This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: Aislamiento de ARN de pequeño tamaño de P. falciparum Durante la IDC <ol><li> Obtener parásitos de la malaria en la cultura asexual 29. NOTA: El tamaño de la cultura requerida variará en función de la aplicación deseada; sin embargo, un cultivo de 10 ml a 3-5% de parasitemia y 5% de hematocrito proporciona un amplio ARN para PCR en tiempo real (RT-PCR). La técnica se optimizó inicialmente para cultivos asíncronos, pero cuando se desean puntos temporales específicos durante el ciclo de infección, los parásitos de anillo etapa se puede sincronizar mediante la sincronización de sorbitol no más tarde de 10 a 12 horas después de la invasión. La sincronización debe repetirse después de un ciclo (aproximadamente 48 horas) 29. </li><li> Células infectadas piscina juntos (~ 5 x 10 9 RBCs a 3-5% de parasitemia) y llenar PBS frío a la parte superior del tubo y centrifugar a 800 xg durante 5 min sin freno para sedimentar las células rojas. </li><li> Después de la centrifugación, eliminar el sobrenadante cuidadosamente con una pipeta de aspiración, que se adjuntaa un vacío, ya que el pellet eritrocítica es fácil de desprender. Lavar el pellet una vez más con 1x PBS frío. </li><li> Resuspender pellet celular en frío 0,15% de saponina (en 1X PBS) y el lugar en hielo durante 30 min. </li><li> Las células se centrifuga a 1500 xg durante 12 min a 4 ° C, eliminar el sobrenadante (que será de color rojo oscuro) y el pellet se resuspende en PBS frío. Repita este paso una vez más. NOTA: Con el fin de garantizar que los microRNAs presentes eran reflejo de microRNAs dentro de los parásitos, y no contaminación eritrocítica, una serie de condiciones de aislamiento de parásitos fueron probados: 1) lisis de saponina, 2) la lisis de saponina combinada con el tratamiento RNaseA de miRNAs célula huésped y 3 ) metil-beta-ciclodextrina tratamiento para eliminar el parásito de la acogida eritrocitos. Todos los tratamientos dieron resultados similares. </li><li> Lyse la aislada pellet parásito utilizando los recomendados 600 l de tampón de lisis. Este volumen de tampón de lisis es suficiente para cultivos hasta ~ 30 ml a 2% de hematocrito y 5% de parasitemia. NOTA: Para los cultivos de parásitos más grandes, este volumen puede ser aumentada. Es importante para asegurar la lisis completa de la pastilla parásito por agitación a fondo durante al menos 1 min. Además, para facilitar la extracción, las muestras lisadas se pueden transferir a un tubo de microcentrífuga de 1,7 ml. </li><li> Añadir 60 l, o 1/10 de volumen de tampón de lisis utilizado en el paso 6, de aditivo homogeneizado (acetato de sodio 2 M, pH 4). </li><li> Deja muestras en hielo durante 10 min. </li><li> Añadir 600 l, o un volumen igual a la cantidad de tampón de lisis añadido en el paso 6, de ácido fenol cloroformo a cada muestra y agitar durante 1 min. </li><li> Se separan las fases acuosa y orgánica por centrifugación de las muestras a 10.000 xg durante 5 min. Este giro es más largo que el sugerido por el kit para garantizar que toda la hemoglobina / hemozoin está en la fase orgánica. </li><li> Recoger el (acuosa) de la capa superior y la transfiere a un tubo nuevo. Repita los pasos 9 y 10 si la fase acuosa es de color blanco o (más probable) de color marrón, lo que sugiere procontaminación de proteína. </li><li> Determinar el volumen del sobrenadante resultante mediante una pipeta y luego añadir 1,25 volúmenes de etanol 100% (~ 800 l) y mezclar invirtiendo el tubo de microcentrífuga de 1,7 ml 5 veces. </li><li> Pase cada muestra a través de un cartucho de filtro de unión al ARN proporcionado (varios diferente de los cuales son comercialmente disponible) ya sea por centrifugación a 14.000 xg durante 1 min o mediante el uso de un colector de vacío. </li><li> Lavar el cartucho de filtro con 700 l de la miRNA Wash Buffer 1 utilizando una microcentrífuga, girando a 14.000 xg durante 1 min. </li><li> Lavar el cartucho de filtro con 500 l de tampón de lavado 3/2 dos veces por centrifugación a 14.000 xg durante 1 minuto cada uno. </li><li> Eluir ARN con 100 l de agua DEPC, que ha sido precalentado a 95 ºC, en dos lavados de 50 l, centrifugando a 14.000 xg durante 1 min cada uno. Medir la concentración de ARN mediante la absorbancia UV a 260 nm. NOTA: Un gel de ARN (ya sea TBE-urea acrilamida o desnaturalización en gel de agarosa formaldehído) pueden be utilizó para evaluar la distribución de tamaños de los ARN aislados. NOTA: Este ARN es adecuado para el análisis de microarrays, ARN-secuencia, el norte de mancha y el ensayo de protección de ribonucleasa. </li></ol> 2: La cuantificación de ARN de pequeño tamaño de P. falciparum Durante la IDC <ol><li> Determinar la concentración de las muestras individuales aisladas en el paso 1 mediante espectrofotometría UV a 260 nm. </li><li> Generar cebadores de PCR en tiempo real para las especies de ARN deseadas. Para miARN solos, hemos utilizado ensayos miARN qPCR prefabricados, mientras que para los ARNm o fusión de los genes miARN-mRNA hemos diseñado cebadores para la SYBR verde. Para los ARN de fusión, el cebador directo fue la secuencia de los genes miARN en sí (miR-451: AAACCGTTACCATTACTGAGTT), mientras que lo contrario era un cebador de ~ 100 pb específico de gen aguas abajo de los genes miARN en la secuencia de ARNm (PKA-R: ATCGAACATGCTGTGAACAT). </li><li> Hacer ADNc a partir de las muestras de ARN utilizando un cebador de horquilla de miRNAs (utilizar 20-40 ng de ARN) sola o hexámeros aleatorios para ARNm y / o miRNAespecie de fusión-mRNA (utilizando 1 g de ARN). Mezclar ARN y cebadores durante 5 min a 65 ° C, después se enfría a temperatura ambiente. Después, agregue la mezcla de la transcriptasa inversa (0,5 l transcriptasa inversa, 0,5 l inhibidor de RNasa, 1 mu l dNTPs (2,5 mM cada uno), 4 l 5x tampón, 2 l 0,1 M de TDT, 1 l H2O). <ol><li> Las muestras se ejecutan en un termociclador capaz de detectar cualquiera de SYBR verde o sondas TaqMan. SYBR verde PCR cuantitativa 30 para genes específicos se ejecuta como un 3-etapa de PCR, 95 ° C durante 15 seg, más baja temperatura de hibridación del cebador menos 5 ° C durante 30 seg, y 68 ° C durante 30 segundos, durante 40 ciclos, utilizando una SYBR comercial mezcla maestra verde. miRNA-PCR en tiempo real se ejecuta como una PCR de dos etapas, 95 ° C durante 15 seg y 60 ° C durante 1 min, durante 40 ciclos. </li><li> Cuantificar ensayos utilizando el método ΔΔCt y normalizarlos en contra de cualquiera de Rab GTPasa (PF08_0110) o 18S rRNA 31. </li></ol></li></ol> 3: Introducciónde los pequeños RNAs en malaria parásitos <ol><li> Pellet 300 l de glóbulos rojos por transfección (250 l de glóbulos rojos, aproximadamente 1,5 x 10 9 células, se utilizará en última instancia) en medio completo malaria por centrifugación a 800 xg durante 5 min a 1 de freno. </li><li> Lavar los eritrocitos dos veces con RPMI y resuspender en Cytomix completa (120 mM KCl; 0,15 mM CaCl 2; 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM HEPES, pH 7,6; 2 mM EGTA, pH 7,6; 5 mM de MgCl 2; pH ajustado con KOH) al 50% de hematocrito después de la centrifugación a 800 xg durante 5 min a 1 de freno. </li><li> Transferir las células a una cubeta de electroporación de 0,2 cm. </li><li> Añadir 10 g, o apropiadas cantidad, de oligonucleótidos sintéticos personalizada a las cubetas y resuspender las culturas. </li><li> Ajuste el electroporador a 310 V / 950 mF y entregar un pulso a cada cubeta. </li><li> Resuspender los 300 l de glóbulos rojos dentro de la cubeta en pre-calentado mal completamedios aria y placa en placas de 24 pocillos y se incuba a 37 ° C en un recipiente hermético con la mezcla de gases en sangre malaria (3% O 2, 5% de CO 2). </li><li> Después de 4 h, infectar a los glóbulos rojos transfectadas con trofozoítos finales sincronizados a una parasitemia final aproximada de 1%. </li><li> Añadir glóbulos rojos recién transfectadas cada 4-6 días para los cultivos infectados y determinar el% de parasitemia por FACS utilizando YoYo-1 tinción, como se indica en la sección 4. </li></ol> 4: Determinación de eritrocitos Efecto microRNAs Al Parásito Infección Rate <ol><li> Tomar 100 l de la cultura resuspendido por micropipeta y colocar en un tubo de 1,7 ml de microcentrífuga. Lavar dos veces con 1 ml de PBS 1x y se centrifuga en una microcentrífuga de mesa por centrifugación a 800 xg durante 5 min. </li><li> Resuspender pellet en 1 ml de 0,025% de glutaraldehído. Incubar las muestras durante 20 min a RT. NOTA: Las muestras se pueden almacenar aquí por varias semanas a 4 ° C. Después, sedimentar los infectados RBC por centrifugación a 800 xg durante 5 min. Lavar dos veces con 1 ml de PBS 1x. </li><li> Resuspender pellet en 1 ml de 0,015% de saponina. Se incuba a 4 ° C durante 15 min. Pellet infectado glóbulos rojos mediante centrifugación a 800 xg durante 5 min. Lavar dos veces con 1 ml de PBS 1x. Repeat.4.3. Resuspender las células en 1 ml de 1x PBS que contenía 1 l (1.000X) tinción de ADN. </li><li> Determinar los grados de parasitemia en un citómetro de flujo, a 488 nm de excitación y 530 nM ~ (FL-1) de emisión. </li><li> En primer lugar, la puerta del citómetro de flujo basado en el FSC y SSC para centrarse en los glóbulos rojos. A continuación, medir el grado de parasitemia (GR infectados) en el RBC cerrada por fluorescencia en el canal FL-1. NOTA: después parásitos etapa son 10 veces más fluorescente de parásitos en etapas iniciales, y ~ 100X anterior glóbulos rojos no infectados. Además, la recogida a baja velocidad tiende a reducir el ruido. Finalmente, este enfoque ha sido comparado con el 3-H hipoxantina incorporación y tinción Giemsa, tanto como se informó anteriormente 13, y todas las técnicas de gave resultados similares. </li></ol> 5: La biotina-etiquetado y elución de miARN-mRNA Fusion Productos <ol><li> Directamente ordenar oligonucleótidos sintéticos de encargo de ARN con destiobiotina (DB) unidos covalentemente al extremo 5 &#39;. </li><li> Transfectar glóbulos rojos infectados con conjugado-destiobiotina (Db-) miARN y miARN no modificada (control negativo), tal como se indica en el paso 3. </li><li> Infectar los glóbulos rojos transfectadas con P. falciparum parásitos a una parasitemia de partida de 0,5% (paso 1.1). </li><li> Extracto de ARN parásito 4 días (96 horas) más tarde como se describe anteriormente en el paso 1. </li><li> Incubar 10 g de ARN parásito con 50 l envasados ​​perlas de estreptavidina, añadido a través de micropipeta, y girar en un rotador tubo de microcentrífuga durante 1 hora a 4 ° C. </li><li> Sedimentar las perlas a 800 xg durante 30 seg y se lava con 20 mM KCl y 1 / 1.000 inhibidor de RNasa. </li><li> Eluir RNAs de las perlas por la competencia con biotina 2 mM y 200 con tampón de elución de captura de RNA l (20 mM de KCl, 1/1, 000 Inhibidor de RNasa y 2 mM biotina) en 4 ° C durante la noche con rotación. </li><li> Determinar el grado de enriquecimiento del indicado P. transcripciones falciparum utilizando SYBR verde QRT-PCR, y el enriquecimiento de microARN (control positivo) por TaqMan qPCR como se indica en el paso 2. </li></ol> 6: Separación polisomas para determinar el Ribosomal ocupación de P. falciparum <ol><li> Coloque solución de sacarosa al 5 ml de 15% (mM de acetato 400 de potasio, HEPES de potasio 25 mM, pH 7,2, acetato de magnesio 15 mM, 200 mM cicloheximida, 1 mM de DTT, 1 mM PMSF, inhibidor de RNasa 40 U / ml, y 15% de sacarosa ) en un tubo de ultracentrífuga SW41 (14 x 89 mm). </li><li> Usando una jeringa de 5 ml, añadir solución de sacarosa al 5 ml de 50% (mM de acetato 400 de potasio, HEPES de potasio 25 mM, pH 7,2, acetato de magnesio 15 mM, 200 mM cicloheximida, 1 mM de DTT, 1 mM PMSF, 40 U / ml de RNasa inhibidor, y el 50% de sacarosa) por debajo de la sacarosa 15% utilizando una aguja de acero largo, a continuación, retire la aguja. </li><li&gt; sellar la parte superior del tubo de gradiente con Parafilm, incline el tubo lentamente sobre su lado, en una posición estable para evitar la rodadura, por lo que está mintiendo horizontalmente sobre la mesa. Mantenga el tubo en su lado durante al menos 2 hr. Mientras espera, comenzar con el paso 6.5. </li><li> Después de 2 horas, lentamente incline el tubo de nuevo en posición vertical y transferir el tubo en hielo, lo que permite que se enfríe durante al menos 15 minutos antes de la carga de la muestra (paso 14). </li><li> Reunir suficiente sangre infectado con Plasmodium cultura etapa para generar 100 a 500 g de ARN total, o aproximadamente un 100 ml cultura asíncrona al 3-5% de parasitemia. Añadir 1/10 que el volumen de medio de cultivo que contiene 10x (2 mM) cicloheximida (CHX) y se incuba a 37 ° C durante 10 min. <ol><li> Culturas precipitado mediante centrifugación a 500 xg durante 7 minutos con la centrífuga (freno 1), a continuación, se lavan dos veces con PBS 1x temperatura ambiente que contiene 200 mM CHX. Resuspender las culturas del parásito en 1x PBS que contenía 200 mM CHX y almacenar en hielo. </li></ol></li&gt; <li> Estimar el volumen del sedimento de RBC. Añadir tampón de lisis (mM acetato de potasio 400, HEPES de potasio 25 mM, pH 7,2, acetato de magnesio 15 mM, 200 CHX mu M, 1 mM de DTT, 1 mM PMSF, 40 U / inhibidor de RNasa ml, 1% (v / v) IGEPAL CA -630, y 0,5% (w / v) DOC) al sedimento de RBC a un volumen final de 4,25 ml. Incubar el lisado a 4 ° C durante 10 min mientras se gira. </li><li> Transferir el lisado a tubos de microcentrífuga, y centrifugar las muestras en una microcentrífuga a 16.000 xg y 4 ° C durante 10 min. </li><li> Preparar cojines de sacarosa pipeteando 1,25 ml de la solución de colchón de sacarosa fría 0,5 M (mM de acetato 400 de potasio, HEPES de potasio 25 mM, pH 7,2, acetato de magnesio 15 mM, 200 mM cicloheximida, 1 mM de DTT, 1 mM PMSF, 40 U / ml de RNasa inhibidor, y 0,5 M de sacarosa) en un tubo de ultracentrífuga SW55 (13 x 51 mm). </li><li> La capa cuidadosamente 3,75 ml de sobrenadante de lisado (del paso 7) en la parte superior del colchón de sacarosa utilizando una jeringa y pequeño (~ 27) aguja de calibre. Store lisado restante (~ 500 l) a -80 ° C para extraer los niveles de ARN total, como se indica en el apartado 1. </li><li> Cargar las muestras en un rotor de ultracentrífuga, pre-refrigerada a 4 ° C, que puede contener 13,2 ml tubos. Centrifugar las muestras a 366.000 xg y 4 ° C durante 146 min. </li><li> Con una pipeta, transferir el sobrenadante a un tubo cónico de 15 ml. Almacenar el sobrenadante a -80 ° C para el aislamiento de ARN de libres (no unida por los ribosomas) ARN. </li><li> Resuspender el precipitado ribosoma en 500 l de tampón de resuspensión ribosoma (mM de acetato 400 de potasio, HEPES de potasio 25 mM, pH 7,2, acetato de magnesio 15 mM, 200 mM cicloheximida, 1 mM de DTT, 1 mM PMSF, y 40 U / inhibidor de RNasa ml) pipeteando durante 5 min. </li><li> Centrifugar las muestras en una microcentrífuga a 16.000 xg y 4 &#160; ° C durante 10 min. </li><li> Mientras se mantiene el gradiente desde el paso # 4 en el hielo, retire el Parafilm, a continuación, la capa cuidadosamente la suspensión ribosoma en la parte superior de la usi gradienteng una jeringa y pequeñas (~ 27) aguja de calibre. </li><li> Cargar el tubo en un rotor de ultracentrífuga pre-enfriada y centrifugar los gradientes a 200.000 xg cargados y 4 ° C durante 180 min. Cuando se completa el giro, almacenar centrifugó a 4 gradientes ° C hasta que esté listo para cargar en el fraccionador. </li><li> Carga de un tubo de ultracentrífuga desembocan en el fraccionador gradiente (esto puede ser un tubo utilizado en una carrera anterior), luego lave con RNasa libre de agua durante 5 minutos a 100 x 10 velocidades. </li><li> Durante el lavado en el paso 6.16, ajustar la sensibilidad del detector de absorbancia UV. Una buena sensibilidad de partida es 0,2, pero esto puede tener que ajustarse en adelante corre dependiendo de la señal A 254 (que varía basada en el número de parásitos, etc.). </li><li> Una vez que la sensibilidad del detector se fija, ajuste la señal de referencia a cero mientras que el agua fluye a través del detector. </li><li> Después de lavar el colector de fracciones, revertir el flujo de fluido hasta que las líneas están vacías y luego remove el tubo de ultracentrífuga vacía. </li><li> Ejecutar solución de sacarosa al 60% a través de la columna de fraccionamiento hasta que sale del aparato de la aguja. </li><li> Inserte el tubo que contiene el primer gradiente en la parte superior de la cámara de carga y apriete el sello, con cuidado de no apretar demasiado. Entonces, perforar la parte inferior del tubo con la aguja. </li><li> Cambiar la velocidad de flujo de fluido a 12,5 x 10 (controlado por la perilla de control de velocidad de flujo en la parte frontal de la bomba), a continuación, establecer el colector de fracciones automático para recoger las fracciones 18 seg (~ 330 l / fracción) en tubos de microcentrífuga. </li><li> Comience hacia adelante de flujo de la solución de sacarosa al 60%. </li><li> Cuando la primera gota de la solución de gradiente de gotas en el tubo de microcentrífuga, comience inmediatamente tanto la recolección de fracciones y la grabación en vivo de la señal A 254. </li><li> Una vez que una fuerte caída se observa en la señal A 254, correspondiente a la interfaz entre las soluciones de sacarosa 50% y 60%, tanto detener el flujo de fluido y A 254 </sub&gt; grabación. </li><li> Guarde las fracciones del gradiente a -80 &#160; ° C para su uso posterior. </li><li> Invertir el flujo de fluido en 100 x 10 velocidad hasta que la solución de sacarosa al 60% se vacía fuera del tubo de ultracentrífuga. </li><li> Si hay gradientes adicionales para fraccionar, retire el tubo de ultracentrífuga vacío de la cámara de carga y reiniciar desde el paso 6.21. Si se han completado todas las muestras, lavar el aparato como se llevó a cabo en pasos de 6.16 y 6.19. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HbS es una de las variantes de hemoglobina más comunes en las zonas endémicas de malaria, en gran medida, ya que proporciona protección contra la malaria grave por P. falciparum. Las técnicas necesarias para caracterizar el papel del microRNA humana en la regulación de genes de P. falciparum se detallan a lo largo de este manuscrito. Mediante la extracción de ARN total de una manera tal como para incluir todos los pequeños RNAs, y mediante la realización de un procedimiento de...

La malaria, causada por parásitos apicomplexan del género Plasmodium, es la enfermedad parasitaria humana más común, infectando a nivel mundial unos 200 millones de personas cada año y causa alrededor de 600.000 muertes 1. De las cinco especies de Plasmodium que infectan a los seres humanos, los más relevantes para las enfermedades humanas son P. falciparum y P. vivax, debido a sus distribuciones generalizadas y el potencial de complicaciones graves de malaria. El ciclo de vida del parásito de la malaria requiere la infección de ambos mosquitos y seres humanos. Cuando un mosquito infectado pica a un humano, los parásitos viajan a través del torrente sanguíneo hasta el hígado, donde se produce una ronda inicial de la replicación. Después de merozoitos ruptura del hepatocito anfitrión, que infectan los glóbulos rojos cercanos, iniciando la replicación sea asexual o sexual. La etapa asexual de replicación, que tiene una duración de 48 horas en P. falciparum, es el foco de este estudio, ya que es a la vez la fuente de la mayoría malsíntomas aria y se recapitulan fácilmente in vitro. Si bien una serie de iniciativas de salud pública, incluyendo la mejora de los tratamientos contra la malaria, han reducido un poco la carga de la malaria a nivel mundial, la continua aparición de parásitos resistentes a los fármacos presenta un problema para los esfuerzos de control de la malaria. Una de las áreas que pueden sugerir nuevos enfoques terapéuticos es el estudio de cómo las diversas variantes genéticas confieren resistencia a la malaria. En las regiones donde la malaria es endémica, una variedad de polimorfismos eritrocitarios son bastante comunes 2,3. Estas mutaciones, con células falciformes siendo quizás el más destacado, a menudo se asocian con la resistencia sustancial a la aparición de la infección de la malaria sintomática 4. Los mecanismos subyacentes por los que causan los eritrocitos para resistir la infección por malaria se conocen por completo. Eritrocitos parasitados con mutaciones de hemoglobina están sujetos a una mayor fagocitosis través rigidez celular mejorada y deshidratación, queestá asociada con la invasión disminuido en P. falciparum 5. El alelo HbC también afecta a la expresión de proteínas en la superficie de los eritrocitos y con la remodelación del citoesqueleto, inhibiendo aún más el desarrollo del parásito 6,7. Por último, P. falciparum crece mal dentro falciformes homocigóticos (HBSS) eritrocitos 8,9 in vitro, lo que sugiere factores eritrocitarios intrínsecas de resistencia a la malaria. Sin embargo, aunque todos estos mecanismos parecen jugar un papel, no explican plenamente los mecanismos detrás de la resistencia de células falciformes a la malaria. Un conjunto potencial de los factores eritrocitarios que permanecen poco conocida es la gran reserva de miARN presentes dentro de los eritrocitos maduros. Los microARNs son pequeños RNAs no codificantes, 19-25 de nt en tamaño, que median la traducción y / o estabilidad del ARNm diana por emparejamiento de bases dentro de la 3 &#39;UTR. Ellos han sido implicados en el control de la respuesta inmune de mamíferos, incluyendo el o supresiónla replicación del virus f 10, y fueron demostrado que confieren resistencia a virus en plantas Ellos también se han demostrado que regulan varios procesos eritrocitarios, incluyendo la eritropoyesis 11,12 y metabolismo del hierro 13. Estudios previos identificaron una población abundante y diversa de miRNAs eritrocítica, cuya expresión se alteró dramáticamente en HbSS eritrocitos 14,15. Puesto que los eritrocitos maduros carecen de la transcripción y la traducción activa, el papel funcional de estos miRNAs eritrocitos sigue siendo poco clara. Como se produce el intercambio de material significativa entre la célula huésped y P. falciparum durante el ciclo de desarrollo intraeritrocitaria (IDC) 16, se especuló que el perfil de miARN alterado dentro de los eritrocitos HbS puede contribuir directamente a la resistencia a la malaria de células intrínseca. Estos estudios condujeron en última instancia al desarrollo de una tubería para aislar, identificar y funcionalmente estudiar el papel de los genes miARN humano dentro de la mparásito alaria, P. falciparum, que indicaron que los anfitriones / miRNAs humanos en última instancia, de forma covalente de fusibles y luego reprimir traslación transcripciones de ARNm parásito 17. Esto proporcionó un ejemplo de las primeras especies cruzadas transcripciones quiméricos formados por trans-empalme e implica que esta fusión miARN-mRNA podría estar ocurriendo en otras especies, incluyendo otros parásitos. Todos los ARNm tripanosoma son trans-empalmados con un empalme-líder (SL) para regular la separación de polycistronic transcripciones 18. Desde P. falciparum carece ortólogos para Dicer / Ago 19,20, es posible que los miRNAs eritrocitos secuestran SL maquinaria similar en P. falciparum para integrar en los genes diana. Estudios recientes en P. falciparum tiene, de hecho, indica la presencia de secuencias líder 5 &#39;de empalme 21. Este estudio detalla los métodos que llevaron al descubrimiento de transcripciones de fusión-humanos parásito miARN-mRNA, incluyendo tanto transcriptómica y translatécnicas de regulación cionales. Los objetivos generales de estos métodos son para investigar los efectos de los pequeños RNAs en la regulación de genes, fenotipos y traducción potencial de P. transcripciones falciparum. La identificación inicial de los transcritos quiméricos humanos parásito se basó en el uso de técnicas de análisis de ARN, tales como PCR en tiempo real, la secuenciación del transcriptoma y EST captura de biblioteca, que incluía tanto totales y pequeños RNAs, en lugar de utilizar técnicas que sólo aislados pequeños RNAs. Aislamiento de RNA todos juntos en una piscina grande, en lugar de por separado, permitió la identificación de ambos translocados pequeños RNAs humanos en el parásito, así como la presencia de estas pequeñas secuencias de ARN como parte de una secuencia más grande. Esto entonces requiere un análisis del estado traducción de estos mRNAs de fusión para determinar las consecuencias funcionales de estas fusiones. Mientras que los grandes esfuerzos en la caracterización de un genoma del parásitod transcriptoma han añadido a la comprensión de la biología del parásito 22-25, mucho menos se sabe acerca de la regulación de la traducción del ARNm transcriptoma en todo el ciclo de vida de P. falciparum 26. Esta comprensión limitada del proteoma del parásito ha dificultado tanto la comprensión de la biología del parásito y la capacidad de identificar nuevos objetivos para la próxima generación de terapias contra la malaria. Esta brecha en la comprensión de la biología celular del parásito ha persistido en gran parte debido a la falta de técnicas adecuadas para investigar la regulación de traducción en P. falciparum. Un artículo reciente describe el uso de la huella ribosomal de P. falciparum para determinar el estado de la traducción mundial 21. Una medida bien establecida de potencial de traslación de las transcripciones es el número de ribosomas asociados determinados por polisomas perfilado. Sin embargo, cuando se aplica esta técnica para P. falciparum &lt;/ em&gt;, no es capaz de recuperar la mayoría de los polisomas y captura predominantemente monosomas. Recientemente, varios grupos han optimizado 27,28 P. técnicas polysome falciparum por lisis de los eritrocitos y parásitos simultáneamente para preservar los polisomas y caracterizar la ocupación ribosomal y el potencial de la traducción de estos parásitos de la malaria durante su desarrollo asexual en las células rojas de acogida 28. Colectivamente, estos métodos demuestran que la fusión observado de mRNAs miARN y parásitos humanos modula la traducción de proteínas del parásito de esos mRNAs de fusión, que se demostró utilizando métodos reportados previamente 27, y es un importante factor determinante de la resistencia a la malaria en HbAS y HbSS eritrocitos 17. Estos métodos podrían ser útiles en cualquier sistema en busca de identificar y funcionalmente explorar eventos de empalme de ARN, ya se trate de los ARN de fusión están a P. falciparum u otros sistemas eucariotas.

<table border="0" cellpadding="0" cellspacing="0" width="651">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:651px;">REAGENTS-All reagents must be RNAse-free.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Diethyl pyrocarbonate (DEPC; Sigma, cat. no. D5758)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC-treated water (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Yoyo-1 DNA fluorescent dye (Thermo Fisher)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gene Pulser II (or comparible) electroporator (Bio-Rad)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.2 cm Electroporation cuvettes</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4 M potassium acetate (Mallinckrodt, cat. no. 6700)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 M potassium HEPES (pH 7.2; Sigma, cat. no. H0527)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M magnesium acetate (Sigma, cat. no. M-2545)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M dithiothreitol (DTT; Research Products International, cat. no. D11000)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM phenylmethylsulfonate fluoride (PMSF; dissolved in isopropanol; Sigma, cat. no. P7626)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (v/v) Igepal CA-630 (Sigma-Aldrich, cat. no. I3021)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (w/v) sodium deoxycholate (DOC; Sigma, cat. no. D-6750)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Cycloheximide (CHX; Sigma, cat. no. C-7698)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose (Mallinckrodt, cat. no. 8360-04)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNAseOUT (Invitrogen, cat. no. 100000840)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RPMI-1640 w/ L-glutamine (Cellgro, cat. no. 10-040-CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% AlbuMAX I (w/v in sterile water) (Invitrogen, cat. no. 11020-039)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gentamicin (Gibco, cat. no. 15750-060))</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HT supplement (100x) (Invitrogen, cat. no. 11067030)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">45% (w/v) sucrose (Sigma, cat no. G8769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M HEPES buffer (Gibco, cat. no. 15630-080)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass slides (VWR, cat. no. 48311-702)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Giemsa stain (50X) (VWR, cat no. m708-01)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#39; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotin powder (Sigma-Aldrich)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1M Potassium Chloride</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin Sepharose High Performance Beads (GE Healthcare)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose cushion (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose chase solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA capture Wash Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Elution Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">REAGENT SETUP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">500 ml RPMI-1640 w/ L-glutamine</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 ml gentamicin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml HT supplement</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2.5 ml 45% glucose</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 ml 10% AlbuMAX I</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">12.5 ml 1 M HEPES</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sterile filter with 0.2 mm vacuum filter flask.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media containing 10x CHX</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as Plasmodium cell culture media above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 mM cycloheximide</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x PBS containing cycloheximide</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">400 mM potassium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 mM potassium HEPES, pH 7.2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15 mM magnesium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">200 mM cycloheximide (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM DTT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM PMSF (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40 U/ml RNaseOUT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% (v/v) Igepal CA-630</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% (w/v) DOC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose to make 15% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose to make 50% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose to make 0.5 M sucrose cushion</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">The 60% sucrose chase solution requires only sucrose and water, no other components</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Wash Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20mM&#160; KCl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5unit/ml Rnase Out (Invitrogen)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Elution Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as RNA Capture Wash Buffer, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2mM Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">EQUIPMENT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Ultra-ClearTM &#189; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polyallomer 9/16 x 3 &#189; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">L8-80M ultracentrifuge (Beckman)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Steel blunt syringe needle, 4 inch, 16G (Aldrich, cat. no. Z261378)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 ml syringe with 27G&#189; needle (Becton Dickinson, cat no. 309623)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml syringe (Becton Dickinson, cat. no. 309646)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Parafilm</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tube rotator, end-over-end</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microcentrifuge, refrigerated</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">TracerDAQ (Measurement Computing)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf 5810R centrifuge</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td>
		</tr>
	</tbody>
</table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

La variación genética responsable para el alelo de células falciformes (HbS) permite a los eritrocitos para resistir la infección por el parásito de la malaria, P. falciparum. La base molecular de esta resistencia, que se sabe que es multifactorial, sigue siendo incompleta entendido. Estudios recientes han encontrado que la expresión diferencial de microRNAs de eritrocitos, una vez trasladadas en parásitos de la malaria, afectan tanto a la regulación de genes y el crecimiento del parásito. Estos miRNAs se muestran más adelante para inhibir la traducción del ARNm mediante la formación de un transcrito de ARN quimérico a través de 5 &#39;de fusión de ARN con subconjuntos discretos de mRNAs de parásitos. Aquí, las técnicas que se utilizaron para estudiar el papel funcional y la posible existencia de mecanismo microRNAs eritrocitos subyacentes en la regulación de genes y el potencial de la traducción de P. falciparum, incluyendo la transfección de microRNAs sintéticos modificados en los eritrocitos de acogida, se detallará. Finalmente, un método de gradiente de polisomas se utiliza para determinar la extensión de translation de estas transcripciones. En conjunto, estas técnicas nos han permitido demostrar que los niveles de microARN dysregulated eritrocitos contribuyen a la resistencia a la malaria de células intrínseca de los eritrocitos falciformes.

Perfiles Global de microARN humano en P. falciparum Las técnicas presentadas aquí se utilizaron para extraer microRNAs de parásitos en una variedad de condiciones. Una cosa a destacar es que se realizaron extracciones de ARN para los glóbulos rojos no infectados como se indica en 32, que a menudo sirve como punto de referencia para los datos de microARN presentados tanto en este artículo y el estudio original 29. Esos estudios anteriores también demostrar...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Métodos para investigar el papel de Regulación de pequeños ARN ribosomal y ocupación de<em&gt; Plasmodium falciparum</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K vistas.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Video: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the disease, is characterised by an accumulation of Plasmodium falciparum infected red blood cells (iRBC) at pigmented trophozoite stage in the microvasculature of the brain2-4. This microvessel obstruction (sequestration) leads to acidosis, hypoxia and harmful inflammatory cytokines (reviewed in 5). Sequestration is also found in most microvascular tissues of the human body2, 3. The mechanism by which iRBC attach to the blood vessel walls is still poorly understood.
The immortalized Human Brain microvascular Endothelial Cell line (HBEC-5i) has been used as an in vitro model of the blood-brain barrier6. However, Plasmodium falciparum iRBC attach only poorly to HBEC-5i in vitro, unlike the dense sequestration that occurs in cerebral malaria cases. We therefore developed a panning assay to select (enrich) various P. falciparum strains for adhesion to HBEC-5i in order to obtain populations of high-binding parasites, more representative of what occurs in vivo.
A sample of a parasite culture (mixture of iRBC and uninfected RBC) at the pigmented trophozoite stage is washed and incubated on a layer of HBEC-5i grown on a Petri dish. After incubation, the dish is gently washed free from uRBC and unbound iRBC. Fresh uRBC are added to the few iRBC attached to HBEC-5i and incubated overnight. As schizont stage parasites burst, merozoites reinvade RBC and these ring stage parasites are harvested the following day. Parasites are cultured until enough material is obtained (typically 2 to 4 weeks) and a new round of selection can be performed. Depending on the P. falciparum strain, 4 to 7 rounds of selection are needed in order to get a population where most parasites bind to HBEC-5i. The binding phenotype is progressively lost after a few weeks, indicating a switch in variant surface antigen gene expression, thus regular selection on HBEC-5i is required to maintain the phenotype.
In summary, we developed a selection assay rendering P. falciparum parasites a more "cerebral malaria adhesive" phenotype. We were able to select 3 out of 4 P. falciparum strains on HBEC-5i. This assay has also successfully been used to select parasites for binding to human dermal and pulmonary endothelial cells. Importantly, this method can be used to select tissue-specific parasite populations in order to identify candidate parasite ligands for binding to brain endothelium. Moreover, this assay can be used to screen for putative anti-sequestration drugs7.

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

An in vitro model for cerebral malaria sequestration is described1. Plasmodium falciparum infected red blood cells are selected for binding to immortalized human brain microvascular endothelial cells. The selected parasites show a distinct phenotype. The selection process can be applied using various P. falciparum strains and endothelial cell lines.

Selección de Plasmodium falciparum Los parásitos de cytoadhesion a las células cerebrales endoteliales humanas

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the ...

Investigación

Inmunología e Infección

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Una introducción a las avispas parasitarias de<em&gt; Drosophila</em&gt; Y la respuesta inmune antiparasitario

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Two Methods of Heterokaryon Formation to Discover HCV Restriction Factors

Hepatitis C virus (HCV) is a hepatotropic virus with a host-range restricted to humans and chimpanzees. Although HCV RNA replication has been observed in human non-hepatic and murine cell lines, the efficiency was very low and required long-term selection procedures using HCV replicon constructs expressing dominant antibiotic-selectable markers1-5. HCV in vitro research is therefore limited to human hepatoma cell lines permissive for virus entry and completion of the viral life cycle. Due to HCVs narrow species tropism, there is no immunocompetent small animal model available that sustains the complete HCV replication cycle 6-8. Inefficient replication of HCV in non-human cells e.g. of mouse origin is likely due to lack of genetic incompatibility of essential host dependency factors and/or expression of restriction factors.
We investigated whether HCV propagation is suppressed by dominant restriction factors in either human cell lines derived from non-hepatic tissues or in mouse liver cell lines. To this end, we developed two independent conditional trans-complementation methods relying on somatic cell fusion. In both cases, completion of the viral replication cycle is only possible in the heterokaryons. Consequently, successful trans-complementation, which is determined by measuring de novo production of infectious viral progeny, indicates absence of dominant restrictions.
Specifically, subgenomic HCV replicons carrying a luciferase transgene were transfected into highly permissive human hepatoma cells (Huh-7.5 cells). Subsequently, these cells were co-cultured and fused to various human and murine cells expressing HCV structural proteins core, envelope 1 and 2 (E1, E2) and accessory proteins p7 and NS2. Provided that cell fusion was initiated by treatment with polyethylene-glycol (PEG), the culture released infectious viral particles which infected na&iuml;ve cells in a receptor-dependent fashion.
To assess the influence of dominant restrictions on the complete viral life cycle including cell entry, RNA translation, replication and virus assembly, we took advantage of a human liver cell line (Huh-7 Lunet N cells 9) which lacks endogenous expression of CD81, an essential entry factor of HCV. In the absence of ectopically expressed CD81, these cells are essentially refractory to HCV infection 10 . Importantly, when co-cultured and fused with cells that express human CD81 but lack at least another crucial cell entry factor (i.e. SR-BI, CLDN1, OCLN), only the resulting heterokaryons display the complete set of HCV entry factors requisite for infection. Therefore, to analyze if dominant restriction factors suppress completion of the HCV replication cycle, we fused Lunet N cells with various cells from human and mouse origin which fulfill the above mentioned criteria. When co-cultured cells were transfected with a highly fusogenic viral envelope protein mutant of the prototype foamy virus (PFV11) and subsequently challenged with infectious HCV particles (HCVcc), de novo production of infectious virus was observed. This indicates that HCV successfully completed its replication cycle in heterokaryons thus ruling out expression of dominant restriction factors in these cell lines. These novel conditional trans-complementation methods will be useful to screen a large panel of cell lines and primary cells for expression of HCV-specific dominant restriction factors.

We describe two methods for conditional trans-complementation of hepatitis C virus (HCV) assembly and the completion of the full viral life cycle, which rely on heterokaryon formation. These techniques are suitable to screen for cell lines that express dominant restriction factors, which preclude production of infectious HCV progeny.

Dos Métodos de Formación heterocarión para descubrir los factores de restricción del VHC

Hepatitis C virus (HCV) is a hepatotropic virus with a host-range restricted to humans and chimpanzees. Although HCV RNA replication has been observed in ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Un<em&gt; In vitro</em&gt; Co-infección modelo para estudiar<em&gt; Plasmodium falciparum</em&gt;-VIH-1 en las interacciones humano primario de monocitos derivados de las células inmunitarias

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully understood and several hypotheses have been put forward, including mechanical obstruction of microvessels by P. falciparum-parasitized red blood cells (pRBC). Indeed, during the intra-erythrocytic stage of its life cycle, P. falciparum has the unique ability to modify the surface of the infected erythrocyte by exporting surface antigens with varying adhesive properties onto the RBC membrane. This allows the sequestration of pRBC in multiple tissues and organs by adhesion to endothelial cells lining the microvasculature of post-capillary venules 1. By doing so, the mature forms of the parasite avoid splenic clearance of the deformed infected erythrocytes 2 and restrict their environment to a more favorable low oxygen pressure 3. As a consequence of this sequestration, it is only immature asexual parasites and gametocytes that can be detected in peripheral blood.
Cytoadherence and sequestration of mature pRBC to the numerous host receptors expressed on microvascular beds occurs in severe and uncomplicated disease. However, several lines of evidence suggest that only specific adhesive phenotypes are likely to be associated with severe pathological outcomes of malaria. One example of such specific host-parasite interactions has been demonstrated in vitro, where the ability of intercellular adhesion molecule-1 to support binding of pRBC with particular adhesive properties has been linked to development of cerebral malaria 4,5. The placenta has also been recognized as a site of preferential pRBC accumulation in malaria-infected pregnant women, with chondrotin sulphate A expressed on syncytiotrophoblasts that line the placental intervillous space as the main receptor 6. Rosetting of pRBC to uninfected erythrocytes via the complement receptor 1 (CD35)7,8 has also been associated with severe disease 9.
One of the most recently described P. falciparum cytoadherence phenotypes is the ability of the pRBC to form platelet-mediated clumps in vitro. The formation of such pRBC clumps requires CD36, a glycoprotein expressed on the surface of platelets. Another human receptor, gC1qR/HABP1/p32, expressed on diverse cell types including endothelial cells and platelets, has also been shown to facilitate pRBC adhesion on platelets to form clumps 10. Whether clumping occurs in vivo remains unclear, but it may account for the significant accumulation of platelets described in brain microvasculature of Malawian children who died from CM 11. In addition, the ability of clinical isolate cultures to clump in vitro was directly linked to the severity of disease in Malawian 12 and Mozambican patients 13, (although not in Malian 14).
With several aspects of the pRBC clumping phenotype poorly characterized, current studies on this subject have not followed a standardized procedure. This is an important issue because of the known high variability inherent in the assay 15. Here, we present a method for in vitro platelet-mediated clumping of P. falciparum with hopes that it will provide a platform for a consistent method for other groups and raise awareness of the limitations in investigating this phenotype in future studies. Being based in Malawi, we provide a protocol specifically designed for a limited resource setting, with the advantage that freshly collected clinical isolates can be examined for phenotype without need for cryopreservation.

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

This method investigates the platelet-mediated clumping phenotype of Plasmodium falciparum-infected erythrocytes (pRBC) in clinical isolates. This is performed by isolating and co-incubating platelet-rich plasma and a suspension of pRBC.

Un protocolo simple para el agrupamiento de plaquetas mediada por<em&gt; Plasmodium falciparum</emEritrocitos&gt; por el VIH en un recurso pobre ajuste

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully ...

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

We describe a method for isolation and characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. Infection of susceptible mouse-strains with this parasite strain results in the induction of experimental cerebral malaria, a neurologic syndrome that recapitulates certain important aspects of Plasmodium falciparum-mediated severe malaria in humans 1,2 . Mature forms of blood-stage malaria express parasitic proteins on the surface of the infected erythrocyte, which allows them to bind to vascular endothelial cells. This process induces obstructions in blood flow, resulting in hypoxia and haemorrhages 3 and also stimulates the recruitment of inflammatory leukocytes to the site of parasite sequestration.
Unlike other infections, i.e neutrotopic viruses4-6, both malaria-parasitized red blood cells (pRBC) as well as associated inflammatory leukocytes remain sequestered within blood vessels rather than infiltrating the brain parenchyma. Thus to avoid contamination of sequestered leukocytes with non-inflammatory circulating cells, extensive intracardial perfusion of infected-mice prior to organ extraction and tissue processing is required in this procedure to remove the blood compartment. After perfusion, brains are harvested and dissected in small pieces. The tissue structure is further disrupted by enzymatic treatment with Collagenase D and DNAse I. The resulting brain homogenate is then centrifuged on a Percoll gradient that allows separation of brain-sequestered leukocytes (BSL) from myelin and other tissue debris. Isolated cells are then washed, counted using a hemocytometer and stained with fluorescent antibodies for subsequent analysis by flow cytometry.
This procedure allows comprehensive phenotypic characterization of inflammatory leukocytes migrating to the brain in response to various stimuli, including stroke as well as viral or parasitic infections. The method also provides a useful tool for assessment of novel anti-inflammatory treatments in pre-clinical animal models.

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

A method for isolation of adherent inflammatory leukocytes from brain blood vessels of Plasmodium berghei ANKA-infected mice is described. The method allows quantification as well as phenotypic characterization of isolated leukocytes after staining with fluorescent antibodies and subsequent analysis by flow cytometry.

Aislamiento y análisis de Brain-secuestrados Los leucocitos de<em&gt; Plasmodium berghei</em&gt; ANKA de ratones infectados

We describe a method for isolation and  characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. ...

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the &asymp;40% limit, the investigator usually keeps the percentage at around 10%. In many cases it is necessary to isolate the parasite-containing red blood cells (RBCs) from the uninfected ones, to enrich the culture and proceed with a given experiment. 
When P. falciparum infects the erythrocyte, the parasite degrades and feeds from haemoglobin 2, 3. However, the parasite must deal with a very toxic iron-containing haem moiety 4, 5. The parasite eludes its toxicity by transforming the haem into an inert crystal polymer called haemozoin 6, 7. This iron-containing molecule is stored in its food vacuole and the metal in it has an oxidative state which differs from the one in haem 8. The ferric state of iron in the haemozoin confers on it a paramagnetic property absent in uninfected erythrocytes. As the invading parasite reaches maturity, the content of haemozoin also increases 9, which bestows even more paramagnetism on the latest stages of P. falciparum inside the erythrocyte.
Based on this paramagnetic property, the latest stages of P. falciparum infected-red blood cells can be separated by passing the culture through a column containing magnetic beads. These beads become magnetic when the columns containing them are placed on a magnet holder. Infected RBCs, due to their paramagnetism, will then be trapped inside the column, while the flow-through will contain, for the most part, uninfected erythrocytes and those containing early stages of the parasite.
Here, we describe the methodology to enrich the population of late stage parasites with magnetic columns, which maintains good parasite viability 10. After performing this procedure, the unattached culture can be returned to an incubator to allow the remaining parasites to continue growing.

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

The paramagnetic properties of hemozoin are used to isolate late stages of Plasmodium falciparum-infected red blood cells growing in culture. The method is simple and fast and does not affect the subsequent invasive capabilities of the parasites.

Separación de los<em&gt; Plasmodium falciparum</em&gt; Late Stage-eritrocitos infectados por medios magnéticos

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the ...

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of free merozoites from the blood by phagocytic cells. However assessing the functional efficacy of merozoite specific opsonizing antibodies is challenging due to the short half-life of merozoites and the variability of primary phagocytic cells. Described in detail herein is a method for generating viable merozoites using the E64 protease inhibitor, and an assay of merozoite opsonin-dependent phagocytosis using the pro-monocytic cell line THP-1. E64 prevents schizont rupture while allowing the development of merozoites which are released by filtration of treated schizonts. &#160;Ethidium bromide labelled merozoites are opsonized with human plasma samples and added to THP-1 cells. Phagocytosis is assessed by a standardized high throughput protocol. Viable merozoites are a valuable resource for assessing numerous aspects of P. falciparum biology, including assessment of immune function. Antibody levels measured by this assay are associated with clinical immunity to malaria in naturally exposed individuals. The assay may also be of use for assessing vaccine induced antibodies. &#160;

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Measuring antibody function is key to understanding immunity to Plasmodium falciparum malaria. This method describes the purification of viable merozoites, and measurement of opsonization-dependent phagocytosis by flow cytometry.

Alto Rendimiento Purificación de<em&gt; Plasmodium falciparum</em&gt; Los merozoitos Para uso en opsonizante Antibody Ensayos

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.

Desarrollo de derivados de células madre Las células T reguladoras específicas de antígeno contra la autoinmunidad

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic ...

Using Phylogenetic Analysis to Investigate Eukaryotic Gene Origin

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct a tree to show the evolutionary relationship among different taxa (classification units) at the molecular level. Phylogenetic analysis can also be used to investigate domain relationships within an individual taxon, particularly for organisms that have undergone substantial change in morphology and physiology, but for which researchers lack fossil evidence due to the organisms&#39; long evolutionary history or scarcity of fossilization.
In this text, a detailed protocol is described for using the phylogenetic method, including amino acid sequence alignment using Clustal Omega, and subsequent phylogenetic tree construction using both Maximum Likelihood (ML) of Molecular Evolutionary Genetics Analysis (MEGA) and Bayesian Inference via MrBayes. To investigate the origin of eukaryotic Sugars Will Eventually be Exported Transporters (SWEET) genes, 228 SWEETs including 35 SWEET proteins from unicellular eukaryotes and 57 SemiSWEET proteins from prokaryotes were analyzed. Interestingly, SemiSWEETs were found in prokaryotes, but SWEETs were found in eukaryotes. Two phylogenetic trees constructed using theoretically distinct methods have consistently&#160;suggested that the first eukaryotic SWEET gene might stem from the fusion of a bacterial SemiSWEET gene and an archaeal SemiSWEET gene.&#160;It is worth noting that one should be cautious to draw a conclusion based only on phylogenetic analysis, although it is useful to explain the underlying relationship between different taxa, which is difficult or even impossible to discern through experimental means.

A method of constructing a phylogenetic tree based on sequence homology of SWEETs from eukaryotes and SemiSWEETs from prokaryotes is described. Phylogenetic analysis is a useful tool for explaining the evolutionary relatedness between homologous proteins or genes from different organism groups.

Utilizando el análisis filogenético para investigar origen de genes eucariotas

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct ...