Name: generation of genetically modified mice through the microinjection of oocytes
Uploaded: 2017-06-15T13:00:00.000+00:00
Duration: 10 min 19 s
Description: Watch this Scientific Journal Video about Generation of Genetically Modified Mice through the Microinjection of Oocytes at JoVE.com

저자들은 지속적인 지원을 위해 동물 시설 (BRC) 직원에게 감사를드립니다. 이 작품은 국가 건강 및 의학 연구 협의회 (National Health and Medical Research Council)와 호주 연구위원회 (Australian Research Council)의 지원을 받았다.

모든 절차는 뉴 사우스 웨일즈 동물 보호 및 윤리위원회의 승인을 받았습니다. 1. Transgene의 준비 (Random Integration) <ol><li> 분석 아가 로스 겔 전기 영동. <ol><li> 제조자의 권고 사항을 따르는 thermocycler에서 적절한 효소 (1 시간 배양) 또는 빠른 분해 효소 (15 ~ 30 분 배양)를 사용하여 도입 유전자를 제거하기 위해 플라스미드를 분해하십시오 ( 그림 2A 및 그 전설 참조). </li><li> 0.5 ~ 1.0 μg / ML ethidium bromide (EtBr)로 염색 한 1 % 트리스 - 아세테이트 - 에틸렌 디아민 테트라 아세트산 (EDTA) (TEA) 아가로 오스 겔을 주조합니다. 참고 : EtBr을 사용할 때는주의하십시오. 그것은 유력한 돌연변이 원입니다. 적절한 개인 보호 장비를 사용하십시오 (물질 안전 보건 자료 참조). </li><li> 1 kb 분자량 마커를로드하십시오. </li><li> 선형화 된 조각 ( 즉, 도입 유전자 및 백본)을로드하십시오. </li&gt; <li> 전기 영동을 100V에서 45 분 동안 실행합니다. </li><li> 자외선 (UV) 투과 조명기에서 젤을 시각화하여 소화가 완료되었는지 확인하고 트랜스 진 ( 즉, 7,338 bp, 그림 2A 참조 )의 정확한 크기를 확인하십시오. </li></ol></li><li> 준비 아가로 오스 겔 전기 영동. <ol><li> 저독성 젤 얼룩으로 염색 된 1 % TAE 아가 로즈 겔을 주조하십시오. 분자량 마커가없는 직선화 된 도입 유전자 8 개 (각 1 μg)를 넣고 45 분 동안 100 V에서 전기 영동하십시오. 선형화 된 도입 유전자에 해당하는 8 개의 모든 밴드를 제거하려면 메스를 사용하십시오. </li><li> 제조사의 권고 사항에 따라 젤 추출 키트를 사용하여 DNA를 추출합니다 ( 재료 표 참조). <ol><li> 적어도 15 분 동안 1.5 ML 튜브 50 ° C에서 겔 조각을 녹여. 이소프로판올로 침전시킨 다음 결합 버퍼를 첨가하십시오. </li><li> 전체 D 조 합치기모든 것을 하나의 컬럼으로 피펫 팅하여 NA. 뉴 클레아제가없는 마이크로 인젝션 완충액 (8 mM Tris-HCl 및 0.15 mM EDTA)으로 용출시킨다. 0.22 μm의 미세 원심 분리 필터를 거쳐 12,000 x g에서 60 초 동안 원심 분리하십시오. </li></ol></li><li> 분광 광도계를 사용하여 DNA의 농도와 품질을 측정하십시오. A260 / A280 비율이 1.8 ( 즉, 단백질에 의한 오염 없음)이고 A260 / A230 비율이 2.0 이상 ( 즉, 유기 용제에 의한 오염 없음)인지 점검하십시오. nuclease-free 마이크로 인젝션 버퍼, 분액 (20-50 μL)에서 3 ng / μL로 희석하고 -20 ° C에서 동결하십시오. </li></ol></li></ol> 2. CRISPR 성분의 합성 (유전자 표적화) <ol><li> Cas9 mRNA. <ol><li> nuclease-free 마이크로 인젝션 버퍼에 1 μg / μL의 농도로 Cas9 mRNA (상업용 소스에서 얻음, Table of Materials 참조)를 희석 하십시오. </li><li> 2 μL 및 무료로 나누어지는<html> -80 ° C에서하십시오. </li></ol></li><li> 단일 가이드 RNA (SgRNA). <ol><li> 최소한의 잠재적 인 목표 외 활동을 허용하는 컴퓨터 설계 도구를 사용하여 원하는 두 표적 게놈 서열 (지침)을 확인하십시오. <ol><li> 유전자 녹아웃의 경우, 반대 방향으로 수백 개의 염기쌍 (bp) 떨어져있는 두 개의 가이드를 체계적으로 선택하고 관심 유전자의 시작 코돈을 포함시킵니다. 상 동성 직접 수리의 경우, 가능한 한 두 개의 중첩 가이드를 반대 방향으로 선택하십시오. 참고 : 예를 들어, 다음 안내서는 최근 TPM4.2 유전자의 첫 번째 엑손을 파괴하기 위해 성공적으로 공동 주입되었습니다 : 가이드 1 : 5 &#39;CGCCATCCAGTTCGCGCTGC 3&#39;; 가이드 2 : 5 &#39;CAGAACGATTGAGCTATGGC 3&#39; </li></ol></li><li> 표 1 에 설명 된대로 프라이머 세트를 주문하십시오. </li><li> 선형 DNA 템플릿을 합성합니다. <ol><li> 희석 px330Nuclease-free water에서 10 ng / μL까지 플라스미드를 교체하십시오. </li><li> 표 1 에 표시된대로 마스터 믹스를 준비합니다. 마지막에 폴리머 라제를 첨가하고 마스터 믹스를 얼음에 보관하십시오. </li><li> 이를 8 개의 PCR 튜브 (19 μL / 튜브)로 나누고 나누십시오. 튜브당 px330 1 μL를 추가하고 다음 조건에서 PCR을 실행하십시오 : 98 ° C에서 1 분; 98 ℃에서 10 초, 64 ℃에서 30 초, 72 ℃에서 15 초의 40주기; 및 72 ℃에서 5 분 동안의 최종 신도. 4 ° C에서 유지. </li><li> PCR 정제 키트 (물질 표 참조), 다기관 및 진공 원 (빠른 처리를 위해)을 사용하여 PCR 생성물을 정제하십시오. 최대 진공 강도 ( 예 : 8 mbar)를가하십시오. <ol><li> PCR 샘플 1 볼륨에 결합 버퍼의 5 볼륨 (100 μL)을 추가하고 섞는다. </li><li> 원심 분리를 위해 2-mL 수집 튜브 (제공) 또는 진공 공정을위한 매니 폴드에 (제공 한) 실리카 멤브레인 스핀 컬럼을 놓습니다ing. DNA를 바인딩하려면 8 개의 시료를 모두 컬럼에 연속적으로 넣고 60 초 동안 진공 또는 12,000 xg로 원심 분리합니다. </li><li> 세척을 위해 0.75 mL의 세척 완충액 (완충액 PE)을 컬럼에 넣고 12,000 x g에서 60 초 동안 진공 또는 원심 분리한다. 잔류 에탄올을 제거하기 위해 12,000 xg에서 60 초 동안 컬럼을 원심 분리하십시오. </li><li> 컬럼을 깨끗한 1.5 mL 미세 원심 분리 튜브에 넣으십시오. DNA를 용리시키기 위해 멤브레인의 중심에 30 μl의 nuclease가없는 물을 넣고 컬럼을 1 분 동안 방치 한 다음 12,000 g에서 60 초 동안 원심 분리하십시오. </li></ol></li><li> 분광 광도계를 사용하여 농도를 측정하십시오. 일반적으로 농도는 100 ng / μL 이상이어야합니다. A260 / A280 비율이 1.8 ( 즉, 단백질에 의한 오염 없음)이고 A260 / A230 비율이 2.0 이상 ( 즉, 유기 용제에 의한 오염 없음)인지 점검하십시오. </li></ol></li><li> T7 RNA 합성 키트를 이용한 시험관 전사. <ol><li> 준비하기그는 표 1 에 표시된대로 마스터 믹스하고 thermocycler에서 37 ° C에서 3 시간 품어. nuclease-free 물 28 μL와 DNase I 2 μL를 넣고 37 ℃에서 15 분 더 incubate하십시오. </li></ol></li><li> 스핀 컬럼을 이용한 RNA 정제. <ol><li> 제공된 스핀 컬럼에 담긴 파우더를 nuclease-free microinjection buffer 650 μL에 녹여 모든 기포를 조심스럽게 제거합니다. 튜브에 뚜껑을 덮고 실온에서 5-15 분 동안 수화시킵니다. </li><li> 하단의 파란색 캡을 제거하고 컬럼을 2 mL 튜브에 넣으십시오. 750 XG 및 실온에서 2 분 동안 원심 분리기. 칼럼을 새로운 1.5-mL 튜브에 넣고 칼럼 벽을 건드리지 않고 50㎕의 RNA 용액을 가운데에 적가한다. 칼럼을 750 x g에서 2 분간 돌린다. </li><li> 분광 광도계를 사용하여 RNA 농도를 측정하십시오 (한 반응의 일반적인 수율은 30 - 50 μg입니다). A260 / A280 비율이2.0 ( 즉, 단백질에 의한 오염이 없음)이고 A260 / A230 비는 2.0 이상 ( 즉, 유기 용제에 의한 오염 없음)이다. 사용하기 전까지 -80 ° C에서 sgRNA를 보관하십시오. </li><li> DNA 전기 영동을 위해 일상적으로 사용되는 1 % TAE 젤을 사용하여 RNA의 품질을 평가하십시오. 200-400 ng의 DNA 주형과 해당 sgRNA를 동시에 실행하십시오. RNA 밴드 (≈ 100 bp)는 DNA 밴드보다 약간 커야합니다 ( 그림 3A 참조 ). </li></ol></li></ol></li></ol> 3. 기증자 템플릿 <ol><li> 점 돌연변이 또는 50bp 이하의 작은 서열의 통합을 위해 상업적으로 합성 된 1 본쇄 올리고 뉴클레오티드 (ssOligos, 표 2 참조)를 주문하십시오. 상 동성 암은 전형적으로 60-90 bp이다. </li><li> 더 큰 삽입을 위해, 기증자 플라스미드를 주형으로 사용하십시오. 고전적인 클로닝 방법을 사용하여 적절한 플라스미드를 생성하거나상업적 출처. 참고 : 상 동성 암당 최소 800 bp를 권장합니다. 백본의 크기는 상 동성 직접 수선 (HDR)의 효율성에 영향을 미치지 않습니다. </li></ol> 4. 사출 성형 <ol><li> 유전자 녹아웃 실험을 위해 nuclease-free microinjection buffer를 사용하여 Cas9 mRNA를 50 ng / μL로 희석하고 sgRNA를 12.5 ng / μL (총 25 ng / μL)로 희석한다. 상 동성 직접 수리를 기반으로 게놈 편집 실험 200 ng / μL의 농도에서 기증자 템플릿 (ssOligo 또는 플라스미드)를 추가합니다. 참고 : 희석액은 재 계산기 18 과 같은 온라인 도구를 사용하여 쉽게 결정할 수 있습니다. </li><li> microinjection 세션 동안 얼음에 각 나누어지는 유지하고 나중에 폐기 (주입 믹스를 다시 동결하지 마십시오). </li></ol> 5. 음낭 정관 절제술 참고 : 두 종류의 정관 수술은 일반적으로 생쥐에서 수행됩니다 : 복부 및 음낭. 후자의덜 침략적이며 이전에 설명되었습니다 15 . <ol><li> 모든 스테인레스 스틸 수술기구를 고압 증기 멸균하십시오. </li><li> 체중계를 사용하여 마우스의 무게를 결정하고 주사 마비 (케타민 100 MG / kg, xylazine 10 MG / kg)와 intraperitoneal (IP) 주사하여 남성을 마취. </li><li> 발가락 핀치 반사의 손실을 모니터하고 마우스가 진정되면 발열 패드 위에 올려 놓습니다. </li><li> 클로르헥시딘과 70 % 에탄올과 같은 국소 소독제를 번갈아 사용하여 고환 주위의 피부를 소독합니다. </li><li> 고환을 음낭 안으로 밀어 넣고 메스로 피부 절개를하십시오. </li><li> testis, cauda epididymis 및 vas deferens를 시각화하십시오. </li><li> 집게로 유리관을 잡고, 잡고, 집게의 3mm를 제거하기 위해 집게 양쪽을 소성합니다. </li><li> 두 번째 testis에 동일한 절차를 수행하십시오. </li><li> 상처 클립으로 피부 절개 부를 닫고완전히 회복 될 때까지 마우스를 가까이서 누릅니다. </li></ol> 6. Superovulation (난자 기증자)과 Time-mating (의사 임신 한 여성) 주 : 적절한 수의 수정 된 난 모세포를 생성하고 재 이식을 위해 위탁 암컷을 막는 기술은 다른 곳에서 기술되어있다. <ol><li> 1 일 12 시경 약 5 IU의 임산부의 혈청 생식샘 자극 호르몬 (PMSG; 100 μL)을 10 명의 여성에게 투여한다. </li><li> 46 ~ 48 시간 후 (3 일 오전 11 시경) 5 IU의 인간 chorionic 성선 자극 호르몬 (hCG, 100 μL)을 투여합니다. </li><li> 하룻밤 사이에 한 마리의 수컷 남성과 암컷을 즉시 교배하십시오. </li></ol> 7. 전핵 (무작위 통합)과 세포질 (유전자 타겟팅) 주사 <ol><li> 이전에 설명한 바와 같이, 자궁 경부 탈구로 과식 배란 된 마우스를 뽑아 내고, 복부를 노출시키고, 난소와 난관에 접근하십시오. 오해입체 시야 (stereomicorscope)하에 적운 - 난 모세포 복합체 (cumulus-oocyte-complexes, COCs)를 수확합니다. 전통적인 방법 15에 따라 아미노산 (KSOMaa)가 보충 된 칼륨 심플 렉스 최적화 배지 1 방울에 넣으십시오. </li><li> 흡인기 입 조각을 사용하여 KSOMaa 매체의 방울에 hyaluronidase (10 밀리그램 / ML)의 approximally 1μL를 추가하여 oocytes을 정화하고 1 분에 30 초 동안 37 ° C / 5 % CO 2 배양기에 접시를 놓습니다. </li><li> 흡인기 마우스 조각을 사용하여 KSOMaa 매체 4 신선한 방울과 Oocytes을 씻어 KSOMaa 매체의 최종 드롭에 전송 미네랄 오일 (약 2 ML)와 중첩. oocytes가 주사 준비가 될 때까지 37 ° C / 5 % CO 2 배양기에 접시를 놓습니다. </li><li> 원핵 주입 (무작위 통합). <ol><li> 입체 현미경으로 알을 시각화하고 약 50 개의 알을 주입 챔버 (droM 배지에 미네랄 오일을 중층 한 것). </li><li> 사출 챔버를 거꾸로 현미경으로 옮기고 수정 핵 세포 (두 개의 보이는 전핵)에 주사 핵산을 타겟팅하는 몇 가지 피코 리터를 주입합니다 (전핵의 표적이 될 수 있음). 전핵의 부종을 관찰하여 성공적인 주사를 시각화하십시오. </li></ol></li><li> 세포질 주사 (유전자 표적화). <ol><li> 마우스 조각을 사용하여 5 μg / ML Cytochalasin B를 포함 KSOMaa의 방울로 약 50 계란을 전송하고 37에서 5 분 동안 품어 ° C / 5 % CO 2 배양기. </li><li> 마우스 피스를 사용하여 주입 챔버에 알을 옮긴다. </li><li> 가능한 경우 자동 마이크로 인젝터의 보정 압력을 사용하여 매우 낮은 압력 (50-100 hPa)에서 세포질에 주사 믹스를 몇 피코 리터 주입하십시오. </li><li> 주사 후, 난 모세포를 한 방울의 KSOMaa (마우스 피스를 사용)를 37 ° C / 5 % CO 2 인큐베이터에 보관하여 의사 임신 여성의 난관으로 재 주입합니다. </li></ol></li></ol> 8. 이식 <ol><li> 모든 스테인레스 스틸 수술기구를 고압 증기 멸균하십시오. </li><li> 체중계를 사용하여 마우스의 무게를 결정하고 주 사용 마취제 (ketamine 100 MG / kg, xylazine 10 MG / kg)와 intraperitoneal (IP) 주사하여 여성을 마취. </li><li> 발가락 핀치 반사의 손실을 모니터하고 마우스가 진정되면 발열 패드 위에 올려 놓습니다. </li><li> 여성 마우스의 지느러미 중간 선 주위에 모피의 넓은 부분을 자르십시오. </li><li> 클로르헥시딘 (chlorhexidine)과 70 % 에탄올 (ethanol)과 같은 국소 소독제를 번갈아 사용하여 노출 된 피부를 소독하십시오. </li><li> 전통적인 방법 15에 따라 생식 기관을 드러내십시오. 지느러미 정중선과 평행 한 1cm 길이의 피부 절개를 만들고 근육을 자르고 지방 패드를 잡습니다.th 포셉, 그럼 부드럽게 첨부 난관과 자궁이 명확하게 볼 때까지 난소를 꺼내. </li><li> 지방 패드를 혈관 클램프로 고정하십시오. 입체 현미경으로 난관을 시각화하고 한 쌍의 마이크로 가위를 사용하여 관의 몇 밀리미터 상류에있는 난관의 벽을 절개합니다. </li><li> 입체 현미경으로 마우스 피스에 연결된 유리 모세관에 25 개의 미세 주입 된 계란을 넣습니다 (모세 혈관의 내경은 약 120 μm 여야합니다). oviduct에 유리 모세관을 도입하고 공기 방울이 ampulla 내부에 보일 때까지 뺍니다. </li><li> 부드럽게 유리 모세관을 제거하고 복부로 생식 기관을 다시 놓습니다. 3-0 비 흡수성 외과 봉합으로 절개를 봉합 한 다음 상처 클립으로 닫습니다. 전체 복구가 완료 될 때까지 마우스를 면밀히 모니터링하십시오. </li></ol> 9. 유전자 타이핑 전략 / 시퀀싱 참고 : 게놈 분리관련 동물 윤리 규정에 따라 2-mm 꼬리 또는 귀 생검에서 얻은 DNA. <ol><li> 빠른 게놈 DNA 추출 (무작위 통합). <ol><li> 알칼리 용해 시약 (25 MM 수산화 나트륨 및 0.2 MM EDTA, 산도 = 12)의 100 μL에서 1 시간 95 ° C에서 조직 샘플 (~ 2 mm)을 Lyse. </li><li> 중화 시약 (40 mM Tris-HCl, pH = 5) 100 μL를 넣는다. </li><li> 12,000 g 및 4 ° C에서 5 분간 원심 분리하십시오. </li></ol></li><li> 고품질 게놈 DNA 추출 (유전자 표적화). <ol><li> 꼬리 버퍼 (50 MM 트리스, 산도 = 8, 100 MM EDTA, 산도 = 8, 100 MM NaCl, 1 % SDS, 0.5 MG / ML proteinase K, 갓 추가)의 500 μL를 추가합니다. </li><li> 55 ° C에서 밤새 품어 둡니다. </li><li> 반전하여 5 분 동안 혼합하십시오 (vortex하지 마십시오). </li><li> 포화 NaCl (6 M) 250 μL를 첨가하고 반전시켜 5 분 동안 혼합한다 (vortex하지 않는다). </li><li> 12,000 xg 및 4 ° C에서 5-10 분 동안 스핀하고 상층 액을 새 튜브에 붓습니다. </li&gt; <li> 500 μl의 이소프로판올을 첨가하고 반전시켜 5 분 동안 혼합한다 (볼텍트하지 마라). </li><li> 12,000 xg 및 실온에서 10 분간 회전합니다. </li><li> 상층 액을 따라 내고 (펠릿은 보이지 않고 튜브에 달라 붙는다). </li><li> 70 % 에탄올 1 mL로 씻으십시오. </li><li> 12,000 xg 및 실온에서 5-10 분 동안 스핀. 흰색 펠렛이 더 이상 끈적 거리지 않고 분실 될 수 있으므로 조심스럽게 상등액을 제거하십시오. </li><li> 약 1 시간 동안 공기를 건조시킵니다. </li><li> TE 버퍼 (10 MM 트리스와 1 MM EDTA, 산도 = 8)의 400 μL를 추가합니다. </li><li> 2 시간 동안 55-60 ° C에서 DNA를 녹입니다. </li></ol></li><li> 프라이머 디자인. <ol><li> 전산 도구를 사용하여 최소 20bp의 프라이머를 디자인하십시오 19 . 참고 : 무작위 통합의 경우, 프라이머는 도입 유전자와 혼성화하여 200-800 bp의 분명한 단편을 생성해야합니다. 유전자 타겟팅의 경우 프라이머를 게놈 DNA와 혼성화되도록 디자인하여 뚜렷한 f잘라내는 사이트 주위에 백 백 bp를 분열. 큰 삽입의 경우, 프라이머는 도입 유전자 상에 놓일 수 있지만, 표적 통합의 확인은 프라이머 워킹 (primer walking) 또는 유사한 기술을 사용하여 수행되어야한다. </li></ol></li><li> PCR genotyping. <ol><li> 각 게놈 변형에 대해 새로운 PCR 프로토콜을 설계하고 경험적으로 테스트하십시오. 생성 된 단편의 길이와 각 쌍의 프라이머의 용융 온도 (Tm)를 고려하십시오. </li></ol></li><li> 시퀀싱. <ol><li> 유전자 타겟팅의 경우 PCR 제품을 생거 시퀀싱 서비스 제공 업체에 보내십시오. </li></ol></li></ol>

<ol>
	<li>Ittner, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+function+of+tau+mediates+amyloid-beta+toxicity+in+Alzheimer's+disease+mouse+models.">Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models.</a> Cell. 142 (3), 387-397 (2010).</li><li>Ittner, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+phosphorylation+of+tau+inhibits+amyloid-beta+toxicity+in+Alzheimer's+mice.">Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice.</a> Science. 354 (6314), 904-908 (2016).</li><li>Marantz Henig, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Monk in the Garden. , (2000).</li><li>Jaenisch, R., Mintz, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simian+virus+40+DNA+sequences+in+DNA+of+healthy+adult+mice+derived+from+preimplantation+blastocysts+injected+with+viral+DNA.">Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA.</a> Proc Natl Acad Sci U S A. 71 (4), 1250-1254 (1974).</li><li>Gordon, J. W., Ruddle, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+and+stable+germ+line+transmission+of+genes+injected+into+mouse+pronuclei.">Integration and stable germ line transmission of genes injected into mouse pronuclei.</a> Science. 214 (4526), 1244-1246 (1981).</li><li>Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+mouse+embryos+by+microinjection+of+purified+DNA.">Genetic transformation of mouse embryos by microinjection of purified DNA.</a> Proc Natl Acad Sci U S A. 77 (12), 7380-7384 (1980).</li><li>Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Factors+affecting+the+efficiency+of+introducing+foreign+DNA+into+mice+by+microinjecting+eggs.">Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs.</a> Proc Natl Acad Sci U S A. 82 (13), 4438-4442 (1985).</li><li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat Rev Genet. 6 (6), 507-512 (2005).</li><li>Carbery, I. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186 (2), 451-459 (2010).</li><li>Sung, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat Biotechnol. 31 (1), 23-24 (2013).</li><li>Jinek, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Wang, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153 (4), 910-918 (2013).</li><li>Kang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introducing+precise+genetic+modifications+into+human+3PN+embryos+by+CRISPR/Cas-mediated+genome+editing.">Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing.</a> J Assist Reprod Genet. 33 (5), 581-588 (2016).</li><li>Liang, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-mediated+gene+editing+in+human+tripronuclear+zygotes.">CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes.</a> Protein Cell. 6 (5), 363-372 (2015).</li><li>Ittner, L. M., G&#246;tz, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pronuclear+injection+for+the+production+of+transgenic+mice.">Pronuclear injection for the production of transgenic mice.</a> Nat Protoc. 2 (5), 1206-1215 (2007).</li><li>Yang, H., Wang, H., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generating+genetically+modified+mice+using+CRISPR/Cas-mediated+genome+engineering.">Generating genetically modified mice using CRISPR/Cas-mediated genome engineering.</a> Nat Protoc. 9 (8), 1956-1968 (2014).</li><li>. Resuspension Calculator Available from: <a target="_blank" href="https://sg.idtdna.com/calc/resuspension/">https://sg.idtdna.com/calc/resuspension/</a> (2017)</li><li>Auerbach, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain-dependent+differences+in+the+efficiency+of+transgenic+mouse+production.">Strain-dependent differences in the efficiency of transgenic mouse production.</a> Transgenic Res. 12 (1), 59-69 (2003).</li><li>Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+aging+on+superovulation+efficiency,+aneuploidy+rates,+and+sister+chromatid+cohesion+in+mice+aged+up+to+15+months.">Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months.</a> Biol Reprod. 86 (2), 49 (2012).</li><li>Nakagawa, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-superovulation+for+the+CRISPR-Cas9-mediated+production+of+gene-knockout,+single-amino-acid-substituted,+and+floxed+mice.">Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice.</a> Biol Open. 5 (8), 1142-1148 (2016).</li><li>Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+estrous+cycle+identification+tool+and+images.">Mouse estrous cycle identification tool and images.</a> PLoS One. 7 (4), e35538 (2012).</li><li>Whitten, W. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+the+oestrous+cycle+of+the+mouse+by+external+stimuli+associated+with+the+male.">Modification of the oestrous cycle of the mouse by external stimuli associated with the male.</a> J Endocrinol. 13 (4), 399-404 (1956).</li><li>Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+procedure+for+genotyping+single+nucleotide+polymorphisms.">An efficient procedure for genotyping single nucleotide polymorphisms.</a> Nucleic Acids Res. 29 (17), E88 (2001).</li><li>Yoshimi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ssODN-mediated+knock-in+with+CRISPR-Cas+for+large+genomic+regions+in+zygotes.">ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes.</a> Nat Commun. 7, 10431 (2016).</li><li>Suzuki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+genome+editing+via+CRISPR/Cas9+mediated+homology-independent+targeted+integration.">In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration.</a> Nature. , (2016).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat Genet. 21, 70-71 (1999).</li><li>Liu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+targeted+mutation+at+the+known+collagenase+cleavage+site+in+mouse+type+I+collagen+impairs+tissue+remodeling.">A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling.</a> J Cell Biol. 130 (1), 227-237 (1995).</li><li>Ke, Y. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+suppression+of+A315T+mutant+human+TDP-43+expression+improves+functional+deficits+in+a+novel+inducible+transgenic+mouse+model+of+FTLD-TDP+and+ALS.">Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS.</a> Acta Neuropathol. 130 (5), 661-678 (2015).</li><li>Auerbach, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+functional+transgenic+mice+by+DNA+pronuclear+microinjection.">Production of functional transgenic mice by DNA pronuclear microinjection.</a> Acta Biochim Pol. 51 (1), 9-31 (2004).</li><li>Iyer, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Off-target+mutations+are+rare+in+Cas9-modified+mice.">Off-target mutations are rare in Cas9-modified mice.</a> Nat Methods. 12 (6), 479 (2015).</li><li>Zhou, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (7501), 487-491 (2014).</li><li>Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+of+globin+messenger+RNA+by+the+mouse+ovum.">Translation of globin messenger RNA by the mouse ovum.</a> Nature. 283 (5746), 499-501 (1980).</li><li>Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+transfer+into+mouse+ova+by+microinjection.">Mitochondria transfer into mouse ova by microinjection.</a> Transgenic Res. 6 (6), 379-383 (1997).</li><li>Biggers, J. D., Summers, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Choosing+a+culture+medium:+making+informed+choices.">Choosing a culture medium: making informed choices.</a> Fertil Steril. 90 (3), 473-483 (2008).</li><li>Nakagata, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryo+transfer+through+the+wall+of+the+fallopian+tube+in+mice.">Embryo transfer through the wall of the fallopian tube in mice.</a> Jikken Dobutsu. 41 (3), 387-388 (1992).</li><li>Truett, G. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+PCR-quality+mouse+genomic+DNA+with+hot+sodium+hydroxide+and+tris+(HotSHOT).">Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT).</a> Biotechniques. 29 (1), 52-54 (2000).</li><li>Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+homology-directed+genome+editing+by+catalytically+active+and+inactive+CRISPR-Cas9+using+asymmetric+donor+DNA.">Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA.</a> Nat Biotechnol. 34 (3), 339-344 (2016).</li><li>Delerue, F., Ittner, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+Editing+in+Mice+Using+CRISPR/Cas9:+Achievements+and+Prospects.">Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects.</a> Clon. Transgen. 4, (2015).</li></ol>

저자는 University of New South Wales의 Mark Wainwright Analytical Center를 통해 마우스에서 학술적 전이 서비스를 제공합니다.

프로토콜 내 중요 단계 유전자 변형 마우스의 생성은 기술적으로 어려운 것으로 알려져 있습니다. 그러나 여기에 제시된 프로토콜은 기록적인 시간에 기술을 마스터하고 문제를 해결할 수 있도록 최적화되고 단순화 된 방법입니다. 이 기술을 성공적으로 완료하려면 두 단계가 필요합니다. 첫째, 염화 마그네슘 (MgCl 2 )없이 선형 DNA 템플릿 (sgRNA 합성 용)의 합성이 가능?...

척추 동물과 무척추 동물의 동물 모델은 알츠하이머 병과 같은 인간의 병태 생리학을 검사하는 도구가되어왔다. 그들은 질병 치료제를 찾고 궁극적으로 완치를위한 새로운 치료 전략을 개발할 수있는 귀중한 도구이기도합니다. 각 모델에는 본질적인 한계가 있지만, 전신 모델로 동물을 사용하는 것은 생물 의학 연구에 필수적입니다. 이것은 신진 대사와 복잡한 생리 환경이 조직 배양에서 완전히 모의 될 수 없기 때문입니다. 지금까지 마우스는 유전자 조작에 사용되는 가장 일반적인 포유류 종으로 남아 있기 때문에 몇 가지 장점이 있습니다. 질병과 관련된 생리적 과정과 유전자는 생쥐와 인간 사이에서 매우 잘 보존되어 있습니다. 마우스는 인간 게놈보다 일년 전에 (2002 년) 전체 유전체 염기 서열을 갖는 최초의 포유 동물이었다.나 (2003). 이 풍부한 유전자 정보 외에, 번식 능력이 좋고 발달주기가 빠르며 (수정으로부터 이유식까지 6 주) 적당한 크기입니다. 뚜렷한 외투 색상 (교차 전략에 필요)과 같은 생리적 인 지표와 결합 된 이러한 모든 장점은 마우스를 유전자 조작을위한 매력적인 모델로 만들었습니다. 주목할 만하게, 현대 유전학의 아주 이른 나이에서는, Gregor Mendel는 식물 3으로 움직이기 전에 쥐에 종사 시작했다. 유전자 전달 기술은 바이러스 성 전달을 이용하여 처음 생성 된 30 년 전의 첫 번째 형질 전환 마우스의 생성을 가져왔다. 그러나 연구자들은 곧 마우스 전이의 주요 과제 중 하나가 외인성 DNA의 운명을 제어 할 수 없다는 것을 깨달았습니다. 마우스 난 모세포로 형질 전환 유전자를 바이러스로 전달하면 게놈에 무작위로 여러 복제물이 통합되기 때문에,후속 형질 전환 계통을 확립하는 것이 제한적이었다. 이러한 한계 중 하나는 Gordon et al. microinjection 5 , 6 에 의한 최초의 형질 전환 마우스 라인을 생성했다. 이것은 재조합 DNA 기술의 시대를 열었고 마이크로 인젝션 세션의 결과에 영향을 미치는 매개 변수가 널리 연구되었습니다 7 . 마이크로 인젝션 (microinjection)은 형질 도입 유전자의 통합 부위에 대한 제어를 허용하지 않지만 (결과적으로 각 창 마우스에 대한 특이적인 발현 수준을 유도 함), 전 핵 마이크로 인젝션의 주요 이점은 컨 테이너 (concatemer)의 형성이다 ( 즉 , 게놈 통합 이전에 시리즈로 링크 됨) 5 . 이러한 특성은 수년 동안 관심있는 유전자를 과발현하는 수천 개의 트랜스 제닉 마우스 라인을 수립하는데 사용되었습니다. 그 이후로 유전자 변형,유기체 게놈의 인공 수정은 질병 발생시 단일 유전자의 역할을 확인하는 데 광범위하게 사용되었습니다. 마리오 카 페치 (Mario Capecchi)가 생쥐의 단일 유전자를 성공적으로 파괴하여 유전자 표적화 시대를 열었을 때 마우스 게놈을 조작하는 데있어 중요한 성과를 달성했습니다. 그러나 ES 세포 배양의 어려움, 약간의 가변성의 키메라 (chimerism) 정도, 과정의 길이 ( 즉, 마우스를 얻는 데 최소 12-18 개월)를 비롯하여 ES 세포 기반 유전자 표적화에서 주요 단점이 빠르게 나타났다. . 최근에, ZFN, TALEN 및 CISPR / Cas9와 같은 신기술의 진보가 대체 방법으로 등장했다. 마이크에서 유전자 타겟팅 과정을 가속화한다.e 9 , 10 . 이 endonucleases는 microinjection에 의해 마우스 난 모세포에 쉽게 주입 될 수 있으며, 6 주 이내에 유전자 표적 마우스를 생성 할 수 있습니다. 게놈 편집을위한 CRISPR 사용에 관한 첫 번째 보고서 이후이 박테리아 적응 면역 시스템은 ZFN과 TALEN을 대체했으며 그 이유는 합성의 용이함과 동시에 여러 유전자좌를 표적으로하는 능력 ( &quot;멀티플렉싱 &quot;). CRISPR은 생쥐 12 번에서 유전자 타겟팅에 처음 사용되었으며 이후 식물에서 사람 13,14 로 무수한 종에 적용되었습니다. 현재까지 CRISPR 게놈 편집에 저항하는 단일 종에 대한보고는 없다. 유전자 변형 생쥐의 생성의 두 가지 주요 제한 단계는 난 모세포의 주입과 재 이식이 난 모세포를 가짜 임신 한 암컷으로 이 기술은 우리와 15 에 의해 기술되었지만 최근의 쥐 발생학 및 유전자 전달 기술의 기술적 향상은 유 전적으로 변형 된 쥐를 생성하는 과정에 혁명을 일으켰습니다. 이러한 개선 사항은 여기에 설명됩니다.

<table><tbody><tr><td>Micropipette 0.1-2.5 &amp;mu;L</td><td>Eppendorf</td><td>4920000016</td><td></td></tr><tr><td>Micropipette 2 - 20 &amp;mu;L</td><td>Eppendorf</td><td>4920000040</td><td></td></tr><tr><td>Micropipette 20 - 200 &amp;mu;L</td><td>Eppendorf</td><td>4920000067</td><td></td></tr><tr><td>Micropipette 100 - 1,000 &amp;mu;L</td><td>Eppendorf</td><td>4920000083</td><td></td></tr><tr><td>Molecular weight marker&amp;nbsp;</td><td>Bioline</td><td>BIO-33025</td><td>HyperLadder 1 kb</td></tr><tr><td>Molecular weight marker&amp;nbsp;</td><td>Bioline</td><td>BIO-33056</td><td>HyperLadder 100 bp</td></tr><tr><td>Agarose</td><td>Bioline</td><td>BIO-41025</td><td></td></tr><tr><td>EDTA buffer</td><td>Sigma-Aldrich</td><td>93296</td><td>10x - Dilute to 1x</td></tr><tr><td>Ethidium bromide</td><td>Thermo Fisher Scientific</td><td>15585011</td><td></td></tr><tr><td>SYBR Safe gel stain</td><td>Invitrogen</td><td>S33102</td><td></td></tr><tr><td>Gel extraction kit</td><td>Qiagen</td><td>28706</td><td></td></tr><tr><td>PCR purification kit (Qiaquick)</td><td>Qiagen</td><td>28106</td><td></td></tr><tr><td>Vacuum system (Manifold)</td><td>Promega</td><td>A7231</td><td></td></tr><tr><td>Nuclease-free microinjection buffer&amp;nbsp;</td><td>Millipore</td><td>MR-095-10F</td><td></td></tr><tr><td>Ultrafree-MC microcentrifuge filter&amp;nbsp;</td><td>Millipore</td><td>UFC30GV00</td><td></td></tr><tr><td>Cas9 mRNA</td><td>Sigma-Aldrich</td><td>CAS9MRNA</td><td></td></tr><tr><td>CRISPR expressing plasmid (px330)</td><td>Addgene</td><td>42230</td><td></td></tr><tr><td>Nuclease free water</td><td>Sigma-Aldrich</td><td>W4502</td><td></td></tr><tr><td>Phusion polymerase</td><td>New England Biolabs</td><td>M0530L</td><td></td></tr><tr><td>T7 Quick High Yield RNA kit</td><td>New England Biolabs</td><td>E2050S</td><td></td></tr><tr><td>RNA purification spin columns (NucAway)</td><td>Thermo Fisher Scientific</td><td>AM10070</td><td></td></tr><tr><td>ssOligos</td><td>Sigma-Aldrich</td><td>OLIGO STANDARD</td><td></td></tr><tr><td>Donor plasmid</td><td>Thermo Fisher Scientific</td><td>GeneArt</td><td></td></tr><tr><td>Hyaluronidase</td><td>Sigma-Aldrich</td><td>H3884</td><td></td></tr><tr><td>KSOMaa embryo culture medium</td><td>Zenith Biotech&amp;nbsp;</td><td>ZEKS-100</td><td></td></tr><tr><td>Mineral oil</td><td>Zenith Biotech&amp;nbsp;</td><td>ZSCO-100</td><td></td></tr><tr><td>M2 Medium</td><td>Sigma-Aldrich</td><td>M7167</td><td></td></tr><tr><td>Cytochalasin B</td><td>Sigma-Aldrich</td><td>C6762</td><td></td></tr><tr><td>Mouthpiece</td><td>Sigma-Aldrich</td><td>A5177</td><td></td></tr><tr><td>Glass microcapillaries</td><td>Sutter Instrument</td><td>BF100-78-10</td><td></td></tr><tr><td>Proteinase K</td><td>Applichem</td><td>A3830.0100</td><td></td></tr><tr><td>Dumont #5 forceps</td><td>Fine Science Tools&amp;nbsp;</td><td>91150-20</td><td></td></tr><tr><td>Iris scissors</td><td>Fine Science Tools&amp;nbsp;</td><td>91460-11</td><td></td></tr><tr><td>Vessel clamp</td><td>Fine Science Tools&amp;nbsp;</td><td>18374-43</td><td></td></tr><tr><td>Wound clips&amp;nbsp;</td><td>Fine Science Tools&amp;nbsp;</td><td>12040-01</td><td></td></tr><tr><td>Clips applier&amp;nbsp;</td><td>Fine Science Tools&amp;nbsp;</td><td>12018-12</td><td></td></tr><tr><td>Micro-scissors&amp;nbsp;</td><td>Fine Science Tools&amp;nbsp;</td><td>15000-03</td><td></td></tr><tr><td>Cauterizer</td><td>Fine Science Tools&amp;nbsp;</td><td>18000-00</td><td></td></tr><tr><td>Non-absorbable surgical sutures (Ethilon 3-0)</td><td>Ethicon</td><td>1691H</td><td></td></tr><tr><td>5% CO&lt;sub&gt;2&lt;/sub&gt; incubator</td><td>MG Scientific</td><td>Galaxy 14S</td><td></td></tr><tr><td>Spectrophotometer</td><td>Thermo Fisher Scientific</td><td>Nanodrop 2000c</td><td></td></tr><tr><td>Thermocycler</td><td>Eppendorf</td><td>6321 000.515</td><td></td></tr><tr><td>Electrophoresis set up</td><td>BioRad</td><td>1640300</td><td></td></tr><tr><td>UV Transilluminator</td><td>BioRad</td><td>1708110EDU</td><td></td></tr><tr><td>Thermocycler</td><td>Eppendorf</td><td>6334000069</td><td></td></tr><tr><td>Stereoscopic microscope</td><td>Olympus</td><td>SZX7</td><td></td></tr><tr><td>Inverted microscope</td><td>Olympus</td><td>IX71</td><td></td></tr><tr><td>2x Micromanipulators</td><td>Eppendorf</td><td>5188000.012</td><td></td></tr><tr><td>Oocytes manipulator</td><td>Eppendorf</td><td>5176000.025</td><td></td></tr><tr><td>Microinjector (Femtojet)</td><td>Eppendorf</td><td>5247000.013</td><td></td></tr><tr><td>Mice C57BL/6J strain</td><td>Australian BioResources</td><td>C57BL/6JAusb&amp;nbsp;</td><td></td></tr></tbody></table>

generation of genetically modified mice through the microinjection of oocytes

유전자 조작 마우스의 사용은 생체 내 및 병리학 적 생체 내 과정 모두에 대한 연구에 크게 기여했다. 수정 된 난 모세포 내로의 DNA 발현 구조물의 전 핵 주입은 과발현을위한 형질 전환 쥐를 생성하는 가장 보편적 인 기술로 남아있다. 유전자 표적화를위한 CRISPR 기술이 도입됨에 따라 수정 된 난 모세포에 전핵을 주입하여 knockout과 knockin 마우스를 생성 할 수있게되었다. 이 연구는 유전자 타겟팅을위한 사출 용 DNA의 준비와 CRISPR 가이드의 생성을 기술하고 있으며 특히 품질 관리에 중점을두고 있습니다. 잠재적 인 창시자를 확인하는 데 필요한 유전형 분석 절차가 중요합니다. CRISPR의 &quot;멀티플렉싱&quot;기능을 활용하는 혁신적인 유전자형 전략이 여기에 제시됩니다. 수술 절차도 요약되어 있습니다. 함께, 프로토콜의 단계는 세대의 생성을 허용합니다면역학, 신경 과학, 암, 생리학, 발달 및 기타를 포함한 수많은 연구 분야에서 마우스 식민지를 확립하는 데 사용됩니다.

아래에서, 무작위 통합 및 CRISPR 매개 유전자 타겟팅의 경우 microinjection에 대한 워크 플로우가 설명됩니다 ( 그림 1 ). <img alt="그림 1" class="xfigimg" src="/files/ftp_upload/55765/55765fig1v2.jpg" /> 그림 1 : 유전자 조작 마우스의 일반적인 워크 플로. 무작위 적으로 통합하기 위해 정화 된 형질 도입 유?...

Watch this Scientific Journal Video about Generation of Genetically Modified Mice through the Microinjection of Oocytes at JoVE.com

Generation of Genetically Modified Mice through the Microinjection of Oocytes

마우스 oocytes의 microinjection는 일반적인 transgenesis ( 즉, transgenes의 무작위 통합) 및 CRISPR 매개 유전자 타겟팅 모두에 일반적으로 사용됩니다. 이 프로토콜은 품질 관리 및 유전자 타이핑 전략에 중점을두고 마이크로 인젝션의 최신 개발 상황을 검토합니다.

난 모세포의 미세 주입을 통한 유전자 조작 마우스의 생성

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear ...

generation-genetically-modified-mice-through-microinjection

Research

JoVE Journal

Developmental Biology

20.5K 조회수.  University of New South Wales.  마우스 oocytes의 microinjection는 일반적인 transgenesis ( 즉, transgenes의 무작위 통합) 및 CRISPR 매개 유전자 타겟팅 모두에 일반적으로 사용됩니다. 이 프로토콜은 품질 관리 및 유전자 타이핑 전략에 중점을두고 마이크로 인젝션의 최신 개발 상황을 검토합니다. 

비디오: Generation of Genetically Modified Mice through the Microinjection of Oocytes

Loss- and Gain-of-function Approach to Investigate Early Cell Fate Determinants in Preimplantation Mouse Embryos

Gene silencing and overexpression techniques are instrumental for the identification of genes involved in embryonic development. Direct target gene modification in preimplantation embryos provides a means to study the underlying mechanisms of genes implicated in, for instance, cellular differentiation into the trophectoderm (TE) and the inner cell mass (ICM). Here, we describe a protocol that examines the role of neogenin as an authentic receptor for initial cell fate determination in preimplantation mouse embryos. First, we discuss the experimental manipulations that were used to produce gain and loss of neogenin function by microinjecting neogenin cDNA and shRNA; the effectiveness of this approach was confirmed by a strong correlation between the pair-wise expression levels of either red fluorescent protein (RFP) or green fluorescent protein (GFP) and the immunocytochemical quantification of neogenin expression. Secondly, overexpression of neogenin in preimplantation mouse embryos leads to normal ICM development while neogenin knockdown causes the ICM to develop abnormally, implying that neogenin could be a receptor that relays extracellular cues to drive blastomeres to early cell fates. Given the success of this detailed protocol in investigating the function of a novel embryonic developmental stage-specific receptor, we propose that it has the potential to aid in exploration and identification of other stage-specific genes during embryogenesis.

The goal of this protocol is to describe a loss- and gain-of function method that is applicable to identify neogenin as a stage-specific receptor that leads to trophectoderm and inner cell mass differentiation in preimplantation mouse embryos.

착상 전의 마우스 배아의 초기 세포 운명 결정 요인을 조사 할 Loss- 및 이득 -의 - 기능 접근

 Gene silencing and overexpression techniques are instrumental for the identification of genes involved in embryonic development. Direct target gene ...

연구

발생학

Using Mouse Oocytes to Assess Human Gene Function During Meiosis I

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively correlated with maternal age, age alone is not always predictive of the risk of generating an aneuploid embryo. Therefore, gene variants might account for incorrect chromosome segregation during oogenesis. Given that access to human oocytes is limited for research purposes, a series of assays were developed to study human gene function during meiosis I using mouse oocytes. First, messenger RNA (mRNA) of the gene and gene variant of interest are microinjected into prophase I-arrested mouse oocytes. After allowing time for expression, oocytes are synchronously released into meiotic maturation to complete meiosis I. By tagging the mRNA with a sequence of a fluorescent reporter, such as green fluorescent protein (Gfp), the localization of the human protein can be assessed in addition to the phenotypic alterations. For example, gain or loss of function can be investigated by establishing experimental conditions that challenge the gene product to fix meiotic errors. Although this system is advantageous in investigating human protein function during oogenesis, adequate interpretation of results should be undertaken given that protein expression is not at endogenous levels and, unless controlled for (i.e. knocked out or down), murine homologs are also present in the system.

As the genetic variants associated with human disease begin to become uncovered, it is becoming increasingly important to develop systems with which to rapidly evaluate the biological significance of those identified variants. This protocol describes methods for evaluating human gene function during female meiosis I using mouse oocytes.

감수 분열 동안 인간 유전자 기능을 평가 하기 위해 마우스 Oocytes를 사용 하 여 나

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively ...

유전학

Lentiviral Mediated Production of Transgenic Mice: A Simple and Highly Efficient Method for Direct Study of Founders

For almost 40 years, pronuclear DNA injection represents the standard method to generate transgenic mice with random integration of transgenes. Such a routine procedure is widely utilized throughout the world and its main limitation resides in the poor efficacy of transgene integration, resulting in a low yield of founder animals. Only few percent of animals born after implantation of injected fertilized oocytes have integrated the transgene. In contrast, lentiviral vectors are powerful tools for integrative gene transfer and their use to transduce fertilized oocytes allows highly efficient production of founder transgenic mice with an average yield above 70%. Furthermore, any mouse strain can be used to produce transgenic animal and the penetrance of transgene expression is extremely high, above 80% with lentiviral mediated transgenesis compared to DNA microinjection. The size of the DNA fragment that can be cargo by the lentiviral vector is restricted to 10 kb and represents the major limitation of this method. Using a simple and easy to perform injection procedure beneath the zona pellucida of fertilized oocytes, more than 50 founder animals can be produced in a single session of microinjection. Such a method is highly adapted to perform, directly in founder animals, rapid gain and loss of function studies or to screen genomic DNA regions for their ability to control and regulate gene expression in vivo.

Here, we present a protocol to promote transgene integration and production of founder transgenic mice with high efficacy by a simple injection of a lentiviral vector in the perivitelline space of a fertilized oocyte.

유전자 변형 마우스 생산을 중재 하는 lentiviral: 창시자의 직접적인 연구를 위한 간단 하 고 매우 효율적인 방법

For almost 40 years, pronuclear DNA injection represents the standard method to generate transgenic mice with random integration of transgenes. Such a ...

Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice

The use of genetically modified (GM) mice has become crucial for understanding gene function and deciphering the underlying mechanisms of human diseases. The CRISPR/Cas9 system allows researchers to modify the genome with unprecedented efficiency, fidelity, and simplicity. Harnessing this technology, researchers are seeking a rapid, efficient, and easy protocol for generating GM mice. Here we introduce an improved method for cryopreservation of one-cell embryos that leads to a higher developmental rate of the freeze-thawed embryos. By combining it with optimized electroporation conditions, this protocol allows for the generation of knockout and knock-in mice with high efficiency and low mosaic rates within a short time. Furthermore, we show a step-by-step explanation of our optimized protocol, covering CRISPR reagent preparation, in vitro fertilization, cryopreservation and thawing of one-cell embryos, electroporation of CRISPR reagents, mouse generation, and genotyping of the founders. Using this protocol, researchers should be able to prepare GM mice with unparalleled ease, speed, and efficiency.

Here, we present a modified method for cryopreservation of one-cell embryos as well as a protocol that couples the use of freeze-thawed embryos and electroporation for the efficient generation of genetically modified mice.

유전자 변형 마우스의 고효율 생산을 위한 동결 해동 배아 사용

The use of genetically modified (GM) mice has become crucial for understanding gene function and deciphering the underlying mechanisms of human diseases. ...

Somatic Genome-Engineered Mouse Models Using In Vivo Microinjection and Electroporation

Germline genetically engineered mouse models (G-GEMMs) have provided valuable insight into in vivo gene function in development, homeostasis, and disease. However, the time and cost associated with colony creation and maintenance are high. Recent advances in CRISPR-mediated genome editing have allowed the generation of somatic GEMMs (S-GEMMs) by directly targeting the cell/tissue/organ of interest.
The oviduct, or fallopian tube in humans, is considered the tissue-of-origin of the most common ovarian cancer, high-grade serous ovarian carcinomas (HGSCs). HGSCs initiate in the region of the fallopian tube distal to the uterus, located adjacent to the ovary, but not the proximal fallopian tube. However, traditional mouse models of HGSC target the entire oviduct, and thus do not recapitulate the human condition. We present a method of DNA, RNA, or ribonucleoprotein (RNP) solution microinjection into the oviduct lumen and in vivo electroporation to target mucosal epithelial cells in restricted regions along the oviduct. There are several advantages of this method for cancer modeling, such as 1) high adaptability in targeting the area/tissue/organ and region of electroporation, 2) high flexibility in targeted cell types (cellular pliancy) when used in combination with specific promoters for Cas9 expression, 3) high flexibility in the number of electroporated cells (relatively low frequency), 4) no specific mouse line is required (immunocompetent disease modeling), 5) high flexibility in gene mutation combination, and 6) possibility of tracking electroporated cells when used in combination with a Cre reporter line. Thus, this cost-effective method recapitulates human cancer initiation.

Somatic Genome-Engineered Mouse Models Using In Vivo Microinjection and Electroporation

This protocol describes microinjection and in vivo electroporation for regionally restricted CRISPR-mediated genome editing in the mouse oviduct.

생체 내 미세주입 및 전기천공을 사용한 체세포 게놈 공학 마우스 모델

Germline genetically engineered mouse models (G-GEMMs) have provided valuable insight into in vivo gene function in development, homeostasis, and disease. ...

암 연구학

Zygote Microinjection for Creating Gene Cassette Knock-in and Flox Alleles in Mice

CRISPR-Cas technology has enabled the rapid and effortless generation of genetically modified mice. Specifically, mice and point mutant mice are readily produced by electroporation of CRISPR factors (and single-stranded oligo DNA donors) into the zygote. In contrast, gene cassette (&#62;1 kb) knock-in and floxed mice are mainly generated by microinjection of CRISPR factors and double-stranded DNA donors into zygotes. Genome editing technologies have also increased the flexibility of genetically modified mice production. It is now possible to introduce the intended mutations in the target genomic regions in a number of beneficial inbred mouse strains. Our team has produced over 200 gene cassette knock-in mouse lines, and over 110 floxed mouse lines by zygote microinjection of CRISPR-Cas9 following requests from several countries, including Japan. Some of these genome editing used BALB/c, C3H/HeJ, and C57BL/6N inbred strains, however most used C57BL/6J. Unlike the electroporation method, genome editing by zygote microinjection in various inbred strains of mice is not that easy. However, gene cassette knock-in and floxed mice on single inbred genetic backgrounds are as critical as genetic humanized, fluorescent reporter, and conditional knockout mouse models. Therefore, this article presents the protocol for the zygote microinjection of CRISPR factors and double-stranded DNA donors in C57BL/6J mice for generating gene cassette knock-in and floxed mice. This article exclusively focuses on nuclear injection rather than cytoplasmic injection. In addition to zygote microinjection, we outline the timeline for the production process and peripheral techniques such as induction of superovulation and embryo transfer.

The present protocol describes zygote microinjection of CRISPR-Cas9 and donor DNA to efficiently produce gene cassette knock-in and floxed mice.

생쥐에서 유전자 카세트 knock-in 및 Flox 대립 유전자를 생성하기위한 접합체 미세 주입

CRISPR-Cas technology has enabled the rapid and effortless generation of genetically modified mice. Specifically, mice and point mutant mice are readily ...

<meta charset="utf8"></head><body>배아 발달을 연구하기 위한 Murine Round Spermatid Injection Procedure

Mouse Round Spermatid Injection

Round spermatids, characterized by their haploid genetic content, represent the precursor cells to mature spermatozoa. Through the innovative technique of round spermatid injection (ROSI), oocytes can be successfully fertilized and developed into viable fetuses. In a groundbreaking milestone achieved in 1995, the first mouse fetus was born through ROSI technology. ROSI has since emerged as a pivotal tool for unraveling the intricate mechanisms governing embryonic development and holds significant potential in various applications, including the acceleration of mouse generation and the production of genetically modified mice. In 1996, a milestone was reached when the first human fetus was born through ROSI technology. However, the clinical applications of this method have shown a fluctuating pattern of success and failure. To date, ROSI technology has not found widespread application in clinical practice, primarily due to its low birth efficiency and insufficient validation of fetal safety. This article provides a comprehensive account of the precise methods of performing ROSI in mice, aiming to shed new light on basic research and its potential clinical applications.

<meta charset="utf8"></head><body>마우스 라운드 Spermatid 주입

Here, we introduce a method for performing round spermatid injection (ROSI) in mice, a technique with promising clinical applications and utility for investigating the mechanisms underlying embryonic development.

마우스 라운드 Spermatid 주입

Round spermatids, characterized by their haploid genetic content, represent the precursor cells to mature spermatozoa. Through the innovative technique of ...

Mouse Oocyte Microinjection, Maturation and Ploidy Assessment

Mistakes in chromosome segregation lead to aneuploid cells. In somatic cells, aneuploidy is associated with cancer but in gametes, aneuploidy leads to infertility, miscarriages or developmental disorders like Down syndrome. Haploid gametes form through species-specific developmental programs that are coupled to meiosis. The first meiotic division (MI) is unique to meiosis because sister chromatids remain attached while homologous chromosomes are segregated. For reasons not fully understood, this reductional division is prone to errors and is more commonly the source of aneuploidy than errors in meiosis II (MII) or than errors in male meiosis 1,2. 
In mammals, oocytes arrest at prophase of MI with a large, intact germinal vesicle (GV; nucleus) and only resume meiosis when they receive ovulatory cues. Once meiosis resumes, oocytes complete MI and undergo an asymmetric cell division, arresting again at metaphase of MII. Eggs will not complete MII until they are fertilized by sperm. Oocytes also can undergo meiotic maturation using established in vitro culture conditions 3. Because generation of transgenic and gene-targeted mouse mutants is costly and can take long periods of time, manipulation of female gametes in vitro is a more economical and time-saving strategy. 
Here, we describe methods to isolate prophase-arrested oocytes from mice and for microinjection. Any material of choice may be introduced into the oocyte, but because meiotically-competent oocytes are transcriptionally silent 4,5 cRNA, and not DNA, must be injected for ectopic expression studies. To assess ploidy, we describe our conditions for in vitro maturation of oocytes to MII eggs. Historically, chromosome-spreading techniques are used for counting chromosome number 6. This method is technically challenging and is limited to only identifying hyperploidies. Here, we describe a method to determine hypo-and hyperploidies using intact eggs 7-8. This method uses monastrol, a kinesin-5 inhibitor, that collapses the bipolar spindle into a monopolar spindle 9 thus separating chromosomes such that individual kinetochores can readily be detected and counted by using an anti-CREST autoimmune serum. Because this method is performed in intact eggs, chromosomes are not lost due to operator error.

Oocytes are prone to aneuploidy due to errors in chromosome segregation during meiotic maturation. Aneuploid eggs can cause infertility, miscarriages or developmental disorders like Down syndrome. Here, we describe methods to introduce materials of choice into oocytes and methods to study meiotic maturation and assess ploidy.

마우스 Oocyte의 Microinjection, 성숙과 Ploidy 평가

Mistakes in chromosome segregation lead to aneuploid cells.  In somatic cells, aneuploidy is associated with cancer but in gametes, aneuploidy leads to ...

난 모세포의 미세 주입을 통한 유전자 조작 마우스의 생성

요약

더 많은 비디오 탐색

이 비디오의 챕터

착상 전의 마우스 배아의 초기 세포 운명 결정 요인을 조사 할 Loss- 및 이득 -의 - 기능 접근

감수 분열 동안 인간 유전자 기능을 평가 하기 위해 마우스 Oocytes를 사용 하 여 나

유전자 변형 마우스 생산을 중재 하는 lentiviral: 창시자의 직접적인 연구를 위한 간단 하 고 매우 효율적인 방법

유전자 변형 마우스의 고효율 생산을 위한 동결 해동 배아 사용

생체 내 미세주입 및 전기천공을 사용한 체세포 게놈 공학 마우스 모델

생쥐에서 유전자 카세트 knock-in 및 Flox 대립 유전자를 생성하기위한 접합체 미세 주입

마우스 라운드 Spermatid 주입

마우스 라운드 Spermatid 주입

마우스 라운드 Spermatid 주입

마우스 Oocyte의 Microinjection, 성숙과 Ploidy 평가