The authors thank the staff of the animal facility (BRC) for their ongoing support. This work was funded by the National Health and Medical Research Council and the Australian Research Council.

All procedures have been approved by the University of New South Wales Animals Care and Ethics Committee.
1. Preparation of the Transgene (Random Integration)
<ol>
	<li>Analytical agarose gel electrophoresis.
	<ol>
		<li>Digest the plasmid to excise the transgene using appropriate enzymes (1 h incubation) or fast-digest enzymes (15 to 30 min incubation) in a thermocycler following the manufacturer&#39;s recommendations (see Figure 2A and its legend).</li>
		<li>Cast a 1% tris-acetate-ethylenediaminetetraacetic acid (EDTA) (TEA) agarose gel, stained with 0.5-1.0 &#181;g/mL ethidium bromide (EtBr). 
		NOTE: Use caution when using EtBr; it is a potent mutagen. Please use appropriate personal protective equipment (refer to the material safety data sheet).</li>
		<li>Load a 1 kb molecular weight marker.</li>
		<li>Load the linearized fragments (i.e., transgene and backbone).</li>
		<li>Run the electrophoresis at 100 V for 45 min.</li>
		<li>Visualize the gel on an ultraviolet (UV) transilluminator to check that the digestion is complete and to confirm the correct size of the transgene (i.e., 7,338 bp; see Figure 2A).</li>
	</ol>
	</li>
	<li>Preparative agarose gel electrophoresis.
	<ol>
		<li>Cast a 1% TAE agarose gel stained with a low-toxicity gel stain. Load 8 aliquots (1 &#181;g each) of linearized transgene without a molecular weight marker and run the electrophoresis at 100 V for 45 min. Use a scalpel to excise all 8 bands corresponding to the linearized transgene.</li>
		<li>Extract the DNA using a gel extraction kit by following the manufacturer&#39;s recommendations (see the Table of Materials).
		<ol>
			<li>Melt the gel fragments at 50 &#176;C in 1.5-mL tubes for at least 15 min. Precipitate it with isopropanol and then add the binding buffer.</li>
			<li>Combine the entire DNA by pipetting it all into one column. Elute into nuclease-free microinjection buffer (8 mM Tris-HCl and 0.15 mM EDTA). Filter through a 0.22 &#181;m microcentrifuge filter and centrifuge for 60 s at 12,000 x g.</li>
		</ol>
		</li>
		<li>Measure the concentration and the quality of the DNA using a spectrophotometer. Check that the A260/A280 ratio is around 1.8 (i.e., no contamination by proteins) and the A260/A230 ratio is at least 2.0 (i.e., no contamination by organic solvents). Dilute down to 3 ng/&#181;L in nuclease-free microinjection buffer, aliquot (20-50 &#181;L), and freeze at -20 &#176;C.</li>
	</ol>
	</li>
</ol>
2. Synthesis of CRISPR Components (Gene Targeting)
<ol>
	<li>Cas9 mRNA.
	<ol>
		<li>Dilute the Cas9 mRNA (obtained from a commercial source, see the Table of Materials) to a concentration of 1 &#181;g/&#181;L in nuclease-free microinjection buffer.</li>
		<li>Aliquot in 2 &#181;L and freeze at -80 &#176;C.</li>
	</ol>
	</li>
	<li>Single-guide RNA (SgRNA).
	<ol>
		<li>Identify the desired two-target genomic sequences (guides) using a computational design tool allowing minimal potential off-target activity17.
		<ol>
			<li>For gene knockout, systematically select two guides located a few hundred base-pairs (bp) apart, in opposite directions, and include the start codon of the gene of interest. &#160;For homology direct repair, select two overlapping guides (whenever possible),&#160;in opposite directions. 
			NOTE: As an example, the following guides have recently been successfully co-injected to disrupt the first exon of the TPM4.2 gene: 
			Guide 1: 5&#39; CGCCATCCAGTTCGCGCTGC 3&#39;; 
			Guide 2: 5&#39; CAGAACGATTGAGCTATGGC 3&#39;</li>
		</ol>
		</li>
		<li>Order a set of primers as described in Table 1.</li>
		<li>Synthesize a linear DNA template.
		<ol>
			<li>Dilute px33012 plasmid to 10 ng/&#181;L in nuclease-free water.</li>
			<li>Prepare the master mix as indicated in Table 1. Add the polymerase at the end and keep the master mix on ice.</li>
			<li>Mix and split this into 8 PCR tubes (19 &#181;L/tube). Add 1 &#181;L of px330 per tube and run the PCR under the following conditions: 1 min at 98 &#176;C; 40 cycles of 98 &#176;C for 10 s, 64 &#176;C for 30 s, and 72 &#176;C for 15 s; and a final elongation at 72 &#176;C for 5 min. Hold at 4 &#176;C.</li>
			<li>Purify the PCR products using a PCR purification kit (see the Table of Materials), a manifold, and a vacuum source (for faster processing). Apply the maximum vacuum strength (i.e., 8 mbar).
			<ol>
				<li>Add 5 volumes (100 &#181;L) of binding buffer to 1 volume of the PCR sample and mix.</li>
				<li>Place a (provided) silica membrane spin column in a (provided) 2-mL collection tube for centrifugation, or on the manifold for vacuum processing. To bind DNA, successively apply all 8 samples to the column and vacuum or centrifuge for 60 s at 12,000 x g for each load.</li>
				<li>To wash, add 0.75 mL of wash buffer (buffer PE) to the column and vacuum or centrifuge for 60 s at 12,000 x g. Centrifuge the column for 60 s at 12,000 x g to eliminate residual ethanol.</li>
				<li>Place the column in a clean 1.5-mL microcentrifuge tube. To elute the DNA, add 30 &#181;L of nuclease-free water to the center of the membrane, let the column stand for 1 min, and centrifuge for 60 s at 12,000 g.</li>
			</ol>
			</li>
			<li>Measure the concentration using a spectrophotometer; typically, the concentration should be 100 ng/&#181;L or higher. Check that the A260/A280 ratio is around 1.8 (i.e., no contamination by proteins) and the A260/A230 ratio is at least 2.0 (i.e., no contamination by organic solvents).</li>
		</ol>
		</li>
		<li>In vitro transcription using a T7 RNA synthesis kit.
		<ol>
			<li>Prepare the master mix, as indicated in Table 1, and incubate for 3 h at 37 &#176;C in a thermocycler. Add 28 &#181;L of nuclease-free water and 2 &#181;L of DNase I and incubate for another 15 min at 37 &#176;C in a thermocycler.</li>
		</ol>
		</li>
		<li>RNA purification using spin columns.
		<ol>
			<li>Dissolve the powder contained in the provided spin column in 650 &#181;L of nuclease-free microinjection buffer, carefully removing all air bubbles. Cap the tube and hydrate for 5 - 15 min at room temperature.</li>
			<li>Remove the blue cap at the bottom and place the column in a 2-mL tube. Centrifuge for 2 min at 750 x g and room temperature. Place the column in a fresh 1.5-mL tube and apply 50 &#181;L of the RNA solution dropwise to the center, without touching the column wall. Spin the column for 2 min at 750 x g.</li>
			<li>Measure the RNA concentration using a spectrophotometer (the typical yield of one reaction is 30 - 50 &#181;g). Check that the A260/A280 ratio is around 2.0 (i.e., no contamination by proteins) and the A260/A230 ratio is at least 2.0 (i.e., no contamination by organic solvents). Store the sgRNAs at -80 &#176;C until use.</li>
			<li>Assess the quality of the RNA using the 1% TAE gels routinely used for DNA electrophoresis. Run 200-400 ng of the DNA template and the corresponding sgRNA in parallel. The RNA band (&#8776; 100 bp) should be slightly bigger than the DNA band (see Figure 3A).</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
3. Donor Template
<ol>
	<li>Order commercially synthesized single-stranded oligonucleotides (ssOligos, see the Table of Materials) for point mutations or for the integration of small sequences up to 50 bp; homology arms are typically 60-90 bp long.</li>
	<li>For larger insertions, use a donor plasmid as a template. Generate a suitable plasmid using either the classic cloning method or de novo synthesis from a commercial source. 
	NOTE: A minimum of 800 bp per homology arm is recommended. The size of the backbone has no influence on the efficiency of homology direct repair (HDR).</li>
</ol>
4. Injection Mix
<ol>
	<li>Dilute the Cas9 mRNA to 50 ng/&#181;L and the sgRNAs to 12.5 ng/&#181;L (25 ng/&#181;L in total) using nuclease-free microinjection buffer for gene knockout experiments. Add the donor template (ssOligo or plasmid) at a concentration of 200 ng/&#181;L for genome editing experiments based on homology direct repair. 
	NOTE: Dilution volumes can be easily determined using online tools, such as a resuspension calculator18.</li>
	<li>Keep each aliquot on ice during the microinjection session and discard afterwards (do not re-freeze the injection mix).</li>
</ol>
5. Scrotal Vasectomy
NOTE: Two types of vasectomy are commonly performed in mice: abdominal and scrotal. The latter is less invasive and has been previously described15.
<ol>
	<li>Autoclave all stainless steel surgical instruments.</li>
	<li>Determine the weight of the mouse using a weigh scale and anesthetize the males by intraperitoneal (i.p.) injection with injectable anesthetics (ketamine 100 mg/kg, xylazine 10 mg/kg).</li>
	<li>Monitor the loss of toe pinch reflex and once the mouse is sedated place it on top of a heating pad.</li>
	<li>Disinfect the skin around the testes with alternating wipes of a topical antiseptic such as chlorhexidine and 70% ethanol.</li>
	<li>Push the testes into the scrotal sac and make a skin incision with a scalpel.</li>
	<li>Visualize the testis, cauda epididymis, and vas deferens.</li>
	<li>Grab the vas deferens with forceps, hold it, and cauterize on each side of the forceps to remove 3 mm of the vas deferens.</li>
	<li>Perform the same procedure on the second testis.</li>
	<li>Close the skin incisions with wound clips and monitor the mouse closely until full recovery.</li>
</ol>
6. Superovulation (Oocytes Donors) and Time-mating (Pseudo-pregnant Females)
NOTE: The technique to generate a suitable number of fertilized oocytes and plugged foster females for reimplantation has been described elsewhere15.
<ol>
	<li>Inject 10 females i.p. with 5 IU of pregnant mare&#39;s serum gonadotropin (PMSG; in 100 &#181;L) at around 12 pm on day 1.</li>
	<li>Inject the females i.p. with 5 IU of human chorionic gonadotropin (hCG; in 100 &#181;L) 46-48 h later (at around 11 am on day 3).</li>
	<li>Immediately mate the females with single-housed males overnight.</li>
</ol>
7. Pronuclear (random-integration) and Cytoplasmic (Gene-targeting) Injections
<ol>
	<li>Cull the superovulated mice by cervical dislocation, expose the abdomen, and access the ovaries and oviducts, as previously described15. Dissect the oviducts and harvest the cumulus-oocyte-complexes (COCs) under a stereomicorscope15. Place them in a drop of potassium simplex optimization medium supplemented with amino acids (KSOMaa) following the traditional method15.</li>
	<li>Purify the oocytes by adding approximatively 1 &#181;L of hyaluronidase (10 mg/mL) to the drop of KSOMaa medium using an aspirator mouth piece and place the dish in a 37 &#176;C / 5% CO2 incubator for 30 s to 1 min.</li>
	<li>Wash the oocytes with 4 fresh drops of KSOMaa medium using the aspirator mouth piece and transfer them to a final drop of KSOMaa medium overlaid with mineral oil (around 2 mL). Place the dish in the 37 &#176;C / 5% CO2 incubator until the oocytes are ready for injection.</li>
	<li>Pronuclear injection (random integration).
	<ol>
		<li>Visualize the eggs under the stereoscopic microscope and transfer approximately 50 eggs to the injection chamber (a drop of M2 medium overlaid with mineral oil) using the aspirator mouth piece.</li>
		<li>Transfer the injection chamber to the inverted microscope and inject the fertilized oocytes (two visible pronuclei) with a few picoliters of the injection mix, targeting a pronucleus (any of the pronuclei can be targeted). Visualize a successful injection by observing the swelling of the pronucleus.</li>
	</ol>
	</li>
	<li>Cytoplasmic injection (gene targeting).
	<ol>
		<li>Transfer approximately 50 eggs to a drop of KSOMaa containing 5 &#181;g/mL Cytochalasin B using the mouth piece and incubate for 5 min in the 37 &#176;C / 5% CO2 incubator.</li>
		<li>Transfer the eggs to the injection chamber using the mouth piece.</li>
		<li>Inject few picoliters of the injection mix into the cytoplasm at very low pressure (50-100 hPa), using the compensation pressure of the automated microinjector where possible.</li>
		<li>After injection, transfer the oocytes back into a drop of KSOMaa (using the mouth piece) and keep them in the 37 &#176;C/5% CO2 incubator, until loaded for reimplantation into the oviduct of pseudo-pregnant females.</li>
	</ol>
	</li>
</ol>
8. Reimplantation
<ol>
	<li>Autoclave all stainless steel surgical instruments.</li>
	<li>Determine the weight of the mouse using the weigh scale and anesthetize the females by intraperitoneal (i.p.) injection with injectable anesthetics (ketamine 100 mg/kg, xylazine 10 mg/kg).</li>
	<li>Monitor the loss of toe pinch reflex and once the mouse is sedated place it on top of a heating pad.</li>
	<li>Clip a large area of the fur around the dorsal midline of the female mouse.</li>
	<li>Disinfect the exposed skin with alternating wipes of a topical antiseptic such as chlorhexidine and 70% ethanol.</li>
	<li>Expose the reproductive tract following traditional method15. Make a 1 cm long skin incision parallel to the dorsal midline, cut the muscle and grab the fat pad with a forceps, then gently pull the ovary out until its attached oviduct and uterus are clearly visible.</li>
	<li>Fix the fat pad with a vessel clamp. Visualize the oviduct under the stereoscopic microscope and using a pair of micro-scissors make an incision into the wall of the oviduct few millimeters upstream of the ampulla.</li>
	<li>Under the stereoscopic microscope, load 25 microinjected eggs into the glass capillary connected to the mouth piece (the internal diameter of the capillary should be around 120 &#181;m wide). Introduce the glass capillary into the oviduct and expel until an air bubble is visible inside the ampulla.</li>
	<li>Gently remove the glass capillary and place the reproductive tract back into the abdomen. Suture the incision with 3-0 non-absorbable surgical sutures, then close with wound clips. Monitor the mouse closely until full recovery.</li>
</ol>
9. Genotyping Strategies/Sequencing
NOTE: Isolate the genomic DNA from 2-mm tail or ear biopsies, following relevant animal ethics regulations.
<ol>
	<li>Fast genomic DNA extraction (random integration).
	<ol>
		<li>Lyse the tissue samples (~2 mm) at 95 &#176;C for 1 h in 100 &#181;L of alkaline lysis reagent (25 mM sodium hydroxide and 0.2 mM EDTA, pH = 12).</li>
		<li>Add 100 &#181;L of neutralizing reagent (40 mM Tris-HCl, pH = 5).</li>
		<li>Centrifuge for 5 min at 12,000 g and 4 &#176;C.</li>
	</ol>
	</li>
	<li>High-quality genomic DNA extraction (gene targeting).
	<ol>
		<li>Add 500 &#181;L of tail buffer (50 mM Tris, pH = 8; 100 mM EDTA, pH = 8; 100 mM NaCl; 1% SDS, and 0.5 mg/mL proteinase K, freshly added).</li>
		<li>Incubate overnight at 55 &#176;C.</li>
		<li>Mix for 5 min by inverting (do not vortex).</li>
		<li>Add 250 &#181;L of saturated NaCl (6 M) and mix for 5 min by inverting (do not vortex).</li>
		<li>Spin for 5-10 min at 12,000 x g and 4 &#176;C and pour the supernatant into new tube.</li>
		<li>Add 500 &#181;L of isopropanol and mix for 5 min by inverting (do not vortex).</li>
		<li>Spin for 10 min at 12,000 x g and room temperature.</li>
		<li>Decant the supernatant (the pellet is invisible and sticks to the tube).</li>
		<li>Wash with 1 mL of 70% ethanol.</li>
		<li>Spin for 5-10 min at 12,000 x g and room temperature. Remove the supernatant with care, as the white pellet is not sticky anymore and can be lost.</li>
		<li>Air dry this for ~1 h.</li>
		<li>Add 400 &#181;L of TE buffer (10 mM Tris and 1 mM EDTA, pH = 8).</li>
		<li>Dissolve the DNA at 55-60 &#176;C for 2 h.</li>
	</ol>
	</li>
	<li>Primer design.
	<ol>
		<li>Design primers a minimum of 20 bp long using a computational tool19. 
		NOTE: For random integration, the primers should hybridize with the transgene, generating a distinct fragment of 200-800 bp. For gene targeting, design the primers so that they hybridize with the genomic DNA, generating a distinct fragment a few hundred bp around the cut sites. For large insertions, the primers can sit on the transgene, but confirmation of the targeted integration should subsequently be performed using primer walking or a similar technique.</li>
	</ol>
	</li>
	<li>PCR genotyping.
	<ol>
		<li>For each genomic modification, design a new PCR protocol and test it empirically. Consider the length of the generated fragment and the melting temperature (Tm) of each pair of primers.</li>
	</ol>
	</li>
	<li>Sequencing.
	<ol>
		<li>For gene targeting, send PCR products to a Sanger sequencing service provider.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Ittner, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+function+of+tau+mediates+amyloid-beta+toxicity+in+Alzheimer's+disease+mouse+models.">Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models.</a> Cell. 142 (3), 387-397 (2010).</li><li>Ittner, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+phosphorylation+of+tau+inhibits+amyloid-beta+toxicity+in+Alzheimer's+mice.">Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice.</a> Science. 354 (6314), 904-908 (2016).</li><li>Marantz Henig, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Monk in the Garden. , (2000).</li><li>Jaenisch, R., Mintz, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simian+virus+40+DNA+sequences+in+DNA+of+healthy+adult+mice+derived+from+preimplantation+blastocysts+injected+with+viral+DNA.">Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA.</a> Proc Natl Acad Sci U S A. 71 (4), 1250-1254 (1974).</li><li>Gordon, J. W., Ruddle, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+and+stable+germ+line+transmission+of+genes+injected+into+mouse+pronuclei.">Integration and stable germ line transmission of genes injected into mouse pronuclei.</a> Science. 214 (4526), 1244-1246 (1981).</li><li>Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+mouse+embryos+by+microinjection+of+purified+DNA.">Genetic transformation of mouse embryos by microinjection of purified DNA.</a> Proc Natl Acad Sci U S A. 77 (12), 7380-7384 (1980).</li><li>Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Factors+affecting+the+efficiency+of+introducing+foreign+DNA+into+mice+by+microinjecting+eggs.">Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs.</a> Proc Natl Acad Sci U S A. 82 (13), 4438-4442 (1985).</li><li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat Rev Genet. 6 (6), 507-512 (2005).</li><li>Carbery, I. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186 (2), 451-459 (2010).</li><li>Sung, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat Biotechnol. 31 (1), 23-24 (2013).</li><li>Jinek, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Wang, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153 (4), 910-918 (2013).</li><li>Kang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introducing+precise+genetic+modifications+into+human+3PN+embryos+by+CRISPR/Cas-mediated+genome+editing.">Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing.</a> J Assist Reprod Genet. 33 (5), 581-588 (2016).</li><li>Liang, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-mediated+gene+editing+in+human+tripronuclear+zygotes.">CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes.</a> Protein Cell. 6 (5), 363-372 (2015).</li><li>Ittner, L. M., G&#246;tz, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pronuclear+injection+for+the+production+of+transgenic+mice.">Pronuclear injection for the production of transgenic mice.</a> Nat Protoc. 2 (5), 1206-1215 (2007).</li><li>Yang, H., Wang, H., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generating+genetically+modified+mice+using+CRISPR/Cas-mediated+genome+engineering.">Generating genetically modified mice using CRISPR/Cas-mediated genome engineering.</a> Nat Protoc. 9 (8), 1956-1968 (2014).</li><li>. Resuspension Calculator Available from: <a target="_blank" href="https://sg.idtdna.com/calc/resuspension/">https://sg.idtdna.com/calc/resuspension/</a> (2017)</li><li>Auerbach, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain-dependent+differences+in+the+efficiency+of+transgenic+mouse+production.">Strain-dependent differences in the efficiency of transgenic mouse production.</a> Transgenic Res. 12 (1), 59-69 (2003).</li><li>Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+aging+on+superovulation+efficiency,+aneuploidy+rates,+and+sister+chromatid+cohesion+in+mice+aged+up+to+15+months.">Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months.</a> Biol Reprod. 86 (2), 49 (2012).</li><li>Nakagawa, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-superovulation+for+the+CRISPR-Cas9-mediated+production+of+gene-knockout,+single-amino-acid-substituted,+and+floxed+mice.">Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice.</a> Biol Open. 5 (8), 1142-1148 (2016).</li><li>Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+estrous+cycle+identification+tool+and+images.">Mouse estrous cycle identification tool and images.</a> PLoS One. 7 (4), e35538 (2012).</li><li>Whitten, W. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+the+oestrous+cycle+of+the+mouse+by+external+stimuli+associated+with+the+male.">Modification of the oestrous cycle of the mouse by external stimuli associated with the male.</a> J Endocrinol. 13 (4), 399-404 (1956).</li><li>Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+procedure+for+genotyping+single+nucleotide+polymorphisms.">An efficient procedure for genotyping single nucleotide polymorphisms.</a> Nucleic Acids Res. 29 (17), E88 (2001).</li><li>Yoshimi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ssODN-mediated+knock-in+with+CRISPR-Cas+for+large+genomic+regions+in+zygotes.">ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes.</a> Nat Commun. 7, 10431 (2016).</li><li>Suzuki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome+editing+via+CRISPR/Cas9+mediated+homology-independent+targeted+integration.">In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration.</a> Nature. , (2016).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat Genet. 21, 70-71 (1999).</li><li>Liu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+targeted+mutation+at+the+known+collagenase+cleavage+site+in+mouse+type+I+collagen+impairs+tissue+remodeling.">A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling.</a> J Cell Biol. 130 (1), 227-237 (1995).</li><li>Ke, Y. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+suppression+of+A315T+mutant+human+TDP-43+expression+improves+functional+deficits+in+a+novel+inducible+transgenic+mouse+model+of+FTLD-TDP+and+ALS.">Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS.</a> Acta Neuropathol. 130 (5), 661-678 (2015).</li><li>Auerbach, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+functional+transgenic+mice+by+DNA+pronuclear+microinjection.">Production of functional transgenic mice by DNA pronuclear microinjection.</a> Acta Biochim Pol. 51 (1), 9-31 (2004).</li><li>Iyer, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Off-target+mutations+are+rare+in+Cas9-modified+mice.">Off-target mutations are rare in Cas9-modified mice.</a> Nat Methods. 12 (6), 479 (2015).</li><li>Zhou, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (7501), 487-491 (2014).</li><li>Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+of+globin+messenger+RNA+by+the+mouse+ovum.">Translation of globin messenger RNA by the mouse ovum.</a> Nature. 283 (5746), 499-501 (1980).</li><li>Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+transfer+into+mouse+ova+by+microinjection.">Mitochondria transfer into mouse ova by microinjection.</a> Transgenic Res. 6 (6), 379-383 (1997).</li><li>Biggers, J. D., Summers, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Choosing+a+culture+medium:+making+informed+choices.">Choosing a culture medium: making informed choices.</a> Fertil Steril. 90 (3), 473-483 (2008).</li><li>Nakagata, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryo+transfer+through+the+wall+of+the+fallopian+tube+in+mice.">Embryo transfer through the wall of the fallopian tube in mice.</a> Jikken Dobutsu. 41 (3), 387-388 (1992).</li><li>Truett, G. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+PCR-quality+mouse+genomic+DNA+with+hot+sodium+hydroxide+and+tris+(HotSHOT).">Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT).</a> Biotechniques. 29 (1), 52-54 (2000).</li><li>Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+homology-directed+genome+editing+by+catalytically+active+and+inactive+CRISPR-Cas9+using+asymmetric+donor+DNA.">Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA.</a> Nat Biotechnol. 34 (3), 339-344 (2016).</li><li>Delerue, F., Ittner, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+Editing+in+Mice+Using+CRISPR/Cas9:+Achievements+and+Prospects.">Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects.</a> Clon. Transgen. 4, (2015).</li></ol>

The authors provide academic transgenesis services in mice via the University of New South Wales Mark Wainwright Analytical Centre.

Critical steps within the protocol
The generation of genetically modified mice is known to be technically challenging. However, the protocol presented here is an optimized and simplified method that allows one to master and troubleshoot the technique in record time. There are two steps necessary for the successful completion of the technique. First, the synthesis of linear DNA templates (for the synthesis of sgRNAs) can be achieved without magnesium chloride (MgCl2). However, it is hig...

Animal models, both in vertebrates and invertebrates, have been instrumental to examining the pathophysiology of human conditions such as Alzheimer&#39;s disease1,2. They are also invaluable tools to search for disease modifiers and to ultimately develop novel treatment strategies in the hope of a cure. Although each model has intrinsic limitations, the use of animals as entire systemic models is vital to biomedical research. This is because the metabolic and complex physiological environment cannot be entirely simulated in tissue culture.
To date, the mouse remains the most common mammalian species used for genetic manipulation because it features several advantages. The physiological processes and genes associated with diseases are highly conserved between mice and humans. The mouse was the first mammal to have its full genome sequenced (2002), one year before the human genome (2003). Aside from this wealth of genetic information, the mouse has good breeding capacities, a fast development cycle (6 weeks from fertilization to weaning), and a reasonable size. All these advantages, coupled with physiological indicators, such as distinct coat colors (required for crossing strategies), made the mouse an attractive model for genetic manipulation. Notably, in the very early age of modern genetics, Gregor Mendel started working on mice before moving to plants3.
Gene transfer techniques resulted in the generation of the first transgenic mouse over three decades ago4, initially created using viral delivery. However, researchers soon realized that one of the main challenges of mouse transgenesis was the inability to control the fate of the exogenous DNA. Because the viral delivery of transgenes into mouse oocytes resulted in multiple copies integrated randomly into the genome, the possibility of establishing subsequent transgenic lines was limited.
One such limitation was overcome when Gordon et al. generated the first transgenic mouse line by microinjection5,6. This began the era of recombinant DNA technology, and the parameters influencing the outcome of a microinjection session have been widely studied7. Although microinjection does not allow for control over the integration site of the transgene (which eventually results in specific expression levels for each founder mouse), the main advantage of pronuclear microinjection remains the formation of concatemers (i.e., arrays of multiple copies of the transgene, linked in series) before genomic integration5. This characteristic has been used over the years to establish thousands of transgenic mouse lines that overexpress a gene of interest. Since then, transgenesis, the artificial modification of an organism&#39;s genome, has been extensively used to identify the role of single genes in the occurrence of diseases.
A further key achievement in manipulating the mouse genome was reached when Mario Capecchi successfully disrupted a single gene in the mouse, opening the era of gene targeting8. However, major drawbacks quickly emerged from ES cell-based gene targeting, including the challenges of culturing ES cells, the somewhat variable degree of chimerism, and the length of the process (i.e., 12-18 months, minimum, to obtain the mouse).
Recently, advances in new technologies, such as engineered endonucleases (e.g., zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and clustered regularly interspaced short palindromic repeats (CRISPR/Cas9)) have emerged as alternative methods to accelerate the process of gene targeting in mice9,10. These endonucleases can readily be injected into mouse oocytes by microinjection, allowing for the generation of gene-targeted mice in as little as 6 weeks.
Since the first report on the use of CRISPR for genome editing11, this bacterial adaptive immune system has superseded ZFN and TALEN because of its many advantages, including the ease of synthesis and the ability to target multiple loci at once (referred to as &#34;multiplexing&#34;). CRISPR was first used for gene targeting in mice12 and has since been applied to countless species, from plants to humans13,14. To date, there is no report of a single species resistant to CRISPR genome editing.
The two main limiting steps of the generation of transgenic mice are the injection of oocytes and the reimplantation of these oocytes into pseudo-pregnant females. Although this technique has been described by us15 and others16, recent technical improvements in mouse embryology and gene transfer techniques have revolutionized the process of generating genetically modified mice. These improvements will be described herein.

<table border="0" cellpadding="0" cellspacing="0" width="740">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Micropipette 0.1-2.5 ul</td>
			<td style="width:147px;">Eppendorf</td>
			<td style="width:119px;">4920000016</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Micropipette 2-20 ul</td>
			<td style="width:147px;">Eppendorf</td>
			<td>4920000040</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Micropipette 20-200 ul</td>
			<td style="width:147px;">Eppendorf</td>
			<td>4920000067</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Micropipette 100-1000 ul</td>
			<td style="width:147px;">Eppendorf</td>
			<td>4920000083</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Molecular weight marker&#160;</td>
			<td>Bioline</td>
			<td>BIO-33025</td>
			<td>HyperLadder 1kb</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Molecular weight marker&#160;</td>
			<td>Bioline</td>
			<td>BIO-33056</td>
			<td>HyperLadder 100 bp</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Agarose</td>
			<td>Bioline</td>
			<td>BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">EDTA buffer</td>
			<td>Sigma-Aldrich</td>
			<td>93296</td>
			<td>10x - Dilute to 1x</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">Ethidium bromide</td>
			<td style="width:147px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">15585011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SYBR Safe gel stain</td>
			<td>Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Gel extraction kit</td>
			<td style="width:147px;">Qiagen</td>
			<td style="width:119px;">28706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">PCR purification kit (Qiaquick)</td>
			<td style="width:147px;">Qiagen</td>
			<td style="width:119px;">28106</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Vacuum system (Manifold)</td>
			<td style="width:147px;">Promega</td>
			<td style="width:119px;">A7231</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nuclease-free microinjection buffer&#160;</td>
			<td>Millipore</td>
			<td>MR-095-10F</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultrafree-MC microcentrifuge filter&#160;</td>
			<td>Millipore</td>
			<td>UFC30GV00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Cas9 mRNA</td>
			<td style="width:147px;">Sigma-Aldrich</td>
			<td style="width:119px;">CAS9MRNA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">CRISPR expressing plasmid (px330)</td>
			<td style="width:147px;">Addgene</td>
			<td style="width:119px;">42230</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Nuclease free water</td>
			<td style="width:147px;">Sigma-Aldrich</td>
			<td>W4502</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Phusion polymerase</td>
			<td style="width:147px;">New England Biolabs</td>
			<td>M0530L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T7 Quick High Yield RNA kit</td>
			<td style="width:147px;">New England Biolabs</td>
			<td>E2050S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">RNA purification spin columns (NucAway)</td>
			<td style="width:147px;">Thermo Fisher Scientific</td>
			<td>AM10070</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">ssOligos</td>
			<td style="width:147px;">Sigma-Aldrich</td>
			<td>OLIGO STANDARD</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">Donor plasmid</td>
			<td style="width:147px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">GeneArt</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Hyaluronidase</td>
			<td style="width:147px;">Sigma-Aldrich</td>
			<td style="width:119px;">H3884</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">KSOMaa embryo culture medium</td>
			<td>Zenith Biotech&#160;</td>
			<td>ZEKS-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Mineral oil</td>
			<td>Zenith Biotech&#160;</td>
			<td>ZSCO-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">M2 Medium</td>
			<td style="width:147px;">Sigma-Aldrich</td>
			<td>M7167</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Cytochalasin B</td>
			<td style="width:147px;">Sigma-Aldrich</td>
			<td>C6762</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Mouthpiece</td>
			<td style="width:147px;">Sigma-Aldrich</td>
			<td style="width:119px;">A5177</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Glass microcapillaries</td>
			<td style="width:147px;">Sutter Instrument</td>
			<td style="width:119px;">BF100-78-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Proteinase K</td>
			<td>Applichem</td>
			<td>A3830.0100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Dumont #5 forceps</td>
			<td>Fine Science Tools&#160;</td>
			<td style="width:119px;">91150-20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Iris scissors</td>
			<td>Fine Science Tools&#160;</td>
			<td style="width:119px;">91460-11</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Vessel clamp</td>
			<td>Fine Science Tools&#160;</td>
			<td style="width:119px;">18374-43</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Wound clips&#160;</td>
			<td>Fine Science Tools&#160;</td>
			<td style="width:119px;">12040-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Clips applier&#160;</td>
			<td>Fine Science Tools&#160;</td>
			<td style="width:119px;">12018-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-scissors&#160;</td>
			<td>Fine Science Tools&#160;</td>
			<td>15000-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cauterizer</td>
			<td>Fine Science Tools&#160;</td>
			<td>18000-00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Non-absorbable surgical sutures (Ethilon 3-0)</td>
			<td>Ethicon</td>
			<td>1691H</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">5% CO2 incubator</td>
			<td style="width:147px;">MG Scientific</td>
			<td style="width:119px;">Galaxy 14S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">Spectrophotometer</td>
			<td style="width:147px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">Nanodrop 2000c</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Thermocycler</td>
			<td style="width:147px;">Eppendorf</td>
			<td style="width:119px;">6321 000.515</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Electrophoresis set up</td>
			<td style="width:147px;">BioRad</td>
			<td style="width:119px;">1640300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">UV Transilluminator</td>
			<td style="width:147px;">BioRad</td>
			<td style="width:119px;">1708110EDU</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Thermocycler</td>
			<td style="width:147px;">Eppendorf</td>
			<td>6334000069</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stereoscopic microscope</td>
			<td>Olympus</td>
			<td>SZX7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Inverted microscope</td>
			<td>Olympus</td>
			<td style="width:119px;">IX71</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">2x Micromanipulators</td>
			<td style="width:147px;">Eppendorf</td>
			<td style="width:119px;">5188000.012</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Oocytes manipulator</td>
			<td style="width:147px;">Eppendorf</td>
			<td style="width:119px;">5176000.025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:307px;">Microinjector (Femtojet)</td>
			<td style="width:147px;">Eppendorf</td>
			<td style="width:119px;">5247000.013</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:307px;">Mice C57BL/6J strain</td>
			<td style="width:147px;">Australian BioResources</td>
			<td>C57BL/6JAusb&#160;</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of genetically modified mice through the microinjection of oocytes

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear injection of DNA expression constructs into fertilized oocytes remains the most commonly used technique to generate transgenic mice for overexpression. With the introduction of CRISPR technology for gene targeting, pronuclear injection into fertilized oocytes has been extended to the generation of both knockout and knockin mice. This work describes the preparation of DNA for injection and the generation of CRISPR guides for gene targeting, with a particular emphasis on quality control. The genotyping procedures required for the identification of potential founders are critical. Innovative genotyping strategies that take advantage of the "multiplexing" capabilities of CRISPR are presented herein. Surgical procedures are also outlined. Together, the steps of the protocol will allow for the generation of genetically modified mice and for the subsequent establishment of mouse colonies for a plethora of research fields, including immunology, neuroscience, cancer, physiology, development, and others.

Below, the workflows for microinjection in the case of random integration and CRISPR-mediated gene targeting are described (Figure 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/55765/55765fig1v2.jpg" /> 
Figure 1: Typical Workflow for the Generation of Genetically Modified Mice. For random integration, the purified transgene is injected into the pronucleus of f...

Watch this Scientific Journal Video about Generation of Genetically Modified Mice through the Microinjection of Oocytes at JoVE.com

Generation of Genetically Modified Mice through the Microinjection of Oocytes

The microinjection of mouse oocytes is commonly used for both classic transgenesis (i.e., the random integration of transgenes) and CRISPR-mediated gene targeting. This protocol reviews the latest developments in microinjection, with a particular emphasis on quality control and genotyping strategies.

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear ...

generation-genetically-modified-mice-through-microinjection

Research

JoVE Journal

Developmental Biology

20.4K Views.  University of New South Wales. The microinjection of mouse oocytes is commonly used for both classic transgenesis (i.e., the random integration of transgenes) and CRISPR-mediated gene targeting. This protocol reviews the latest developments in microinjection, with a particular emphasis on quality control and genotyping strategies.

Video: Generation of Genetically Modified Mice through the Microinjection of Oocytes

Generation of Human Adipose Stem Cells through Dedifferentiation of Mature Adipocytes in Ceiling Cultures

Mature adipocytes have been shown to reverse their phenotype into fibroblast-like cells in vitro through a technique called ceiling culture. Mature adipocytes can also be isolated from fresh adipose tissue for depot-specific characterization of their function and metabolic properties. Here, we describe a well-established protocol to isolate mature adipocytes from adipose tissues using collagenase digestion, and subsequent steps to perform ceiling cultures. Briefly, adipose tissues are incubated in a Krebs-Ringer-Henseleit buffer containing collagenase to disrupt tissue matrix. Floating mature adipocytes are collected on the top surface of the buffer. Mature cells are plated in a T25-flask completely filled with media and incubated upside down for a week. An alternative 6-well plate culture approach allows the characterization of adipocytes undergoing dedifferentiation. Adipocyte morphology drastically changes over time of culture. Immunofluorescence can be easily performed on slides cultivated in 6-well plates as demonstrated by FABP4 immunofluorescence staining. FABP4 protein is present in mature adipocytes but down-regulated through dedifferentiation of fat cells. Mature adipocyte dedifferentiation may represent a new avenue for cell therapy and tissue engineering.

Mature adipocytes may represent an abundant source of stem cells through dedifferentiation, which leads to a homogenous population of fibroblast-like cells. Collagenase digestion is used to isolate mature adipocytes from human fat. The goal of our protocol is to obtain multipotent, dedifferentiated fat cells from human mature adipocytes.

Mature adipocytes have been shown to reverse their phenotype into fibroblast-like cells in vitro through a technique called ceiling culture. Mature ...

Generation of Genetically Modified Organotypic Skin Cultures Using Devitalized Human Dermis

Organotypic cultures allow the reconstitution of a 3D environment critical for cell-cell contact and cell-matrix interactions which mimics the function and physiology of their in vivo tissue counterparts. This is exemplified by organotypic skin cultures which faithfully recapitulates the epidermal differentiation and stratification program. Primary human epidermal keratinocytes are genetically manipulable through retroviruses where genes can be easily overexpressed or knocked down. These genetically modified keratinocytes can then be used to regenerate human epidermis in organotypic skin cultures providing a powerful model to study genetic pathways impacting epidermal growth, differentiation, and disease progression. The protocols presented here describe methods to prepare devitalized human dermis as well as to genetically manipulate primary human keratinocytes in order to generate organotypic skin cultures. Regenerated human skin can be used in downstream applications such as gene expression profiling, immunostaining, and chromatin immunoprecipitations followed by high throughput sequencing. Thus, generation of these genetically modified organotypic skin cultures will allow the determination of genes that are critical for maintaining skin homeostasis.

The goal of this paper is to provide a comprehensive and detailed protocol on how to generate genetically modified human organotypic skin from epidermal keratinocytes and devitalized human dermis.

Organotypic cultures allow the reconstitution of a 3D environment critical for cell-cell contact and cell-matrix interactions which mimics the function ...

Technique to Target Microinjection to the Developing Xenopus Kidney

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus embryos are large, develop externally, and can be easily manipulated by microinjection or surgical procedures. In addition, fate maps have been established for early Xenopus embryos. Targeted microinjection into the individual blastomere that will eventually give rise to an organ or tissue of interest can be used to selectively overexpress or knock down gene expression within this restricted region, decreasing secondary effects in the rest of the developing embryo. In this protocol, we describe how to utilize established Xenopus fate maps to target the developing Xenopus kidney (the pronephros), through microinjection into specific blastomere of 4- and 8-cell embryos. Injection of lineage tracers allows verification of the specific targeting of the injection. After embryos have developed to stage 38 - 40, whole-mount immunostaining is used to visualize pronephric development, and the contribution by targeted cells to the pronephros can be assessed. The same technique can be adapted to target other tissue types in addition to the pronephros.

Technique to Target Microinjection to the Developing Xenopus Kidney

Here, we present a protocol to use fate maps and lineage tracers to target injections into individual blastomeres that give rise to the kidney of Xenopus laevis embryos.

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus ...

Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily functions. Biomimetics is the imitation of the models, systems, and elements of nature for the purpose of solving complex human problems1. Skin biomimetics is a useful tool for in vitro disease research and in vivo regenerative medicine. Human induced pluripotent stem cells (iPSCs) have the characteristic of unlimited proliferation and the ability of differentiation to three germ layers. Human iPSCs are generated from various primary cells, such as blood cells, keratinocytes, fibroblasts, and more. Among them, cord blood mononuclear cells (CBMCs) have emerged as an alternative cell source from the perspective of allogeneic regenerative medicine. CBMCs are useful in regenerative medicine because human leukocyte antigen (HLA) typing is essential to the cell banking system. We provide a method for the differentiation of CBMC-iPSCs into keratinocytes and fibroblasts and for generation of a 3D skin organoid. CBMC-iPSC-derived keratinocytes and fibroblasts have characteristics similar to a primary cell line. The 3D skin organoids are generated by overlaying an epidermal layer onto a dermal layer. By transplanting this 3D skin organoid, a humanized mice model is generated. This study shows that a 3D human iPSC-derived skin organoid may be a novel, alternative tool for dermatologic research in vitro and in vivo.

We propose a protocol that shows how to differentiate induced pluripotent stem cell-derived keratinocytes and fibroblasts and generate a 3D skin organoid, using these keratinocytes and fibroblasts. This protocol contains an additional step of generating a humanized mice model. The technique presented here will improve dermatologic research.

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily ...

Generation of Organoids from Mouse Extrahepatic Bile Ducts

Cholangiopathies, which affect extrahepatic bile ducts (EHBDs), include biliary atresia, primary sclerosing cholangitis, and cholangiocarcinoma. They have no effective therapeutic options. Tools to study EHBD are very limited. Our purpose was to develop an organ-specific, versatile, adult stem cell-derived, preclinical cholangiocyte model that can be easily generated from wild type and genetically engineered mice. Thus, we report on the novel technique of developing an EHBD organoid (EHBDO) culture system from adult mouse EHBDs. The model is cost-efficient, able to be readily analyzed, and has multiple downstream applications. Specifically, we describe the methodology of mouse EHBD isolation and single cell dissociation, organoid culture initiation, propagation, and long-term maintenance and storage. This manuscript also describes EHBDO processing for immunohistochemistry, fluorescent microscopy, and mRNA abundance quantitation by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). This protocol has significant advantages in addition to producing EHBD-specific organoids. The use of a conditioned medium from L-WRN cells significantly reduces the cost of this model. The use of mouse EHBDs provides almost unlimited tissue for culture generation, unlike human tissue. Generated mouse EHBDOs contain a pure population of epithelial cells with markers of endodermal progenitor and differentiated biliary cells. Cultured organoids maintain homogenous morphology through multiple passages and can be recovered after a long-term storage period in liquid nitrogen. The model allows for the study of biliary progenitor cell proliferation, can be manipulated pharmacologically, and may be generated from genetically engineered mice. Future studies are needed to optimize culture conditions in order to increase plating efficiency, evaluate functional cell maturity, and direct cell differentiation. Development of co-culture models and a more biologically neutral extracellular matrix are also desirable.

This protocol describes the production of a mouse extrahepatic bile duct 3-dimensional organoid system. These biliary organoids can be maintained in culture to study cholangiocyte biology. Biliary organoids express markers of both progenitor and biliary cells and are composed of polarized epithelial cells.

Cholangiopathies, which affect extrahepatic bile ducts (EHBDs), include biliary atresia, primary sclerosing cholangitis, and cholangiocarcinoma. They have ...

Generation of a Human iPSC-Based Blood-Brain Barrier Chip

The blood brain barrier (BBB) is formed by neurovascular units (NVUs) that shield the central nervous system (CNS) from a range of factors found in the blood that can disrupt delicate brain function. As such, the BBB is a major obstacle to the delivery of therapeutics to the CNS. Accumulating evidence suggests that the BBB plays a key role in the onset and progression of neurological diseases. Thus, there is a tremendous need for a BBB model that can predict penetration of CNS-targeted drugs as well as elucidate the BBB&#39;s role in health and disease.
We have recently combined organ-on-chip and induced pluripotent stem cell (iPSC) technologies to generate a BBB chip fully personalized to humans. This novel platform displays cellular, molecular, and physiological properties that are suitable for the prediction of drug and molecule transport across the human BBB. Furthermore, using patient-specific BBB chips, we have generated models of neurological disease and demonstrated the potential for personalized predictive medicine applications. Provided here is a detailed protocol demonstrating how to generate iPSC-derived BBB chips, beginning with differentiation of iPSC-derived brain microvascular endothelial cells (iBMECs) and resulting in mixed neural cultures containing neural progenitors, differentiated neurons, and astrocytes. Also described is a procedure for seeding cells into the organ chip and culturing of the BBB chips under controlled laminar flow. Lastly, detailed descriptions of BBB chip analyses are provided, including paracellular permeability assays for assessing drug and molecule permeability as well as immunocytochemical methods for determining the composition of cell types within the chip.

The blood-brain barrier (BBB) is a multicellular neurovascular unit tightly regulating brain homeostasis. By combining human iPSCs and organ-on-chip technologies, we have generated a personalized BBB chip, suitable for disease modeling and CNS drug penetrability predictions. A detailed protocol is described for the generation and operation of the BBB chip.

The blood brain barrier (BBB) is formed by neurovascular units (NVUs) that shield the central nervous system (CNS) from a range of factors found in the ...

Minimum Volume Vitrification of Immature Feline Oocytes

In wild animals&#8217; conservation programs, gamete banking is crucial to safeguard genetic resources of valuable individuals and rare species and to promote biodiversity preservation. In felids, most species are threatened with extinction, and domestic breeds are used as a model to increase the efficiency of protocols for germplasm banking. Among oocyte cryopreservation techniques, vitrification is more and more popular in human and veterinary assisted reproduction. Cryotop vitrification, which was at first developed for human oocytes and embryos, has demonstrated to be well-suited for cat oocytes. This method offers several advantages, such as the feasibility in field conditions and the speed of the procedure, which can be helpful when several samples need to be processed. However, the efficiency is strongly dependent on the operator&#8217;s skills, and intra- and inter-laboratory standardization are needed, as well as personnel training. This protocol describes minimum volume vitrification of immature feline oocytes on a commercial support in a step by step field-friendly protocol, from oocyte collection to warming. Following the protocol, preservation of oocyte integrity and viability at warming (as high as 90%) can be expected, although there is still room for improvement in post-warming maturation and embryonic development outcomes.

This manuscript describes a protocol for the minimum volume vitrification of immature cat oocytes with laboratory-made media on commercial supports. It covers every step from oocyte isolation from ex vivo gonads to vitrification and warming.

In wild animals&#8217; conservation programs, gamete banking is crucial to safeguard genetic resources of valuable individuals and rare species and to ...

Separation of Follicular Cells and Oocytes in Ovarian Follicles of Zebrafish

Zebrafish has become an ideal model to study the ovarian development of vertebrates. The follicle is the basic unit of the ovary, which consists of oocytes and surrounding follicular cells. It is vital to separate both follicular cells and oocytes for various research purposes such as for primary culture of follicular cells, analysis of gene expression, oocyte maturation and in vitro fertilization, etc. The conventional method uses forceps to separate both compartments, which is laborious, time consuming and has high damage to the oocyte. Here, we have established a simple method to separate both compartments using a pulled glass capillary. Under a stereomicroscope, oocytes and follicular cells can be easily separated by pipetting in a pulled fine glass capillary (the diameter depends on the follicle diameter). Compared with the conventional method, this new method has high efficiency in separating both oocytes and follicular cells and has low damage to the oocytes. More importantly, this method can be applied to early-stage follicles including at the pre-vitellogenesis stage. Thus, this simple method can be used to separate follicular cells and oocytes of zebrafish.

Here, we present a simple method for separating follicular cells and oocytes in zebrafish ovarian follicles, which will facilitate investigations of ovarian development in zebrafish.

Zebrafish has become an ideal model to study the ovarian development of vertebrates. The follicle is the basic unit of the ovary, which consists of ...

Generation and Expansion of Human Cardiomyocytes from Patient Peripheral Blood Mononuclear Cells

Generating patient-specific cardiomyocytes from a single blood draw has attracted tremendous interest in precision medicine on cardiovascular disease. Cardiac differentiation from human induced pluripotent stem cells (iPSCs) is modulated by defined signaling pathways that are essential for embryonic heart development. Numerous cardiac differentiation methods on 2-D and 3-D platforms have been developed with various efficiencies and cardiomyocyte yield. This has puzzled investigators outside the field as the variety of these methods can be difficult to follow. Here we present a comprehensive protocol that elaborates robust generation and expansion of patient-specific cardiomyocytes from peripheral blood mononuclear cells (PBMCs). We first describe a high-efficiency iPSC reprogramming protocol from a patient&#39;s blood sample using non-integration Sendai virus vectors. We then detail a small molecule-mediated monolayer differentiation method that can robustly produce beating cardiomyocytes from most human iPSC lines. In addition, a scalable cardiomyocyte expansion protocol is introduced using a small molecule (CHIR99021) that could rapidly expand patient-derived cardiomyocytes for industrial- and clinical-grade applications. At the end, detailed protocols for molecular identification and electrophysiological characterization of these iPSC-CMs are depicted. We expect this protocol to be pragmatic for beginners with limited knowledge on cardiovascular development and stem cell biology.

Here, we present a protocol to robustly generate and expand human cardiomyocytes from patient peripheral blood mononuclear cells.

Generating patient-specific cardiomyocytes from a single blood draw has attracted tremendous interest in precision medicine on cardiovascular disease. ...

Zygote Microinjection for Creating Gene Cassette Knock-in and Flox Alleles in Mice

CRISPR-Cas technology has enabled the rapid and effortless generation of genetically modified mice. Specifically, mice and point mutant mice are readily produced by electroporation of CRISPR factors (and single-stranded oligo DNA donors) into the zygote. In contrast, gene cassette (&#62;1 kb) knock-in and floxed mice are mainly generated by microinjection of CRISPR factors and double-stranded DNA donors into zygotes. Genome editing technologies have also increased the flexibility of genetically modified mice production. It is now possible to introduce the intended mutations in the target genomic regions in a number of beneficial inbred mouse strains. Our team has produced over 200 gene cassette knock-in mouse lines, and over 110 floxed mouse lines by zygote microinjection of CRISPR-Cas9 following requests from several countries, including Japan. Some of these genome editing used BALB/c, C3H/HeJ, and C57BL/6N inbred strains, however most used C57BL/6J. Unlike the electroporation method, genome editing by zygote microinjection in various inbred strains of mice is not that easy. However, gene cassette knock-in and floxed mice on single inbred genetic backgrounds are as critical as genetic humanized, fluorescent reporter, and conditional knockout mouse models. Therefore, this article presents the protocol for the zygote microinjection of CRISPR factors and double-stranded DNA donors in C57BL/6J mice for generating gene cassette knock-in and floxed mice. This article exclusively focuses on nuclear injection rather than cytoplasmic injection. In addition to zygote microinjection, we outline the timeline for the production process and peripheral techniques such as induction of superovulation and embryo transfer.

The present protocol describes zygote microinjection of CRISPR-Cas9 and donor DNA to efficiently produce gene cassette knock-in and floxed mice.

CRISPR-Cas technology has enabled the rapid and effortless generation of genetically modified mice. Specifically, mice and point mutant mice are readily ...