This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: Isolamento de RNAs de pequeno porte de P. falciparum Durante o IDC <ol><li> Obter parasitas da malária na cultura assexuada 29. NOTA: O tamanho cultura requerida irá variar de acordo com a aplicação desejada; No entanto, uma cultura de 10 ml em 3-5% de parasitemia e 5% de hematócrito fornece amplo para ARN-PCR em tempo real (RT-PCR). A técnica foi inicialmente otimizado para culturas assíncronas, mas quando são desejados momentos específicos durante o ciclo de infecção, os parasitas anel de carreira podem ser sincronizados pela sincronização sorbitol, o mais tardar 10-12 horas pós-invasão. Sincronização deve ser repetido após um ciclo (aproximadamente 48 horas) 29. </li><li> Piscina células infectadas em conjunto (5 x 10 ~ 9 GVs na parasitemia 3-5%) e PBS frio encher a parte superior do tubo e centrifugar a 800 xg durante 5 minutos, sem travão para sedimentar as células vermelhas. </li><li> Após centrifugação, o sobrenadante cuidadosamente remover usando uma pipeta de aspiração, ligadopara um vácuo, uma vez que o pellet eritrocítica é fácil de deslocar. Lava-se a pelete mais uma vez com PBS 1x frio. </li><li> Ressuspender o sedimento de células em 0,15% de saponina frio (em PBS 1x) e colocar em gelo durante 30 min. </li><li> Centrifugar as células a 1.500 xg durante 12 min a 4 ° C, remover o sobrenadante (que será vermelho escuro em cor) e ressuspender o pellet em PBS frio. Repita este passo mais uma vez. NOTA: De modo a assegurar que os microARNs presentes eram reflectora de microARNs dentro parasitas, e não contaminação eritrocítica, um número de condições de isolamento do parasita foram testados: 1) de saponina de lise, 2) saponina de lise combinada com tratamento com ARNase A de miARNs célula hospedeira e 3 ) metil-beta-ciclodextrina de tratamento para remover o parasita do eritrócito hospedeiro. Todos os tratamentos deu resultados semelhantes. </li><li> Lisar as parasita sedimento isolado usando as recomendadas 600 ul de tampão de lise. Este volume de tampão de lise é suficiente para culturas até ~ 30 ml em 2% de hematócrito e 5% de parasitemia. NOTA: Para as culturas de parasitas de maiores dimensões, este volume pode ser aumentado. É importante garantir uma lise completa do pelete parasita em vórtice completa durante pelo menos 1 min. Além disso, para facilitar a extracção, as amostras submetidas a lise pode ser transferida para um tubo de microcentrífuga de 1,7 ml. </li><li> Adicionar 60 ul, ou 1/10 do volume do tampão de lise usado no passo 6, de aditivo homogeneizado (acetato de sódio 2 M, pH 4). </li><li> Deixar as amostras em gelo durante 10 min. </li><li> Adicionar 600 ul, ou um volume igual ao volume de tampão de lise adicionado no passo 6, de choloroform fenol ácido para cada amostra e vortex durante 1 min. </li><li> Separaram-se as fases aquosa e orgânica por centrifugação das amostras a 10000 xg durante 5 min. Esta rotação é maior do que a sugerida pelo kit para garantir que toda a hemoglobina / hemozoína está na fase orgânica. </li><li> Recolhe-se o (aquosa) da camada superior e transferi-lo para um tubo fresco. Repetir os passos 9 e 10, se a fase aquosa é branca ou (mais provavelmente) de cor castanha, que sugere prócontaminação tein. </li><li> Determinar o volume do sobrenadante resultante por pipeta e, em seguida, adicionar 1,25 volumes de etanol a 100% (~ 800 mL) e misturar por inversão do tubo de microcentrífuga de 1,7 ml de 5 vezes. </li><li> Passar cada amostra através de um cartucho de filtro de ligação de ARN fornecida (vários diferente dos quais estão disponíveis comercialmente), quer por centrifugação a 14.000 xg durante 1 min, ou usando um colector de vácuo. </li><li> Lavar o cartucho de filtro com 700 ul de tampão de lavagem a miARN 1 usando uma microcentrífuga, girando a 14.000 xg durante 1 min. </li><li> Lavar o cartucho de filtro com 500 ul de tampão de lavagem 2/3 duas vezes por centrifugação a 14.000 xg durante 1 min cada. </li><li> Eluir com 100 ul de ARN DEPC-água, que foi pré-aquecido a 95 ° C, em duas lavagens de 50 mL, a centrifugação a 14000 xg durante 1 min cada. Medir a concentração de ARN através de absorvência de UV a 260 nm. NOTA: O gel de ARN (quer de acrilamida TBE-ureia ou gel desnaturante de formaldeído agarose a) pode be utilizada para avaliar a distribuição de tamanho dos ARN isolados. NOTA: Este RNA é adequado para análise por microarray, RNA-sequenciamento, norte blot e ensaio de protecção de ribonuclease. </li></ol> 2: Quantificação de RNAs de pequeno porte de P. falciparum Durante o IDC <ol><li> Determinar a concentração de amostras individuais isolados no passo 1, utilizando espectrofotometria de UV a 260 nm. </li><li> Gerar iniciadores de PCR em tempo real para as espécies de ARN desejado. Para miRNA sozinho, usamos premade ensaios miRNA qPCR, enquanto que para mRNAs ou fusão miRNA-RNAm nós projetamos primers para o verde SYBR. Para os ARN de fusão, o iniciador directo foi a própria sequência miARN (miR-451: AAACCGTTACCATTACTGAGTT), ao passo que o inverso era um iniciador específico do gene ~ 100 pb a jusante da miARN na sequência de ARNm (PKA-R: ATCGAACATGCTGTGAACAT). </li><li> Faça cDNA a partir das amostras de RNA usando um iniciador hairpin para miRNAs (20-40 ng de usar RNA) sozinho ou hexâmeros aleatórios para mRNA e / ou miRNAespécies de fusão -mRNA (usando 1 ug de ARN). Misture e iniciadores de ARN durante 5 minutos a 65 ° C, depois arrefece-se até à temperatura ambiente. Em seguida, adicionar mistura de transcriptase reversa (0,5 ul de transcriptase reversa, 0,5 ul de inibidor de RNase, 1 ul de dNTPs (2,5 mM cada), 4 pi de tampão 5x, 2 ul de DTT 0,1 M, 1 mL de H2O). <ol><li> Amostras executado em um termociclador capaz de detectar qualquer SYBR verde ou sondas TaqMan. SYBR Green PCR quantitativa em 30 para genes específicos foi executado como um 3-passo do PCR, 95 ° C durante 15 seg, menor temperatura de hibridação do iniciador de menos de 5 ° C durante 30 seg, e 68 ° C durante 30 s, durante 40 ciclos, utilizando um SYBR comercial master mix verde. miARN-PCR em tempo real foi executada como uma PCR de dois passos, 95 ° C durante 15 seg e 60 ° C durante 1 min, durante 40 ciclos. </li><li> Quantificar os ensaios utilizando o método ΔΔCt e normalizá-los contra qualquer Rab GTPase (PF08_0110) ou 18S rRNA 31. </li></ol></li></ol> 3: Introduçãodos Pequenos RNAs em Malária Parasitas <ol><li> Agregar a 300 ul de células vermelhas do sangue por transfecção (250 ul de hemácias, cerca de 1,5 x 10 9 células, em última análise, ser utilizado) em meio completo a malária por centrifugação a 800 xg durante 5 min a 1 freio. </li><li> Lavar os eritrócitos duas vezes com meio RPMI e ressuspender em cytomix completo (KCl 120 mM, 0,15 mM de CaCl2, 10 mM de K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM de HEPES, pH 7,6; EGTA a 2 mM, pH 7,6; 5 mM de MgCl2, pH ajustado com KOH) a 50% de hematócrito após a centrifugação a 800 xg durante 5 min a 1 freio. </li><li> Transferir as células para uma cuvete de electroporação 0,2 cm. </li><li> Adiciona-se 10 ug, ou quantidade apropriada, de oligonucleótidos sintéticos costume às cuvetes e ressuspender as culturas. </li><li> Ajustar o electroporador de 310 V / 950 uF e fornecer um impulso para cada cuvete. </li><li> Ressuspender as 300 ul de hemácias dentro da tina em pré-aquecido Mal completameios Aria e placa-los em placas de 24 poços e incuba-se a 37 ° C num recipiente estanque ao ar com uma mistura de gases no sangue malária (3% de O2, 5% de CO 2). </li><li> Após 4 horas, infectam os glóbulos vermelhos transfectadas com trofozoítos final sincronizado para uma parasitemia final, de cerca de 1%. </li><li> Adicionar hemácias recém-transfectadas cada 4-6 dias para culturas infectadas e determinar a parasitemia% por FACS usando YoYo-1 coloração, conforme indicado na secção 4. </li></ol> 4: Determinação da Erythrocyte microRNAs efeito sobre Parasite Taxa de Infecção <ol><li> Tome 100 ul de cultura ressuspenso por micropipeta e coloque em um tubo de 1,7 ml de microcentrífuga. Lavar duas vezes com 1 ml de PBS 1x e centrifugar numa microcentrífuga mesa por centrifugação a 800 xg durante 5 min. </li><li> Ressuspender o sedimento em 1 ml de glutaraldeído a 0,025%. Incubar as amostras durante 20 min à TA. NOTA: As amostras podem ser armazenadas aqui durante várias semanas a 4 ° C. Depois, sedimentar os infectados RBCs por centrifugação a 800 xg durante 5 min. Lavar duas vezes com 1 ml de PBS 1x. </li><li> Ressuspender o sedimento em 1 mL de 0,015% de saponina. Incubar a 4 ° C durante 15 min. Pellet infectados eritrócitos por centrifugação a 800 xg durante 5 min. Lavar duas vezes com 1 ml de PBS 1x. Repeat.4.3. Ressuspender as células em 1 ml de PBS 1x contendo 1 ul (1.000X) corante de ADN. </li><li> Determinar os graus de parasitemia num citómetro de fluxo, a 488 nm de excitação e 530 nm (FL-1) ~ emissão. </li><li> Em primeiro lugar, o portão citômetro de fluxo com base em FSC e SSC para se concentrar em hemácias. Em seguida, medir os graus de parasitemia (hemácias infectadas) no RBC fechado por fluorescência no canal FL-1. NOTA: depois parasitas estágio são 10X mais fluorescente de parasitas fase anterior, e ~ 100X acima hemácias não infectados. Além disso, a coleta em baixa velocidade tende a reduzir o ruído. Finalmente, esta abordagem tem sido comparada ao 3H-hipoxantina incorporação e Giemsa, tanto como relatado anteriormente 13, e todas as técnicas GAVum e resultados semelhantes. </li></ol> 5: Biotina-tagging e eluição de miRNA-RNAm Fusão produtos <ol><li> Directamente por ordem oligonucleótidos sintéticos costume de RNA com destiobiotina (DB) ligadas covalentemente à extremidade 5 &#39;. </li><li> Transfectar RBC infectados com destiobiotina-conjugado (DB) miARN e não modificado miARN (controlo negativo), como indicado no passo 3. </li><li> Infectar hemácias transfectadas com P. falciparum parasitas para uma parasitemia de partida de 0,5% (passo 1.1). </li><li> Extrair ARN parasita 4 dias (96 horas) mais tarde, como descrito acima no passo 1. </li><li> Incubar 10 ug de ARN parasita com 50 ul embalados esferas de estreptavidina, adicionada através de micropipeta, e girar sobre um rotador tubo de microcentrífuga durante 1 hora a 4 ° C. </li><li> Agregar as esferas a 800 xg durante 30 seg e lava-se com 20 mM de KCl e 1 / 1.000 de RNase inibidor. </li><li> Eluir ARN a partir das pérolas por competição com biotina 2 mM e tampão com 200 ul de RNA de captura de eluição (20 mM de KCl, 1/1, 000 Inibidor de RNase e 2 mM de biotina) a 4 ° C durante a noite com rotação. </li><li> Determinar o grau de enriquecimento de P. indicado transcrições falciparum utilizando SYBR Green qRT-PCR, e microARN enriquecimento (controlo positivo) por TaqMan qPCR como indicado no passo 2. </li></ol> 6: Separação polissoma determinar o Ribosomal Ocupação de P. falciparum <ol><li> Coloque solução de sacarose a 5 ml de 15% (400 mM de acetato de potássio, HEPES de potássio 25 mM, pH 7,2, acetato de magnésio 15 mM, 200 ^ M de ciclo-heximida, DTT 1 mM, PMSF 1 mM, 40 U / ml de RNase inibidor, e 15% de sacarose ) para um tubo de ultracentrífuga SW41 (14 x 89 mm). </li><li> Usando uma seringa de 5 ml, adicionar solução de sacarose a 5 ml de 50% (400 mM de acetato de potássio, HEPES de potássio 25 mM, pH 7,2, acetato de magnésio 15 mM, 200 ^ M de ciclo-heximida, DTT 1 mM, PMSF 1 mM, 40 U / ml de ARNase inibidor, e 50% de sacarose) debaixo da sacarose 15% utilizando uma agulha de aço longo, em seguida, remover a agulha. </li><li&gt; Selar o topo do tubo do gradiente com parafilme, inclinar o tubo lentamente sobre o seu lado, numa posição estável que impeça o rolamento, de modo que é deitado na horizontal sobre a superfície da mesa. Manter o tubo no seu lado, pelo menos, 2 h. Enquanto espera, comece com o passo 6.5. </li><li> Após 2 horas, incline lentamente o tubo de volta na posição vertical e transferir o tubo de gelo, permitindo-o esfriar por pelo menos 15 minutos antes da amostra de carregamento (passo 14). </li><li> Recolha de sangue infectado com Plasmodium suficiente cultura estágio para gerar 100-500 ug de RNA total, ou cerca de 100 ml de cultura assíncrona em 3-5% parasitemia. Adicionar 1/10 volume de que o meio de cultura contendo 10x (2 mM) de ciclo-heximida (CHX) e incubar a 37 ° C durante 10 min. <ol><li> Culturas por centrifugação a 500 xg durante 7 minutos com a centrifugadora (freio 1), lavar duas vezes com, em seguida, temperatura ambiente 1x PBS contendo 200 uM CHX. Volte a suspender as culturas de parasitas em 1x PBS contendo 200 mM CHX e armazenar no gelo. </li></ol></li&gt; <li> Estimar o volume do pelete de RBC. Adicionar tampão de lise (400 acetato de potássio mM, HEPES de potássio 25 mM, pH 7,2, acetato de magnésio 15 mM, 200 uM de CHX, DTT 1 mM, PMSF 1 mM, 40 U / ml de RNase Inhibitor, 1% (v / v) de IGEPAL CA -630, e 0,5% (w / v) DOC) à pelete de RBC a um volume final de 4,25 ml. Incubar o lisado a 4 ° C durante 10 min durante a rotação. </li><li> Transferir o lisado para tubos de microcentrífuga, e depois centrifugar as amostras numa microcentrífuga a 16000 xg e 4 ° C durante 10 min. </li><li> Prepare almofadas de sucrose por pipetagem de 1,25 ml de solução de almofada de sacarose a frio 0,5 M (400 mM de acetato de potássio, HEPES de potássio 25 mM, pH 7,2, acetato de magnésio 15 mM, 200 ^ M de ciclo-heximida, DTT 1 mM, PMSF 1 mM, 40 U / ml de ARNase inibidor, e sacarose 0,5 M) para um tubo de ultracentrífuga SW55 (13 x 51 mm). </li><li> Camada cuidadosamente 3,75 ml de sobrenadante lisado (a partir do passo 7) no topo da almofada de sacarose utilizando uma seringa e pequeno (~ 27) agulha de calibre. Store o lisado remanescente (~ 500 mL) a -80 ° C para extrair os níveis de ARN total, como indicado no ponto 1. </li><li> Coloque as amostras num rotor de ultracentrífuga, pré-refrigerada a 4 ° C, a qual pode conter tubos de 13,2 ml. Centrifugar as amostras a 366.000 xg e 4 ° C durante 146 min. </li><li> Usando uma pipeta, transferir o sobrenadante para um tubo cónico de 15 ml. Armazene o sobrenadante a -80 ° C para o isolamento de RNA livre (não ligada por ribossomos) RNAs. </li><li> Ressuspender o sedimento ribossoma em 500 ul de tampão de ressuspensão ribossoma (400 mM de acetato de potássio, HEPES de potássio 25 mM, pH 7,2, acetato de magnésio 15 mM, 200 ^ M de ciclo-heximida, DTT 1 mM, PMSF 1 mM, e 40 U / ml de RNase inibidor) pipetando durante 5 min. </li><li> Centrifugar as amostras numa microcentrífuga a 16000 xg e 4 &#160; ° C durante 10 min. </li><li> Mantendo o gradiente do passo 4 em gelo, remover o Parafilm, em seguida, a camada cuidadosamente a suspensão ribossoma no topo do gradiente using uma seringa e pequena (~ 27) agulha de calibre. </li><li> Carregar o tubo num rotor de ultracentrífuga pré-gelada e centrifugar os gradientes carregados em 200.000 xg e 4 ° C durante 180 min. Quando a rotação estiver concluída, loja centrifugado gradientes a 4 ° C até estar pronto para carregar no fraccionador. </li><li> Coloque um tubo de ultracentrífuga vazio no fraccionador do gradiente (este pode ser um tubo usado em uma execução anterior), depois lave com água RNase por 5 min a 100 x 10 velocidade. </li><li> Durante o passo de lavagem em 6,16, ajustar a sensibilidade do detector de absorvância no UV. Uma boa sensibilidade de partida é de 0,2, mas este pode ter de ser ajustado em mais tarde corre dependendo do sinal A 254 (que varia com base no número de parasitas, etc.). </li><li> Uma vez que a sensibilidade do detector é definido, defina o sinal de linha de base para zero, enquanto a água está fluindo através do detector. </li><li> Depois de se lavar o colector de fracções, inverter o fluxo de fluido até que as linhas estão vazios e, em seguida, REMove o tubo de ultracentrífuga vazio. </li><li> Executar solução de 60% de sacarose através do fraccionador até que ele sai do aparelho de agulha. </li><li> Insira o tubo que contém o primeiro gradiente na parte superior da câmara de carga e apertar o selo, tomando cuidado para não apertar demasiado. Em seguida, furar o fundo do tubo com a agulha. </li><li> Repor a velocidade de fluxo de fluido a 12,5 x 10 (controlada pelo botão de controlo de velocidade do fluxo na parte da frente da bomba), em seguida, definir o colector de fracções automático para recolher fracções de 18 seg (~ 330 ul / fracção) em tubos de microcentrífuga. </li><li> Comece a frente de fluxo da solução de sacarose a 60%. </li><li> Quando a primeira gota da solução gradiente cai para dentro do tubo de microcentrífuga, começará imediatamente tanto a recolha de fracções e gravação ao vivo do sinal A 254. </li><li> Uma vez que uma queda brusca é observada no sinal de A 254, que corresponde à interface entre as soluções de sacarose a 50% e 60%, parar o fluxo de fluido e uma 254 </sub&gt; gravação. </li><li> Armazenar as fracções de gradiente a -80 &#160; ° C para uso posterior. </li><li> Inverter o fluxo de fluido a 100 x 10 velocidade até que a solução de sacarose 60% esvazia para fora do tubo de ultracentrífuga. </li><li> Se houver gradientes adicionais para fracionar, remover o tubo de ultracentrífuga vazio da câmara de carga e reinicie a partir do passo 6.21. Se todas as amostras são completadas, lavar o aparelho como foi realizada em passos 6.16 e 6.19. </li></ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HbS é uma das variantes da hemoglobina mais comuns em áreas endêmicas de malária, em grande parte porque ele fornece proteção contra a malária grave causada por P. falciparum. As técnicas necessárias para caracterizar o papel do microRNA humana na regulação de genes de P. falciparum são detalhadas ao longo deste manuscrito. Ao extrair o RNA total de modo a incluir todos os pequenos RNAs, e através da realização de um procedimento de lise parasita relativamente simples, estes ARN...

A malária, causada por parasitas apicomplexan do gênero Plasmodium, é a doença parasitária humana mais comum, infectando mundialmente cerca de 200 milhões de pessoas por ano e causando cerca de 600.000 mortes 1. Dos cinco espécies de Plasmodium que infectam os humanos, o mais relevante para a doença humana são P. falciparum e P. vivax, devido às suas distribuições generalizadas e potencial para complicações graves de malária. O ciclo de vida do parasita da malária requer infecção de ambos os mosquitos e seres humanos. Quando um mosquito infectado pica um humano, os parasitas viajar através da corrente sanguínea para o fígado, onde uma rodada inicial de replicação ocorre. Depois merozoites ruptura do hepatócito hospedeiro, infectam os glóbulos vermelhos próximos, quer iniciar a replicação assexuada ou sexual. A fase assexuada de replicação, que dura 48 horas em P. falciparum, é o foco deste estudo, uma vez que é a fonte da maior parte malsintomas Aria e é facilmente recapitulou in vitro. Embora uma série de iniciativas de saúde pública, incluindo as terapias anti-malária melhoradas, ter um pouco reduzido o fardo do paludismo a nível mundial, o surgimento contínuo de parasitas resistentes aos medicamentos constitui um problema para os esforços de controle da malária. Uma área que pode sugerir novas abordagens terapêuticas é o estudo sobre como as várias variantes genéticas conferem resistência à malária. Em regiões endêmicas de malária, uma variedade de polimorfismos eritrocitários são bastante comuns 2,3. Estas mutações, com falciforme sendo talvez o mais importante, estão muitas vezes associados com substancial resistência ao aparecimento de infecção por malária sintomática 4. Os mecanismos subjacentes pelo qual eles causam eritrócitos para resistir à infecção da malária são completamente compreendidas. Eritrócitos parasitados com mutações da hemoglobina estão sujeitos a fagocitose aumentada através de uma maior rigidez celular e desidratação, queestá associada à diminuição invasão pelo P. falciparum 5. O alelo HbC também afecta a expressão da proteína na superfície do eritrócito e com a remodelação do citoesqueleto, inibindo a continuação do desenvolvimento do parasita 6,7. Finalmente, P. falciparum cresce pouco dentro de foice homozigoto (HbSS) 8,9 eritrócitos in vitro, sugerindo fatores eritrocitários intrínsecas de resistência da malária. No entanto, embora todos esses mecanismos parecem desempenhar um papel, eles não explicar completamente os mecanismos de resistência das células falciformes trás para a malária. Um conjunto de fatores eritrocitários potencial que continuam a ser mal compreendido é a grande piscina de miRNA presentes dentro de eritrócitos maduros. MicroRNAs são pequenos RNAs não-codificantes, 19-25 nt de tamanho, que medeiam a tradução e / ou estabilidade de mRNAs alvo por emparelhamento de bases dentro da UTR 3 &#39;. Eles têm sido implicados no controlo de respostas imunitárias de mamíferos, incluindo a supressão óf replicação do vírus 10, e foram exibidas para conferir resistência a vírus em plantas Eles também têm sido mostrados para regular vários processos, incluindo a eritropoiese eritrocitárias 11,12 e metabolismo do ferro 13. Estudos anteriores identificaram uma população abundante e diversificada de miRNAs eritrocitários, cuja expressão foi alterada drasticamente nos HbSS eritrócitos 14,15. Desde eritrócitos maduros falta de transcrição e tradução activo, o papel funcional destas miARNs eritrocitárias permanece obscura. Como material de troca significativa ocorre entre a célula hospedeira e P. falciparum durante o ciclo de desenvolvimento intraerythrocytic (IDC) 16, especulou-se que o perfil de miARN alterado dentro eritrócitos HbS podem contribuir directamente para a célula-resistência intrínseca a malária. Estes estudos culminaram no desenvolvimento de um gasoduto para isolar, identificar e funcionalmente estudar o papel de miARN humana dentro do mAlaria parasita, P. falciparum, que indicou que esses hospedeiros / miRNAs humanos em última análise, de forma covalente fusível e, em seguida, traducionalmente reprimir transcritos de ARNm parasita 17. Isto proporcionou um exemplo dos primeiros cruzada entre espécies transcritos quiméricos formados por trans-splicing e implica que esta fusão ARNm-miARN pode estar a ocorrer em outras espécies, incluindo outros parasitas. Todos os mRNAs de tripanossomas são trans-emendado com uma tala-líder (SL) para regular a separação de transcrições policistrónicos 18. Desde P. falciparum carece orthologs para Dicer / Ago 19,20, é possível que miRNAs eritrócitos seqüestrar máquinas SL semelhante em P. falciparum para integrar genes-alvo. Estudos recentes em P. falciparum têm, de facto, indica a presença de sequências líder 5 &#39;da tala 21. Este estudo detalha os métodos que levaram à descoberta de humanos-parasita miRNA-RNAm transcrições de fusão, incluindo tanto transcriptomic e translatécnicas de regulação adicionais. Os objetivos gerais destes métodos são a investigar os efeitos de pequenos RNAs na regulação gênica, fenótipos e tradução potencial de P. transcrições falciparum. A identificação inicial de transcritos quiméricos humano-parasita invocado a utilização de técnicas de análise de RNA, tais como PCR em tempo real, o seqüenciamento do transcriptoma e EST captura biblioteca, que incluía tanto totais e pequenos RNAs, em vez de usar as técnicas que só isoladas pequenos RNAs. Isolamento de ARN todos juntos em um tanque grande, em vez de separadamente, permitiu a identificação de ambos os pequenos RNAs humanos translocados do parasita, assim como a presença destas sequências de ARN pequenos, como parte de uma sequência maior. Este então necessária uma análise do estado tradução destes ARNms de fusão para determinar as consequências funcionais destas fusões. Enquanto esforços extensivos sobre a caracterização do genoma do parasita umad transcriptoma contribuíram para a compreensão da biologia do parasita 22-25, muito menos se sabe sobre a regulação da tradução do mRNA transcriptoma em todo o ciclo de vida de P. falciparum 26. Esta compreensão limitada do proteoma do parasita tem dificultado tanto a compreensão da biologia do parasita ea capacidade de identificar novos alvos para a próxima geração de terapias anti-malária. Esta lacuna na compreensão da biologia celular do parasita persiste em grande parte devido à falta de técnicas adequadas para investigar regulação traducional em P. falciparum. Um estudo recente descreveu o uso de pegada ribossomal de P. falciparum para determinar o status de tradução global 21. Uma medição bem estabelecido de potencial de translação dos transcritos corresponde ao número de ribossomas associados determinados pelo perfil polissoma. No entanto, quando esta técnica é aplicada a P. falciparum &lt;/ em&gt;, é incapaz de recuperar a maioria polissomos e captura predominantemente monosomes. Recentemente, vários grupos 27,28 otimizaram P. técnicas polissomas falciparum por lise do eritrócito e parasita simultaneamente para preservar os polissomos e caracterizar a ocupação ribossômica e potencial translacional desses parasitas da malária durante o seu desenvolvimento assexuado em hospedeiras células vermelhas 28. Coletivamente, esses métodos demonstram que a fusão observado de miRNA e parasitas mRNAs humanos modula a tradução da proteína do parasita desses mRNAs de fusão, que foi demonstrada utilizando métodos previamente relatados 27, e é um importante determinante da resistência da malária em HbAS e 17 HbSS eritrócitos. Estes métodos seriam úteis em qualquer sistema de procura para identificar e explorar funcionalmente eventos de splicing de ARN, ARN de fusão se estas estão dentro P. falciparum ou outros sistemas eucariotas.

<table border="0" cellpadding="0" cellspacing="0" width="651">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:651px;">REAGENTS-All reagents must be RNAse-free.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Diethyl pyrocarbonate (DEPC; Sigma, cat. no. D5758)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC-treated water (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Yoyo-1 DNA fluorescent dye (Thermo Fisher)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gene Pulser II (or comparible) electroporator (Bio-Rad)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.2 cm Electroporation cuvettes</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4 M potassium acetate (Mallinckrodt, cat. no. 6700)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 M potassium HEPES (pH 7.2; Sigma, cat. no. H0527)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M magnesium acetate (Sigma, cat. no. M-2545)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M dithiothreitol (DTT; Research Products International, cat. no. D11000)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM phenylmethylsulfonate fluoride (PMSF; dissolved in isopropanol; Sigma, cat. no. P7626)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (v/v) Igepal CA-630 (Sigma-Aldrich, cat. no. I3021)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (w/v) sodium deoxycholate (DOC; Sigma, cat. no. D-6750)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Cycloheximide (CHX; Sigma, cat. no. C-7698)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose (Mallinckrodt, cat. no. 8360-04)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNAseOUT (Invitrogen, cat. no. 100000840)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RPMI-1640 w/ L-glutamine (Cellgro, cat. no. 10-040-CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% AlbuMAX I (w/v in sterile water) (Invitrogen, cat. no. 11020-039)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gentamicin (Gibco, cat. no. 15750-060))</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HT supplement (100x) (Invitrogen, cat. no. 11067030)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">45% (w/v) sucrose (Sigma, cat no. G8769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M HEPES buffer (Gibco, cat. no. 15630-080)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass slides (VWR, cat. no. 48311-702)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Giemsa stain (50X) (VWR, cat no. m708-01)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#39; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotin powder (Sigma-Aldrich)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1M Potassium Chloride</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin Sepharose High Performance Beads (GE Healthcare)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose cushion (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose chase solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA capture Wash Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Elution Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">REAGENT SETUP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">500 ml RPMI-1640 w/ L-glutamine</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 ml gentamicin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml HT supplement</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2.5 ml 45% glucose</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 ml 10% AlbuMAX I</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">12.5 ml 1 M HEPES</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sterile filter with 0.2 mm vacuum filter flask.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media containing 10x CHX</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as Plasmodium cell culture media above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 mM cycloheximide</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x PBS containing cycloheximide</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">400 mM potassium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 mM potassium HEPES, pH 7.2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15 mM magnesium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">200 mM cycloheximide (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM DTT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM PMSF (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40 U/ml RNaseOUT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% (v/v) Igepal CA-630</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% (w/v) DOC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose to make 15% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose to make 50% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose to make 0.5 M sucrose cushion</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">The 60% sucrose chase solution requires only sucrose and water, no other components</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Wash Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20mM&#160; KCl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5unit/ml Rnase Out (Invitrogen)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Elution Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as RNA Capture Wash Buffer, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2mM Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">EQUIPMENT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Ultra-ClearTM &#189; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polyallomer 9/16 x 3 &#189; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">L8-80M ultracentrifuge (Beckman)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Steel blunt syringe needle, 4 inch, 16G (Aldrich, cat. no. Z261378)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 ml syringe with 27G&#189; needle (Becton Dickinson, cat no. 309623)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml syringe (Becton Dickinson, cat. no. 309646)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Parafilm</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tube rotator, end-over-end</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microcentrifuge, refrigerated</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">TracerDAQ (Measurement Computing)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf 5810R centrifuge</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td>
		</tr>
	</tbody>
</table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

A variação genética responsável pelo alelo falciforme (HbS) permite eritrócitos para resistir à infecção pelo parasita da malária, P. falciparum. A base molecular da resistência a este, que é conhecida por ser multifactorial, permanece incompletamente compreendida. Estudos recentes descobriram que a expressão diferencial de microRNAs de eritrócitos, uma vez translocados em parasitas da malária, afetar tanto a regulação gênica e crescimento do parasita. Estes miARNs foram posteriormente mostrados para inibir a tradução do ARNm através da formação de um transcrito de ARN quimérico através de 5 &#39;do RNA de fusão com subconjuntos discretos de mRNAs do parasita. Aqui, as técnicas que foram usadas para estudar o papel funcional e putativos mecanismo microRNAs eritrócitos subjacentes na regulação gênica e potencial translacional de P. falciparum, incluindo a transfecção de microRNAs sintéticos modificados em eritrócitos de acolhimento, serão detalhados. Por fim, um método de gradiente de polissoma é usado para determinar a extensão da TRAnslation destes transcritos. Juntas, essas técnicas nos permitiu demonstrar que os níveis desregulados de microRNAs eritrócitos contribuir para a célula-intrínseca resistência da malária dos eritrócitos falciformes.

Perfil global de microARN humana em P. falciparum As técnicas aqui apresentadas foram usadas para extrair microARNs de parasitas em uma variedade de condições. Uma coisa a notar é que extrações de RNA para glóbulos vermelhos não infectados foram realizados como indicado na 32, que muitas vezes serviu como um ponto de referência para os dados de microRNA apresentadas tanto este artigo e do estudo original 29. Esses estudos também demonstraram ...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Métodos para investigar o papel de Regulamentação dos Pequenos RNAs e Ribosomal Ocupação de<em&gt; Plasmodium falciparum</em

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

8.8K visualizações.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Vídeo: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the disease, is characterised by an accumulation of Plasmodium falciparum infected red blood cells (iRBC) at pigmented trophozoite stage in the microvasculature of the brain2-4. This microvessel obstruction (sequestration) leads to acidosis, hypoxia and harmful inflammatory cytokines (reviewed in 5). Sequestration is also found in most microvascular tissues of the human body2, 3. The mechanism by which iRBC attach to the blood vessel walls is still poorly understood.
The immortalized Human Brain microvascular Endothelial Cell line (HBEC-5i) has been used as an in vitro model of the blood-brain barrier6. However, Plasmodium falciparum iRBC attach only poorly to HBEC-5i in vitro, unlike the dense sequestration that occurs in cerebral malaria cases. We therefore developed a panning assay to select (enrich) various P. falciparum strains for adhesion to HBEC-5i in order to obtain populations of high-binding parasites, more representative of what occurs in vivo.
A sample of a parasite culture (mixture of iRBC and uninfected RBC) at the pigmented trophozoite stage is washed and incubated on a layer of HBEC-5i grown on a Petri dish. After incubation, the dish is gently washed free from uRBC and unbound iRBC. Fresh uRBC are added to the few iRBC attached to HBEC-5i and incubated overnight. As schizont stage parasites burst, merozoites reinvade RBC and these ring stage parasites are harvested the following day. Parasites are cultured until enough material is obtained (typically 2 to 4 weeks) and a new round of selection can be performed. Depending on the P. falciparum strain, 4 to 7 rounds of selection are needed in order to get a population where most parasites bind to HBEC-5i. The binding phenotype is progressively lost after a few weeks, indicating a switch in variant surface antigen gene expression, thus regular selection on HBEC-5i is required to maintain the phenotype.
In summary, we developed a selection assay rendering P. falciparum parasites a more "cerebral malaria adhesive" phenotype. We were able to select 3 out of 4 P. falciparum strains on HBEC-5i. This assay has also successfully been used to select parasites for binding to human dermal and pulmonary endothelial cells. Importantly, this method can be used to select tissue-specific parasite populations in order to identify candidate parasite ligands for binding to brain endothelium. Moreover, this assay can be used to screen for putative anti-sequestration drugs7.

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

An in vitro model for cerebral malaria sequestration is described1. Plasmodium falciparum infected red blood cells are selected for binding to immortalized human brain microvascular endothelial cells. The selected parasites show a distinct phenotype. The selection process can be applied using various P. falciparum strains and endothelial cell lines.

Seleção de Plasmodium falciparum Parasitas para Cytoadhesion para células do cérebro humano endotelial

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the ...

Imunologia e Infecção

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Uma Introdução à Vespas parasitas de<em&gt; Drosophila</em&gt; E Resposta Imune a antiparasitários

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Two Methods of Heterokaryon Formation to Discover HCV Restriction Factors

Hepatitis C virus (HCV) is a hepatotropic virus with a host-range restricted to humans and chimpanzees. Although HCV RNA replication has been observed in human non-hepatic and murine cell lines, the efficiency was very low and required long-term selection procedures using HCV replicon constructs expressing dominant antibiotic-selectable markers1-5. HCV in vitro research is therefore limited to human hepatoma cell lines permissive for virus entry and completion of the viral life cycle. Due to HCVs narrow species tropism, there is no immunocompetent small animal model available that sustains the complete HCV replication cycle 6-8. Inefficient replication of HCV in non-human cells e.g. of mouse origin is likely due to lack of genetic incompatibility of essential host dependency factors and/or expression of restriction factors.
We investigated whether HCV propagation is suppressed by dominant restriction factors in either human cell lines derived from non-hepatic tissues or in mouse liver cell lines. To this end, we developed two independent conditional trans-complementation methods relying on somatic cell fusion. In both cases, completion of the viral replication cycle is only possible in the heterokaryons. Consequently, successful trans-complementation, which is determined by measuring de novo production of infectious viral progeny, indicates absence of dominant restrictions.
Specifically, subgenomic HCV replicons carrying a luciferase transgene were transfected into highly permissive human hepatoma cells (Huh-7.5 cells). Subsequently, these cells were co-cultured and fused to various human and murine cells expressing HCV structural proteins core, envelope 1 and 2 (E1, E2) and accessory proteins p7 and NS2. Provided that cell fusion was initiated by treatment with polyethylene-glycol (PEG), the culture released infectious viral particles which infected na&iuml;ve cells in a receptor-dependent fashion.
To assess the influence of dominant restrictions on the complete viral life cycle including cell entry, RNA translation, replication and virus assembly, we took advantage of a human liver cell line (Huh-7 Lunet N cells 9) which lacks endogenous expression of CD81, an essential entry factor of HCV. In the absence of ectopically expressed CD81, these cells are essentially refractory to HCV infection 10 . Importantly, when co-cultured and fused with cells that express human CD81 but lack at least another crucial cell entry factor (i.e. SR-BI, CLDN1, OCLN), only the resulting heterokaryons display the complete set of HCV entry factors requisite for infection. Therefore, to analyze if dominant restriction factors suppress completion of the HCV replication cycle, we fused Lunet N cells with various cells from human and mouse origin which fulfill the above mentioned criteria. When co-cultured cells were transfected with a highly fusogenic viral envelope protein mutant of the prototype foamy virus (PFV11) and subsequently challenged with infectious HCV particles (HCVcc), de novo production of infectious virus was observed. This indicates that HCV successfully completed its replication cycle in heterokaryons thus ruling out expression of dominant restriction factors in these cell lines. These novel conditional trans-complementation methods will be useful to screen a large panel of cell lines and primary cells for expression of HCV-specific dominant restriction factors.

We describe two methods for conditional trans-complementation of hepatitis C virus (HCV) assembly and the completion of the full viral life cycle, which rely on heterokaryon formation. These techniques are suitable to screen for cell lines that express dominant restriction factors, which preclude production of infectious HCV progeny.

Dois métodos de formação de heterocários Descobrir Fatores de restrição HCV

Hepatitis C virus (HCV) is a hepatotropic virus with a host-range restricted to humans and chimpanzees. Although HCV RNA replication has been observed in ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Um<em&gt; In vitro</em&gt; Modelo de Co-infecção para Estudar<em&gt; Plasmodium falciparum</em&gt;-HIV-1 Interacções em monócitos humanos primários derivados de células imunes

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully understood and several hypotheses have been put forward, including mechanical obstruction of microvessels by P. falciparum-parasitized red blood cells (pRBC). Indeed, during the intra-erythrocytic stage of its life cycle, P. falciparum has the unique ability to modify the surface of the infected erythrocyte by exporting surface antigens with varying adhesive properties onto the RBC membrane. This allows the sequestration of pRBC in multiple tissues and organs by adhesion to endothelial cells lining the microvasculature of post-capillary venules 1. By doing so, the mature forms of the parasite avoid splenic clearance of the deformed infected erythrocytes 2 and restrict their environment to a more favorable low oxygen pressure 3. As a consequence of this sequestration, it is only immature asexual parasites and gametocytes that can be detected in peripheral blood.
Cytoadherence and sequestration of mature pRBC to the numerous host receptors expressed on microvascular beds occurs in severe and uncomplicated disease. However, several lines of evidence suggest that only specific adhesive phenotypes are likely to be associated with severe pathological outcomes of malaria. One example of such specific host-parasite interactions has been demonstrated in vitro, where the ability of intercellular adhesion molecule-1 to support binding of pRBC with particular adhesive properties has been linked to development of cerebral malaria 4,5. The placenta has also been recognized as a site of preferential pRBC accumulation in malaria-infected pregnant women, with chondrotin sulphate A expressed on syncytiotrophoblasts that line the placental intervillous space as the main receptor 6. Rosetting of pRBC to uninfected erythrocytes via the complement receptor 1 (CD35)7,8 has also been associated with severe disease 9.
One of the most recently described P. falciparum cytoadherence phenotypes is the ability of the pRBC to form platelet-mediated clumps in vitro. The formation of such pRBC clumps requires CD36, a glycoprotein expressed on the surface of platelets. Another human receptor, gC1qR/HABP1/p32, expressed on diverse cell types including endothelial cells and platelets, has also been shown to facilitate pRBC adhesion on platelets to form clumps 10. Whether clumping occurs in vivo remains unclear, but it may account for the significant accumulation of platelets described in brain microvasculature of Malawian children who died from CM 11. In addition, the ability of clinical isolate cultures to clump in vitro was directly linked to the severity of disease in Malawian 12 and Mozambican patients 13, (although not in Malian 14).
With several aspects of the pRBC clumping phenotype poorly characterized, current studies on this subject have not followed a standardized procedure. This is an important issue because of the known high variability inherent in the assay 15. Here, we present a method for in vitro platelet-mediated clumping of P. falciparum with hopes that it will provide a platform for a consistent method for other groups and raise awareness of the limitations in investigating this phenotype in future studies. Being based in Malawi, we provide a protocol specifically designed for a limited resource setting, with the advantage that freshly collected clinical isolates can be examined for phenotype without need for cryopreservation.

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

This method investigates the platelet-mediated clumping phenotype of Plasmodium falciparum-infected erythrocytes (pRBC) in clinical isolates. This is performed by isolating and co-incubating platelet-rich plasma and a suspension of pRBC.

Um protocolo simples para agregação plaquetária mediada por<em&gt; Plasmodium falciparum</emEritrócitos&gt; infectados em uma configuração com poucos recursos

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully ...

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

We describe a method for isolation and characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. Infection of susceptible mouse-strains with this parasite strain results in the induction of experimental cerebral malaria, a neurologic syndrome that recapitulates certain important aspects of Plasmodium falciparum-mediated severe malaria in humans 1,2 . Mature forms of blood-stage malaria express parasitic proteins on the surface of the infected erythrocyte, which allows them to bind to vascular endothelial cells. This process induces obstructions in blood flow, resulting in hypoxia and haemorrhages 3 and also stimulates the recruitment of inflammatory leukocytes to the site of parasite sequestration.
Unlike other infections, i.e neutrotopic viruses4-6, both malaria-parasitized red blood cells (pRBC) as well as associated inflammatory leukocytes remain sequestered within blood vessels rather than infiltrating the brain parenchyma. Thus to avoid contamination of sequestered leukocytes with non-inflammatory circulating cells, extensive intracardial perfusion of infected-mice prior to organ extraction and tissue processing is required in this procedure to remove the blood compartment. After perfusion, brains are harvested and dissected in small pieces. The tissue structure is further disrupted by enzymatic treatment with Collagenase D and DNAse I. The resulting brain homogenate is then centrifuged on a Percoll gradient that allows separation of brain-sequestered leukocytes (BSL) from myelin and other tissue debris. Isolated cells are then washed, counted using a hemocytometer and stained with fluorescent antibodies for subsequent analysis by flow cytometry.
This procedure allows comprehensive phenotypic characterization of inflammatory leukocytes migrating to the brain in response to various stimuli, including stroke as well as viral or parasitic infections. The method also provides a useful tool for assessment of novel anti-inflammatory treatments in pre-clinical animal models.

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

A method for isolation of adherent inflammatory leukocytes from brain blood vessels of Plasmodium berghei ANKA-infected mice is described. The method allows quantification as well as phenotypic characterization of isolated leukocytes after staining with fluorescent antibodies and subsequent analysis by flow cytometry.

Isolamento e Análise de Cérebro-sequestrados de Leucócitos<em&gt; Plasmodium berghei</em&gt; ANKA infectadas Mice

We describe a method for isolation and  characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. ...

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the &asymp;40% limit, the investigator usually keeps the percentage at around 10%. In many cases it is necessary to isolate the parasite-containing red blood cells (RBCs) from the uninfected ones, to enrich the culture and proceed with a given experiment. 
When P. falciparum infects the erythrocyte, the parasite degrades and feeds from haemoglobin 2, 3. However, the parasite must deal with a very toxic iron-containing haem moiety 4, 5. The parasite eludes its toxicity by transforming the haem into an inert crystal polymer called haemozoin 6, 7. This iron-containing molecule is stored in its food vacuole and the metal in it has an oxidative state which differs from the one in haem 8. The ferric state of iron in the haemozoin confers on it a paramagnetic property absent in uninfected erythrocytes. As the invading parasite reaches maturity, the content of haemozoin also increases 9, which bestows even more paramagnetism on the latest stages of P. falciparum inside the erythrocyte.
Based on this paramagnetic property, the latest stages of P. falciparum infected-red blood cells can be separated by passing the culture through a column containing magnetic beads. These beads become magnetic when the columns containing them are placed on a magnet holder. Infected RBCs, due to their paramagnetism, will then be trapped inside the column, while the flow-through will contain, for the most part, uninfected erythrocytes and those containing early stages of the parasite.
Here, we describe the methodology to enrich the population of late stage parasites with magnetic columns, which maintains good parasite viability 10. After performing this procedure, the unattached culture can be returned to an incubator to allow the remaining parasites to continue growing.

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

The paramagnetic properties of hemozoin are used to isolate late stages of Plasmodium falciparum-infected red blood cells growing in culture. The method is simple and fast and does not affect the subsequent invasive capabilities of the parasites.

Separação de<em&gt; Plasmodium falciparum</em&gt; Fase Tardia eritrócitos infectados por meio magnético

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the ...

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of free merozoites from the blood by phagocytic cells. However assessing the functional efficacy of merozoite specific opsonizing antibodies is challenging due to the short half-life of merozoites and the variability of primary phagocytic cells. Described in detail herein is a method for generating viable merozoites using the E64 protease inhibitor, and an assay of merozoite opsonin-dependent phagocytosis using the pro-monocytic cell line THP-1. E64 prevents schizont rupture while allowing the development of merozoites which are released by filtration of treated schizonts. &#160;Ethidium bromide labelled merozoites are opsonized with human plasma samples and added to THP-1 cells. Phagocytosis is assessed by a standardized high throughput protocol. Viable merozoites are a valuable resource for assessing numerous aspects of P. falciparum biology, including assessment of immune function. Antibody levels measured by this assay are associated with clinical immunity to malaria in naturally exposed individuals. The assay may also be of use for assessing vaccine induced antibodies. &#160;

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Measuring antibody function is key to understanding immunity to Plasmodium falciparum malaria. This method describes the purification of viable merozoites, and measurement of opsonization-dependent phagocytosis by flow cytometry.

High Yield purificação<em&gt; Plasmodium falciparum</em&gt; Merozoítos Para uso em opsonizantes Anticorpo Ensaios

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of ...

Using Phylogenetic Analysis to Investigate Eukaryotic Gene Origin

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct a tree to show the evolutionary relationship among different taxa (classification units) at the molecular level. Phylogenetic analysis can also be used to investigate domain relationships within an individual taxon, particularly for organisms that have undergone substantial change in morphology and physiology, but for which researchers lack fossil evidence due to the organisms&#39; long evolutionary history or scarcity of fossilization.
In this text, a detailed protocol is described for using the phylogenetic method, including amino acid sequence alignment using Clustal Omega, and subsequent phylogenetic tree construction using both Maximum Likelihood (ML) of Molecular Evolutionary Genetics Analysis (MEGA) and Bayesian Inference via MrBayes. To investigate the origin of eukaryotic Sugars Will Eventually be Exported Transporters (SWEET) genes, 228 SWEETs including 35 SWEET proteins from unicellular eukaryotes and 57 SemiSWEET proteins from prokaryotes were analyzed. Interestingly, SemiSWEETs were found in prokaryotes, but SWEETs were found in eukaryotes. Two phylogenetic trees constructed using theoretically distinct methods have consistently&#160;suggested that the first eukaryotic SWEET gene might stem from the fusion of a bacterial SemiSWEET gene and an archaeal SemiSWEET gene.&#160;It is worth noting that one should be cautious to draw a conclusion based only on phylogenetic analysis, although it is useful to explain the underlying relationship between different taxa, which is difficult or even impossible to discern through experimental means.

A method of constructing a phylogenetic tree based on sequence homology of SWEETs from eukaryotes and SemiSWEETs from prokaryotes is described. Phylogenetic analysis is a useful tool for explaining the evolutionary relatedness between homologous proteins or genes from different organism groups.

Usando a análise filogenética para investigar a origem de genes eucariontes

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct ...

Bone Marrow Transplantation Platform to Investigate the Role of Dendritic Cells in Graft-versus-Host Disease

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to eradicate tumors. However, its application is limited by the development of graft-versus-host disease (GVHD), a major complication of BMT. GVHD is evoked when T-cells in the donor grafts recognizealloantigen expressed by recipient cells and mount unwanted immunological attacks against recipient healthy tissues. Thus, traditional therapies are designed to suppress donor T-cell alloreactivity. However, these approaches substantially impair the GVL effect so that the recipient&#39;s survival is not improved. Understanding the effects of therapeutic approaches on BMT, GVL, and GVHD, is thus essential. Due to the antigen-presenting and cytokine-secreting capacities to stimulate donor T-cells, recipient dendritic cells (DCs) play a significant role in the induction of GVHD. Therefore, targeting recipient DCs becomes a potential approach for controlling GVHD. This work provides a description of a novel BMT platform to investigate how host DCs regulate GVH and GVL responses after transplantation. Also presented is an effective BMT model to study the biology of GVHD and GVL after transplantation.

Graft-versus-host disease is a major complication after allogeneic bone marrow transplantation. Dendritic cells play a critical role in the pathogenesis of graft-versus-host disease. The current article describes a novel bone marrow transplantation platform to investigate the role of dendritic cells in the development of graft-versus-host disease and the graft-versus-leukemia effect.

Plataforma de transplante de medula óssea para investigar o papel das células dendríticas na doença enxerto-versus-hospedeiro

Allogeneic bone marrow transplantation (BMT) is an effective therapy for hematological malignancies due to the graft-versus-leukemia (GVL) effect to ...