetate</td><td></td><td></td><td></td></tr><tr><td>200 mM cycloheximide (add fresh)</td><td></td><td></td><td></td></tr><tr><td>1 mM DTT (add fresh)</td><td></td><td></td><td></td></tr><tr><td>1 mM PMSF (add fresh)</td><td></td><td></td><td></td></tr><tr><td>40 U/ml RNaseOUT (add fresh)</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Lysis buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as ribosome resuspension buffer above, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>1% (v/v) Igepal CA-630</td><td></td><td></td><td></td></tr><tr><td>0.5% (w/v) DOC</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Sucrose solutions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td><td></td><td></td><td></td></tr><tr><td>15% (w/v) sucrose to make 15% sucrose gradient solution</td><td></td><td></td><td></td></tr><tr><td>50% (w/v) sucrose to make 50% sucrose gradient solution</td><td></td><td></td><td></td></tr><tr><td>0.5 M sucrose to make 0.5 M sucrose cushion</td><td></td><td></td><td></td></tr><tr><td>As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td><td></td><td></td><td></td></tr><tr><td>The 60% sucrose chase solution requires only sucrose and water, no other components</td><td></td><td></td><td></td></tr><tr><td>60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;RNA Capture Wash Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>20 mM&amp;nbsp; KCl</td><td></td><td></td><td></td></tr><tr><td>5 unit/ml Rnase Out (Invitrogen)</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;RNA Capture Elution Buffer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Same recipe as RNA Capture Wash Buffer, with the addition of:</td><td></td><td></td><td></td></tr><tr><td>2 mM Biotin</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;EQUIPMENT&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td><td></td><td></td><td></td></tr><tr><td>SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td><td></td><td></td><td></td></tr><tr><td>Ultra-Clear&lt;sup&gt;TM&lt;/sup&gt; &amp;frac12; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td><td></td><td></td><td></td></tr><tr><td>Polyallomer 9/16 x 3 &amp;frac12; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td><td></td><td></td><td></td></tr><tr><td>L8-80M ultracentrifuge (Beckman)</td><td></td><td></td><td></td></tr><tr><td>Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)</td><td></td><td></td><td></td></tr><tr><td>1 ml syringe with 27 G&amp;frac12; needle (Becton Dickinson, cat no. 309623)</td><td></td><td></td><td></td></tr><tr><td>5 ml syringe (Becton Dickinson, cat. no. 309646)</td><td></td><td></td><td></td></tr><tr><td>Parafilm</td><td></td><td></td><td></td></tr><tr><td>Tube rotator, end-over-end</td><td></td><td></td><td></td></tr><tr><td>Microcentrifuge, refrigerated</td><td></td><td></td><td></td></tr><tr><td>Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td><td></td><td></td><td></td></tr><tr><td>TracerDAQ (Measurement Computing)</td><td></td><td></td><td></td></tr><tr><td>Eppendorf 5810R centrifuge</td><td></td><td></td><td></td></tr><tr><td>Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td><td></td><td></td><td></td></tr></tbody></table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

Orak hücre alel sorumlu genetik varyasyon (HbS) sıtma parazitinin, P. tarafından enfeksiyonu karşı eritrosit sağlar Falciparum. Multifaktöryel olduğu bilinmektedir, bu direncin, moleküler temeli, tam olarak anlaşılamamıştır. Son çalışmalar kez sıtma parazitleri transloke eritrosit microRNA, ayırıcı ifadesi, gen düzenlemesi ve parazit büyümesi hem de etkilediği bulundu. Bu miRNA&#39;ların sonra parazit mRNA&#39;ların gizli alt grupları ile 5 &#39;RNA füzyon ile bir kimerik RNA transkripti oluşturarak mRNA translasyonunu inhibe ettiği gösterilmiştir. Burada kullanılan teknikler gen regülasyonu ve P. translasyonel potansiyeline fonksiyonel rolü ve varsayılan mekanizma altında yatan eritrosit microRNA incelemek için falsiparum, ev sahibi eritrositlerin içine modifiye sentetik microRNA transfeksiyonunun dahil detaylı olarak açıklanacaktır. Son olarak, polisom gradyan yöntemi tra derecesini belirlemek için kullanılırBu transkriptlerin nslation. Birlikte, bu teknikler bize eritrosit microRNA düzensiz düzeyleri orak eritrositlerin hücre içsel sıtma direncine katkıda bulunduğunu göstermek için izin verdi.

P. insan microRNA Küresel profilleme Falciparum Burada sunulan teknikler çeşitli koşullar içerisinde parazitlerden microRNA çıkarmak için kullanıldı. Unutulmaması gereken bir şey, genellikle bu makalede ve orijinal çalışmada 29 hem de sunulan microRNA verileri için bir referans noktası olarak görev 32, belirtildiği gibi enfekte olmamış eritrositlerde için RNA ekstraksiyonu gerçekleştirilmiştir olmasıdır. Bu daha önceki çal?...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Yöntemler Küçük RNA&#39;ların ve Ribosomal doluluk Düzenleyici Rolü Araştırma<em&gt; Plasmodium falciparum</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K Görüntüleme.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Video: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

Rapid Metodoloji tarafından Roman RNA Bağlayıcı Proteinler İzolasyon

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

Genetik

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

Nicel ayirt ölçmek küresel çeviri lokalize

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biyokimya

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For a long time, the gene expression studies were dominated by research on the transcriptional level. However, the steady-state levels of mRNAs do not correlate well with protein production, and the translatability of mRNAs varies greatly depending on the conditions. In some organisms, like the parasite Leishmania, the protein expression is regulated mostly at the translational level. Recent studies demonstrated that protein translation dysregulation is associated with cancer, metabolic, neurodegenerative and other human diseases. Polysome profiling is a powerful method to study protein translation regulation. It allows to measure the translational status of individual mRNAs or examine translation on a genome-wide scale. The basis of this technique is the separation of polysomes, ribosomes, their subunits and free mRNAs during centrifugation of a cytoplasmic lysate through a sucrose gradient. Here, we present a universal polysome profiling protocol used on three different models - parasite Leishmania major, cultured human cells and animal tissues. Leishmania cells freely grow in suspension and cultured human cells grow in adherent monolayer, while mouse testis represents an animal tissue sample. Thus, the technique is adapted to all of these sources. The protocol for the analysis of polysomal fractions includes detection of individual mRNA levels by RT-qPCR, proteins by Western blot and analysis of ribosomal RNAs by electrophoresis. The method can be further extended by examination of mRNAs association with the ribosome on a transcriptome level by deep RNA-seq and analysis of ribosome-associated proteins by mass spectroscopy of the fractions. The method can be easily adjusted to other biological models.

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

The overall goal of polysome profiling technique is analysis of translational activity of individual mRNAs or transcriptome mRNAs during protein synthesis. The method is important for studies of protein synthesis regulation, translation activation and repression in health and multiple human diseases.

Polysome LEISHMANIA, insan hücreleri ve fare Testis profil oluşturma

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

Ökaryotik mRNA-Protein kompleksleri kurtarmak için bir Tandem oligonükleotid tabanlı RNA izolasyon yordamı

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

An Assay for Quantifying Protein-RNA Binding in Bacteria

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding of an RNA binding protein (RBP) to the initiation region of the mRNA, which interferes with ribosome binding. In the presented method, we utilize this blocking phenomenon to quantify the binding affinity of RBPs to their cognate and non-cognate binding sites. To do this, we insert a test binding site in the initiation region of a reporter mRNA and induce the expression of the test RBP. In the case of RBP-RNA binding, we observed a sigmoidal repression of the reporter expression as a function of RBP concentration. In the case of no-affinity or very low affinity between binding site and RBP, no significant repression was observed. The method is carried out in live bacterial cells, and does not require expensive or sophisticated machinery. It is useful for quantifying and comparing between the binding affinities of different RBPs that are functional in bacteria to a set of designed binding sites. This method may be inappropriate for binding sites with high structural complexity. This is due to the possibility of repression of ribosomal initiation by complex mRNA structure in the absence of RBP, which would result in lower basal reporter gene expression, and thus less-observable reporter repression upon RBP binding.

In this method, we quantify the binding affinity of RNA binding proteins (RBPs) to cognate and non-cognate binding sites using a simple, live, reporter assay in bacterial cells. The assay is based on repression of a reporter gene.

Bakterilerde protein RNA bağlayıcı ölçümü için bir tahlil

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding ...

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes.
The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1.
Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types.

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization FISH

Fluorescent in situ hybridization (FISH) to identify mRNA transcripts in individual cells allows analysis of polygenic activity such as the simultaneous transcription of more than one member of the var multigene family in Plasmodium falciparum infected erythrocytes 1. The technique is adaptable and can be used on different types of genes, cells and organisms.

RNA Floresan tarafından Tek hücreli Gen Transkripsiyon Analizi<em&gt; In Situ</em&gt; Hibridizasyon (FISH)

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 ...

Biyoloji

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

Malaria remains one of the most devastating diseases worldwide and, to date, the African region is still responsible for 94% of all cases worldwide. This parasitic disease requires a protozoan parasite, an Anopheles mosquito vector, and a vertebrate host. The Anopheles genus comprises more than 500 species, of which 60 are known as vectors of the parasite. The Plasmodium parasite genus consists of 250 species, and 48 of these are involved in disease transmission. Furthermore, the Plasmodium falciparum parasite has contributed toward an estimated 99.7% of malaria cases in sub-Saharan Africa in recent years. 
Gametocytes form part of the sexual stage of the parasite and are ingested by the female mosquito upon feeding on an infected human host. Further development of the parasite within the mosquito is enhanced by favorable environmental conditions in the midgut of the mosquito. Here, the fusion of the female and male gametes takes place, and the motile ookinetes originate. The ookinetes enter the midgut epithelium of the mosquito, and mature ookinetes form oocysts, which, in turn, produce motile sporozoites. These sporozoites migrate to the mosquito's salivary glands and are injected as a mosquito takes a blood meal. 
For drug discovery purposes, mosquitoes were artificially infected with gametocyte-infected blood in the standard membrane feeding assay (SMFA). To detect infection within the mosquito and/or to assess the efficacy of antimalarial compounds, the midguts of the female mosquitoes were removed post infection and were stained with mercurochrome. This method was used to enhance the visual detection of oocysts under the microscope for the accurate determination of oocyst prevalence and intensity.

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

The standard membrane feeding assay (SMFA) is regarded as the gold standard for the assessment and identification of potential antimalarial compounds. This artificial feeding system is used to infect mosquitoes to further evaluate the effects of such compounds on the intensity and prevalence of the Plasmodium falciparum parasite.

Anofellerde Plasmodium falciparum Enfeksiyonunun Tespiti için Standart Membran Besleme Testi

Malaria remains one of the most devastating diseases worldwide and, to date, the African region is still responsible for 94% of all cases worldwide. This ...

İmmünoloji ve Enfeksiyon

Polysome Fractionation and Analysis of Mammalian Translatomes on a Genome-wide Scale

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. Accordingly, dysregulation of mRNA translation is considered to play a major role in a variety of pathological states including cancer. Ribosomes also host chaperones, which facilitate folding of nascent polypeptides, thereby modulating function and stability of newly synthesized polypeptides. In addition, emerging data indicate that ribosomes serve as a platform for a repertoire of signaling molecules, which are implicated in a variety of post-translational modifications of newly synthesized polypeptides as they emerge from the ribosome, and/or components of translational machinery. Herein, a well-established method of ribosome fractionation using sucrose density gradient centrifugation is described. In conjunction with the in-house developed &#8220;anota&#8221; algorithm this method allows direct determination of differential translation of individual mRNAs on a genome-wide scale. Moreover, this versatile protocol can be used for a variety of biochemical studies aiming to dissect the function of ribosome-associated protein complexes, including those that play a central role in folding and degradation of newly synthesized polypeptides.

Ribosomes play a central role in protein synthesis. Polyribosome (polysome) fractionation by sucrose density gradient centrifugation allows direct determination of translation efficiencies of individual mRNAs on a genome-wide scale. In addition, this method can be used for biochemical analysis of ribosome- and polysome-associated factors such as chaperones and signaling molecules.

Bir genom Ölçeği Polizom Fraksiyonu ve Memeli Translatomes Analizi

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. ...

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown to allow to selective translation of specific mRNAs, which typically encode for proteins required for a particular stress response. Identification of these mRNAs, as well as the characterization of regulatory mechanisms responsible for selective translation has been at the forefront of molecular biology for some time. Polysome profiling is a cornerstone method in these studies. The goal of polysome profiling is to capture mRNA translation by immobilizing actively translating ribosomes on different transcripts and separate the resulting polyribosomes by ultracentrifugation on a sucrose gradient, thus allowing for a distinction between highly translated transcripts and poorly translated ones. These can then be further characterized by traditional biochemical and molecular biology methods. Importantly, combining polysome profiling with high throughput genomic approaches allows for a large scale analysis of translational regulation.

The ability of cells to adapt to stress is crucial for their survival. Regulation of mRNA translation is one such adaptation strategy, providing for rapid regulation of the proteome. Here, we provide a standardized polysome profiling protocol to identify specific mRNAs that are selectively translated under stress conditions.

Polizom Profil Yöntemi ile memeli hücrelerine selektif mRNA dönüşümüyle Değerlendirilmesi

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown ...

An Easy Method for Plant Polysome Profiling

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the analysis of translational regulation. The method described here is an easy and economical way for fractionating polysomes from various plant tissues. A sucrose gradient is made without the need for a gradient maker by sequentially freezing each layer. Cytosolic extracts are then prepared in a buffer containing cycloheximide and chloramphenicol to immobilize the cytosolic and chloroplastic ribosomes to mRNA and are loaded onto the sucrose gradient. After centrifugation, six fractions are directly collected from the bottom to the top of the gradient, without piercing the ultracentrifugation tube. During collection, the absorbance at 260 nm is read continuously to generate a polysome profile that gives a snapshot of global translational activity. Fractions are then pooled to prepare three different mRNA populations: the polysomes, mRNAs bound to several ribosomes; the monosomes, mRNAs bound to one ribosome; and mRNAs that are not bound to ribosomes. mRNAs are then extracted. This protocol has been validated for different plants and tissues including Arabidopsis thaliana seedlings and adult plants, Nicotiana benthamiana, Solanum lycopersicum, and Oryza sativa leaves.

This protocol describes an easy method to extract and fractionate transcripts from plant tissues on the basis of the number of bound ribosomes. It allows a global estimate of translation activity and the determination of the translational status of specific mRNAs.

Bitki Polizom Profiling için bir Kolay Yöntem

Translation of mRNA to protein is a fundamental and highly regulated biological process. Polysome profiling is considered as a gold standard for the ...

Yöntemler Küçük RNA'ların ve Ribosomal doluluk Düzenleyici Rolü Araştırma

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler