This work was supported by an IMPRS PhD stipend to E.S, an EMBO Long-Term Fellowship to V.P., and MPI-MPP internal funds to F.K. Part of this work was also funded through PLAMORF, a project that has received funding from the European Research Council (ERC) under the European Union&#8217;s Horizon 2020 research and innovation programme (Grant agreement No. 810131). The authors would like to thank Federico Apelt for the bioinformatic analysis and comments on the manuscript, and Mathieu Bahin and Amira Kramdi for the bioinformatic analysis.&#160;Work in the Colot lab is supported by Investissements d&#8217;Avenir ANR-10-LABX-54 MEMO LIFE, 506 ANR-11-IDEX-0001-02 PSL* Research University.

1. Preparing the RNA
<ol>
	<li>Grind 200 mg of plant tissue to powder in liquid nitrogen, making sure that the tissue remains frozen throughout the procedure.</li>
	<li>Extract the RNA from the desired plant tissue following an acid guanidinium thiocyanate-phenol-chloroform extraction protocol. To decrease the possibility to contaminate RNA with DNA during the phase separation, use 1-bromo-3-chloropropane instead of chloroform.
	<ol>
		<li>Add 1 mL of RNA extraction reagent containing guanidine thiocyanate and acid phenol to the grinded plant tissue (500 &#181;L per 100 mg tissue). Mix well by inverting and make sure all the tissue is wet. Incubate for 10 min at room temperature to dissociate the ribonucleoprotein complexes.</li>
		<li>Centrifuge for 10 min at 12,000 x g at 4 &#176;C and transfer the supernatant to a new 1.5 mL tube.</li>
		<li>Add 200 &#181;L of 1-bromo-3-chloropropane (100 &#181;L per 500 &#181;L RNA extraction reagent) and vortex vigorously.</li>
		<li>Centrifuge for 15 min at 12,000 x g at 4 &#176;C and transfer the upper aqueous phase (approx. 500 &#181;L) to a new 1.5 mL tube.</li>
		<li>Add 1 volume of isopropanol (500 &#181;L) and 0.1 volume of 3 M sodium acetate pH 5.5 (50 &#181;L), mix well by inverting and precipitate 10 min at -20 &#176;C. 
		NOTE: The use of sodium acetate (NaOAc) is recommended in order to enhance RNA precipitation. The protocol can be paused at this point by prolonging the precipitation of RNA for a few hours or even overnight.</li>
		<li>Centrifuge for 30 min at 12,000 x g at 4 &#176;C and discard the supernatant.</li>
		<li>Wash the pellet twice with 500 &#181;L of 80% EtOH, centrifuge for 5 min at 12,000 x g at 4 &#176;C and discard.</li>
		<li>Wash the pellet once with 500 &#181;L 99% EtOH, centrifuge for 5 min at 12,000 x g at 4 &#176;C and discard.</li>
		<li>Dry the pellet for 5-10 min and dissolve in 30 &#181;L of RNase-free H2O. 
		NOTE: Instead, use any RNA extraction protocol of choice (e.g., a column-based system). If a DNase digestion is included in the protocol, skip it in the following step (step 1.3).</li>
	</ol>
	</li>
	<li>Measure the RNA concentration (e.g., with the use of a spectrophotometer) and digest 20 &#181;g of RNA with DNase. 
	NOTE: DNA is rich in m5C and the antibody does not distinguish between DNA and RNA.
	<ol>
		<li>In a typical DNase reaction, treat 10 &#181;g of RNA in a 50 &#181;L reaction. Mix the following components and incubate the reaction(s) at 37 &#176;C for 30 min: 
		10 &#181;g of RNA x &#181;L 
		10x DNase buffer 5 &#181;L 
		DNase 1 &#181;L (2 units) 
		RNase-free H2O up to 50 &#181;L</li>
		<li>Remove the enzyme either by adding an appropriate volume of DNase inactivation reagent (if it is included in the DNase kit and according to manufacturer&#8217;s instructions) or by performing a cleanup step (e.g., column purification or phenol/chloroform extraction).</li>
	</ol>
	</li>
	<li>Check the quality and purity of the isolated RNA by capillary electrophoresis and proceed if the RNA integrity number (RIN) is higher than 7, to ensure the samples are of good quality.</li>
	<li>OPTIONAL: Remove the ribosomal RNA to enrich the samples in mRNA content using an rRNA removal kit and according to manufacturer&#8217;s protocol.
	<ol>
		<li>Use the DNase treated RNA from the previous step for the rRNA depletion reaction(s). Perform multiple reactions if the amount of total RNA is more than the maximum amount suggested for the reaction.</li>
		<li>Note that only 5-10% of the input amount will be recovered after rRNA depletion. Proceed with the rRNA depleted RNA (equal amount for all samples) and ignore the amounts mentioned in the following steps, as they refer to total RNA. 
		NOTE: For a comparison and description of available rRNA depletion methods see references 38,39,40. rRNA is the major part of total RNA and is m5C methylated in many organisms.</li>
	</ol>
	</li>
	<li>Prepare in advance in vitro transcripts (IVT) to be used as control RNA sequences and add them in the samples.
	<ol>
		<li>Produce two distinct IVTs using an in vitro transcription kit, one with non-methylated nucleosides and one where rCTP is replaced by 5-methyl-rCTP, to serve as negative and positive controls in MeRIP, respectively. The transcripts prepared were those of EGFP and Renilla luciferase. 
		NOTE: The IVTs should not exist in the transcriptome of the organism you are analysing. If the IVTs are from the same template (e.g., both EGFP), then add the positive and negative control in two different samples. If their sequence is different (e.g., EGFP and Renilla), they can be added to the same sample.</li>
		<li>Spike in each sample 0.1 ng IVT per 3 &#181;g of RNA, as controls.</li>
	</ol>
	</li>
	<li>Sonicate the RNA to approximately 100 nt fragments. 
	NOTE: The conditions for RNA shearing must be adjusted in advance and they differ for each sonicator. For the model used here, sonication is performed with the following conditions: Peak power 174, Duty factor 10, Cycles/burst 200, 17 min.
	<ol>
		<li>Sonicate the same amount of RNA for all samples, at least 12 &#181;g RNA per sample in 80 &#181;L of total volume (min 60 &#181;L, max 100 &#181;L), filled up with RNase-free H2O.</li>
	</ol>
	</li>
	<li>Confirm the efficiency of sonication and the concentration of the RNA samples by capillary electrophoresis. The average size of fragmented RNA should be around 100 nt.</li>
</ol>
2. Methylated RNA Immunoprecipitation (MeRIP)
<ol>
	<li>In low-binding tubes, add 9 &#181;g of sonicated RNA and RNase-free H2O up to 60 &#181;L (or more, depending on the concentration).</li>
	<li>Dissociate the secondary structures by heating the RNA at 70 &#176;C in a water bath for 10 min and cooling down for an additional 10 min in an ice-water mix.</li>
	<li>Split the sample in three parts: one-third (20 &#181;L, if 60 &#181;L were taken in step 2.1) is saved in a separate tube at -80 &#176;C as the Input sample. Fill the remaining 40 &#181;L with RNase-free H2O up to 860 &#181;L and then split in two low-binding tubes: one for IP and one for the Mock control (430 &#181;L each).</li>
	<li>Add to both tubes: 
	50 &#181;L of 10x MeRIP buffer 
	10 &#181;L of RNase inhibitor 
	10 &#181;L of &#945;-m5C antibody (10 &#181;g) in the IP sample per 10 &#181;L of H2O in the Mock sample 
	NOTE: The antibody clone used previously is not commercially available anymore. However, any anti-5-methylcytosine monoclonal antibody should work similarly. Antibodies should be tested for specificity before used for MeRIP11,23.</li>
	<li>Seal the tubes with parafilm and incubate for 12-14 hours at 4 &#176;C, with overhead rotation.</li>
	<li>The next day, prepare the protein G magnetic beads for binding.
	<ol>
		<li>For each tube (either IP or Mock control), use 40 &#181;L of beads. Add the total amount of beads (# of tubes x 40 &#181;L, e.g., for 2 IP and 2 Mock samples, 160 &#181;L of beads are needed) in a 15 mL tube and wash three times with 800 &#181;L of 1x MeRIP buffer per sample (# of tubes x 800 &#181;L buffer, e.g., 3.2 mL for 2 IP and 2 Mock samples).</li>
		<li>Perform washes at room temperature for 5 min with overhead rotation, collect the beads with the help of a magnetic rack and discard the washing buffer. After the third wash, resuspend the beads in the same volume of 1x MeRIP buffer as the initial volume of beads taken (# of tubes x 40 &#181;L, e.g., 160 &#181;L of 1x MeRIP buffer for 2 IP and 2 Mock samples). 
		NOTE: The amount of protein G beads used is determined by the binding capacity of the beads for the specific antibody type and the amount of antibody used. In this case, the beads have a binding capacity of approx. 8 &#181;g of mouse IgG per mg of beads and 30 mg/mL concentration. Therefore, 40 &#181;L are enough to bind approx. 9.6 &#181;g of antibody.</li>
	</ol>
	</li>
	<li>Add 40 &#181;L of resuspended beads to each IP and Mock sample and incubate for additional 2 hours at 4 &#176;C, with overhead rotation.</li>
	<li>Place the tubes on a magnetic rack for 1 min and discard the supernatant or save it as a control (non-bound RNA sample).</li>
	<li>Wash the beads 5 times by resuspending in 700 &#181;L of 1x MeRIP buffer supplied with 0.01% Tween 20 and incubating for 10 min at room temperature with overhead rotation.</li>
	<li>Resuspend the washed beads in 200 &#181;L of Proteinase K digestion buffer and add 3.5 &#181;L of Proteinase K. Incubate for 3 hours at 50 &#176;C, shaking at 800 rpm. Occasionally, flick manually the bottom of the tube if a sediment of beads is forming during the incubation.</li>
	<li>Extract the RNA by addition of 800 &#181;L of RNA extraction reagent and following an acid guanidinium thiocyanate-phenol-chloroform extraction protocol, and continue as in step 1.2. To increase visibility of the RNA pellet, a colored co-precipitant can be added in isopropanol at the precipitation step. Resuspend the pellet in 20 &#181;L of RNase-free H2O (or equal to Input volume kept in step 2.3).</li>
</ol>
3. Downstream analysis
<ol>
	<li>Submit the Input and IP samples for single end sequencing with 50 bases read length (SE50).</li>
	<li>Trim 3&#8217; end adaptors using cutadapt41 and discard reads that are shorter than 48 nt.</li>
	<li>Map trimmed reads to the Arabidopsis genome (TAIR10 annotation) using STAR42 with a cutoff of 6% for mismatches and maximum intron size of 10 kb. Keep uniquely mapped reads for further analysis.</li>
	<li>Identify enriched RNA fragments in IP samples compared to Input using two distinct methods and consider those that are found significantly enriched by both.
	<ol>
		<li>First, detect MeRIP-seq peaks using MACS2 peak caller43 on pooled IPs versus Input.</li>
		<li>Secondly, follow the analysis for MeRIP-seq peak calling as described in Meyer et al.22 and Yang et al.17.
		<ol>
			<li>Using custom R scripts, divide the genome in distinct 25 nt windows and count the number of uniquely mapped reads for each window based on the position of the last mapped nucleotide (since the reads originate from 100 nt RNA fragments).</li>
			<li>Calculate significantly enriched windows in IP samples compared to Input with the Fisher Exact Test. Use the Benjamini-Hochberg procedure&#160;to correct for multiple testing.</li>
			<li>Keep the significantly enriched peaks that span over at least two consecutive windows and discard peaks that cover only one window.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Identify annotated regions of the genome (transcripts) with significantly enriched peaks found by both methods.</li>
	<li>Alternatively or complementarily, test specific RNA targets for their enrichment in the IP samples.
	<ol>
		<li>Reverse transcribe the RNA (same volume of Input, IP and Mock samples) with random hexamers.</li>
		<li>Perform quantitative real-time PCR on the chosen targets, comparing Input, IP and Mock via the &#916;&#916;Ct method. 
		NOTE: The generated product should not be longer than 100 bp, as this is the average fragmentation size.</li>
	</ol>
	</li>
</ol>

The authors have no conflict of interest to disclose.

RNA carries more than one hundred distinct base modifications4 that form the epitranscriptome44. These modifications add an additional layer of regulation of translation and signalling (reviewed in5,6,8,20,45,46). Early studies were able to detect the presence of post-transcriptional modifications on RNA28,47 but the specific modified RNAs need to be identified in order to understand the role of epitranscriptomics. MeRIP was designed as a method to map RNA methylation sites transcriptome-wide21,22. It can be adapted to any modification, if a specific antibody is available.
The main strength of this protocol is that is relatively simple, safe for the RNA and the user (e.g., 5-azaC is highly toxic for plants and humans) and does not require sequence or modifying enzyme information. Moreover, the enrichment of methylated RNAs by the IP increases the chances of low abundant mRNAs to be detected, unlike bisulfite sequencing that does not contain an enrichment step. When two serial rounds of MeRIP are performed, enrichment in RNA fragments containing methylation sites increases further22. One of the limitations of MeRIP, especially when applied to mRNA methylation studies, is the high quantity of RNA required as input for the assay. The ribodepletion &#8211; or poly(A) enrichment &#8211; step will reduce the background caused by the heavily modified ribosomal RNA but it removes more than 90% of total RNA. DNA must also be completely removed as it is rich in 5-methylated cytosines. Another drawback is the lower resolution of the exact position of methylation. Sonication of the RNA prior to incubation with the antibody helps towards this direction by narrowing down the region containing the modification to 100-200 nucleotides. When MeRIP is combined with deep sequencing, the resolution of m5C site prediction increases as the sequencing reads form a Gaussian distribution around the potential methylation site. Additionally, the specificity of the antibody needs to be confirmed prior to the assay (e.g., with RNA dot blot assays, performed with oligos synthesized with modified nucleotides), however, to what extent an antibody can actually distinguish between closely related modifications (e.g., m6A and m6Am) is a point of argument in the field48,49. Moreover, highly structured RNAs might interfere with the antibody&#8211;antigen interaction, another restriction that is mostly addressed with fragmentation and denaturation of RNA prior to IP. On the contrary, bisulfite sequencing that is also affected by secondary structures, does not include a fragmentation step and this might be one reason that causes discrepancy between the m5C sites and mRNAs predicted by bisulfite sequencing16 and MeRIP-seq11,17. Other cytosine modifications (e.g., hm5C) are also resistant to bisulfite-mediated deamination35.
Modifications of MeRIP-seq include a crosslinking step, either with the introduction of a photoactivatable ribonucleoside (photo-crosslinking-assisted m6A-seq, PA-m6A-seq 50) or using UV light to create antibody-RNA crosslinks after the IP (miCLIP49, different method than the miCLIP described in introduction30, but also with individual-nucleotide resolution). In the future, and as knowledge on RNA methylation is accumulating, more targeted approaches might be preferable, based on the modifying enzymes and/or the consensus sequences where methylation is appearing. The identification of reader proteins is essential to the understanding of the molecular and signalling function of post-transcriptional modifications. Nanopore sequencing technology already allows the direct identification of modified nucleotides without prior treatment of the RNA17 but there is still room for improvement on this field regarding sequence depth and bioinformatic analysis. Overall, MeRIP-seq is currently an established, reliable, and unbiased approach to identify methylated RNA transcripts.

An erratum was issued for:&#160;<a href="https://www.jove.com/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.
The author list was updated from:
Eleftheria Saplaoura1, Valentina Perrera2, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua
to:
Eleftheria Saplaoura1, Valentina Perrera2, Vincent Colot3, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua 
3Biologie de l&#39;Ecole Normale Sup&#233;rieure (IBENS),&#160;Paris, France

An erratum was issued for:&#160;<a href="https://www.jove.com/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.

Erratum: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

In all three kingdoms of life, RNA species undergo post-transcriptional modifications and research on these functionally relevant biochemical modifications is called &#8220;epitranscriptomics&#8221;. Epitranscriptomics is a growing field and various methods are being developed to study and map the modifications on RNA molecules (reviewed in1,2). More than a hundred RNA modifications have been found, detected in rRNAs, tRNAs, other ncRNAs, as well as mRNAs3,4. Although the presence and function of chemically diverse post-transcriptional modifications in tRNAs and rRNAs are extensively studied5,6,7,8, only recently have mRNA modifications been characterized. In plants, many mRNA modifications have been identified to date, including m7G at the cap structure9, m1A10, hm5C11,12, and uridylation13. However, only m6A10,14,15, m5C11,16,17, and pseudouridine18 have been mapped transcriptome-wide in Arabidopsis. Post-transcriptional mRNA base modifications are involved in several developmental processes19,20.
One of the most commonly used approaches in epitranscriptomics is the methylated RNA immunoprecipitation coupled with deep sequencing (MeRIP-seq). MeRIP-seq was developed in 2012 to study m6A in mammalian cells21,22. It requires the use of an antibody for the desired modification and aims to enrich for RNA fragments carrying the modified nucleotide(s). It is usually followed by deep sequencing to identify and map the enriched fragments or quantitative PCR to verify specific RNA targets. The accuracy of MeRIP is based on the specificity of the antibody to recognise the modified nucleotide over similar modifications (e.g., m5C and hm5C11,23). Besides m6A, MeRIP-seq has been also applied to study m1A and m5C RNA methylation in several organisms11,17,23,24,25.
Methylation of the cytosine at the fifth carbon position (m5C) is the most prevalent DNA modification26,27 and one of the most common RNA modifications too3,4. While m5C was detected in eukaryotic mRNAs in 197528, only recently have studies focused on mapping the modification transcriptome-wide, in coding and non-coding RNAs11,16,17,23,29,30,31,32,33,34.
Alternative methods used in m5C RNA research include chemical conversion of non-methylated cytosines into uracils (bisulfite sequencing) and immunoprecipitation assays based on an irreversible binding of a known RNA cytosine methyltransferase to its RNA targets (miCLIP, aza-IP). In brief, bisulfite sequencing exploits the feature of 5-methylated cytosine to be resistant to sodium bisulfite treatment that deaminates unmodified cytosines to uracil. The method was first developed for DNA but adapted for RNA too and many studies have chosen this approach to detect m5C sites in RNA16,23,29,32,34,35. Both miCLIP and aza-IP require previous knowledge of the RNA cytosine methyltransferase and use of the respective antibody. In the case of miCLIP (methylation individual-nucleotide-resolution crosslinking and immunoprecipitation), the methyltransferase carries a single amino acid mutation so that it binds to the RNA substrate but cannot be released30. In aza-IP (5-azacytidine&#8211;mediated RNA immunoprecipitation), the irreversible binding is formed between the 5-azaC nucleoside and the RNA cytosine methyltransferase when exogenously provided 5-azaC is incorporated by RNA polymerases into a target RNA molecule31.
The main advantage of these three methods is that they allow single nucleotide resolution mapping of m5C. In addition, miCLIP and aza-IP provide information about the specific targets of a selected RNA cytosine methyltransferase, deciphering deeper the mechanism and role of post-transcriptional RNA modifications. However, the MeRIP-seq approach can identify transcriptome-wide m5C regions without any previous knowledge required and avoids harsh chemical and temperature conditions, such as bisulfite treatment or incubation with 5-azaC. Both MeRIP and bisulfite sequencing can be inhibited by secondary RNA structures36. The fragmentation step that is included in the MeRIP assay prior to immunoprecipitation aims to facilitate antibody binding and increase the resolution of m5C identification.
Another method worth mentioning is mass spectrometry (MS) of RNA nucleosides. MS can detect and distinguish any type of modification both on DNA and on RNA. Briefly, RNA is extracted and DNase digested, then desalted and digested to single nucleosides. The RNA nucleosides are analyzed by a mass spectrometer. This method can be used to quantify the levels of each modification and it does not rely on an antibody or a chemical conversion. However, a major drawback is that it provides bulk information about the presence of RNA modifications. In order to map the modifications, MS needs to be combined with RNase digestion and sequencing information about specific RNA molecules, as in the case of human tRNALeu(CAA)37.
Here, we describe and discuss the MeRIP assay as used to study m5C RNA methylation in Arabidopsis17.

<table>
	<tbody>
		<tr>
			<td>&#945;&#8208;m5C antibody</td>
			<td>ZymoResearch</td>
			<td>A3001 (discontinued), A3002 available</td>
			<td>Clone 10G4 (discontinued), 7D21 available</td>
		</tr>
		<tr>
			<td>Chip and reagents for capillary electrophoresis</td>
			<td>Agilent</td>
			<td>5067-1511</td>
			<td>RNA 6000 Nano kit</td>
		</tr>
		<tr>
			<td>Dnase</td>
			<td>Ambion</td>
			<td>AM1907</td>
			<td>TURBO DNA-free kit</td>
		</tr>
		<tr>
			<td>Co-precipitant of nucleic acids</td>
			<td>Ambion</td>
			<td>AM9515</td>
			<td>Glycoblue, 15 mg/mL</td>
		</tr>
		<tr>
			<td>In vitro transcription kit</td>
			<td>Promega</td>
			<td>P1300</td>
			<td>T7 RiboMAX Large Scale RNA Production System</td>
		</tr>
		<tr>
			<td>Low-binding reaction tubes</td>
			<td>Kisker Biotech</td>
			<td>G017</td>
			<td>1.7 ml microcentrifuge tubes</td>
		</tr>
		<tr>
			<td>Protein G magnetic beads</td>
			<td>Invitrogen</td>
			<td>10003D</td>
			<td>Dynabeads Protein G</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Ambion</td>
			<td>AM2546</td>
			<td>20mg/mL stock solution, RNA grade</td>
		</tr>
		<tr>
			<td>RNase inhibitor</td>
			<td>Promega</td>
			<td>N2615</td>
			<td>RNasin Plus 40 U/&#956;l</td>
		</tr>
		<tr>
			<td>rRNA removal kit</td>
			<td>Epicentre</td>
			<td>RZPL11016</td>
			<td>Ribo-Zero rRNA removal kit (Plant leaf)</td>
		</tr>
		<tr>
			<td>Sonication tubes</td>
			<td>Covaris</td>
			<td>520045</td>
			<td>microtube AFA Fiber Pre-Slit Snap-Cap 6x16mm</td>
		</tr>
		<tr>
			<td>RNA extraction reagent</td>
			<td>Ambion</td>
			<td>15596018</td>
			<td>TRIzol reagent</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Capillary electrophoresis machine</td>
			<td>Agilent</td>
			<td>G2939BA</td>
			<td>2100 Bioanalyzer System</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>DynaMag-2</td>
		</tr>
		<tr>
			<td>Microentrifuge</td>
			<td>Eppendorf</td>
			<td>discontinued</td>
			<td>5417R model</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Benchmark</td>
			<td>R4040</td>
			<td>RotoBot Mini</td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Covaris</td>
			<td>500217</td>
			<td>S220 Focused-ultrasonicator</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>ThermoFisher Scientific</td>
			<td>ND-ONEC-W</td>
			<td>NanoDrop OneC</td>
		</tr>
		<tr>
			<td>Waterbath</td>
			<td>GFL</td>
			<td>1012</td>
			<td>1012 Incubation bath</td>
		</tr>
	</tbody>
</table>

methylated rna immunoprecipitation assay to study m5c modification in arabidopsis

Secondary base modifications on RNA, such as m5C, affect the structure and function of the modified RNA molecules. Methylated RNA Immunoprecipitation and sequencing (MeRIP-seq) is a method that aims to enrich for methylated RNA and ultimately identify modified transcripts. Briefly, sonicated RNA is incubated with an antibody for 5-methylated cytosines and precipitated with the assistance of protein G beads. The enriched fragments are then sequenced and the potential methylation sites are mapped based on the distribution of the reads and peak detection. MeRIP can be applied to any organism, as it does not require any prior sequence or modifying enzyme knowledge. In addition, besides fragmentation, RNA is not subjected to any other chemical or temperature treatment. However, MeRIP-seq does not provide single-nucleotide prediction of the methylation site as other methods do, although the methylated area can be narrowed down to a few nucleotides. The use of different modification-specific antibodies allows MeRIP to be adjusted for the different base modifications present on RNA, expanding the possible applications of this method.

A schematic of the method is provided in Figure 1. The first critical steps of the protocol are to obtain RNA of good quality (RIN &#8805; 7) and sonicate it to approximately 100 nt fragments. The efficiency of both steps is examined by a chip-based capillary electrophoresis machine. In Figure 2A, a representative run of a good RNA sample is shown. The sample is diluted 1:10 before loading on the chip in order to have a concentration that is in the range of detection of the kit used (5-500 ng/&#181;L). The same sample is also run after sonication and is shown in Figure 2B. Notice the presence of one uniform peak shifted to the left of the diagram, at a size of around 100 nucleotides. The lower concentration is caused both by loss of RNA during fragmentation but also because of the increased volume of the samples (60-100 &#181;L, step 1.7.1).
The quality of the IP and Mock samples can be evaluated by qRT-PCR. To this end, the spiked-in IVTs serve as positive and negative controls: the methylated IVT, where in all cytosine positions there is m5C, is expected to be highly enriched in the IP sample; on the contrary, the non-methylated IVT should not have a difference between IP and Mock. The primers used in the qRT-PCR assay for the two control IVTs (EGFP and Renilla luciferase) are listed in Table 1. Indeed, as shown in Figure 3, around 80% of the methylated IVT was recovered in the IP sample, and only approximately 2% in the Mock. For the non-methylated control, the recovery was below 1% in both IP and Mock samples. This verifies the efficiency of MeRIP that methylated RNA fragments were precipitated and enriched, and is a good indicator that the samples can be used for downstream analysis. In addition, the fold enrichment of the non-methylated IVT (IP to Mock ratio) can be applied as a threshold to estimate significance of enrichment in the qRT-PCR assays.
After aligning the reads to the genome (Figure 4), the peak calling algorithms described in steps 3.4.1&#160;and 3.4.2&#160;are applied to identify the statistically significant windows, enriched in the IP samples compared to the Input. The sequences that correspond to these windows can be used further, for example to search for conserved methylation-related motifs11,17.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61231/61231fig01.jpg" /> 
Figure 1: Schematic representation of MeRIP-seq protocol. 
RNA samples are incubated with an antibody for 5-methylated cytosines and the complexes are pulled down with protein G magnetic beads that capture the antibodies along with the bound RNA. The eluted RNA samples are analyzed by deep sequencing and qRT-PCR. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61231/61231fig02.jpg" /> 
Figure 2: Representative results from quality analysis of RNA samples. 
(A) Representative profile of a qualified total RNA plant sample. (B) Representative profile of an RNA sample after sonication to 100 nt fragments. Output files from capillary electrophoresis software. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61231/61231fig03.jpg" /> 
Figure 3: qRT-PCR analysis of control IVTs. 
Methylated and non-methylated in vitro transcripts were used as positive and negative controls of the MeRIP assay, respectively. After immunoprecipitation, the methylated IVT is highly enriched in the IP sample (green) but not in the Mock sample (without anti-m5C antibody; purple). The non-methylated IVT showed no enrichment and no difference between IP and Mock. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/61231/61231fig04.jpg" /> 
Figure 4: Read alignment before and after MeRIP around a representative transcript. 
Reads aligned to a specific transcript in the Input sample (top row) and in two IP replicates (middle and bottom row). The black box shows an identified enriched 50 nt long window based on MACS243 and MeRIP-seq22 peak-calling analyses. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Target</td>
			<td colspan="2">Primer pair</td>
			<td colspan="2">Product sequence</td>
			<td>Product length</td>
		</tr>
		<tr>
			<td rowspan="2">EGFP</td>
			<td colspan="2">For: 5&#39;- GGCAACTACAAGACCCGCGCC -3&#39;</td>
			<td colspan="2" rowspan="2">GGCAACTACAAGACCCGCGCCGAG 
			GTGAAGTTCGAGGGCGACACCCTG 
			GTGAACCGCATCGAGCTGAAGGGC</td>
			<td rowspan="2">72 bp</td>
		</tr>
		<tr>
			<td colspan="2">Rev: 5&#39;- GCCCTTCAGCTCGATGCGGTT -3&#39;</td>
		</tr>
		<tr>
			<td rowspan="2">Renilla luciferase</td>
			<td colspan="2">For: 5&#39;- GGAGAATAACTTCTTCGTGGAAAC -3&#39;</td>
			<td colspan="2" rowspan="2">GGAGAATAACTTCTTCGTGGAAACC 
			ATGTTGCCATCAAAAATCATGAGAA 
			AGTTAGAACCAGAAGAATTTGCAGC</td>
			<td rowspan="2">75 bp</td>
		</tr>
		<tr>
			<td colspan="2">Rev: 5&#39;- GCTGCAAATTCTTCTGGTTCTAA -3&#39;</td>
		</tr>
	</tbody>
</table>
Table 1: Information about the primers and generated products for the qRT-PCR analysis.
Buffer Recipes.&#160; <a href="https://www.jove.com/files/ftp_upload/61231/Buffer Recipes MeRIP.xlsx" target="_blank">Please click here to download this file.</a>

Watch this Scientific Journal Video about Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis at JoVE.com

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

The methylated RNA immunoprecipitation assay is an antibody-based method used to enrich for methylated RNA fragments. Coupled with deep sequencing, it leads to the identification of transcripts carrying the m5C modification.

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

Secondary base modifications on RNA, such as m5C, affect the structure and function of the modified RNA molecules. Methylated RNA Immunoprecipitation and ...

methylated-rna-immunoprecipitation-assay-to-study-m5c-modification

Research

JoVE Journal

Genetics

6.4K Views.  Max Planck Institute of Molecular Plant Physiology. The methylated RNA immunoprecipitation assay is an antibody-based method used to enrich for methylated RNA fragments. Coupled with deep sequencing, it leads to the identification of transcripts carrying the m5C modification.

Video: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative without tools to study gene function. The development and sharing of detailed protocols for the establishment of new model systems in laboratories, and for tools to carry out functional studies, is thus crucial for leveraging the power of genomics. Coleoptera (beetles) are the largest clade of insects and occupy virtually all types of habitats on the planet. In addition to providing ideal models for fundamental research, studies of beetles can have impacts on pest control as they are often pests of households, agriculture, and food industries. Detailed protocols for rearing and maintenance of D. maculatus laboratory colonies and for carrying out dsRNA-mediated interference in D. maculatus are presented. Both embryonic and parental RNAi procedures-including apparatus set up, preparation, injection, and post-injection recovery-are described. Methods are also presented for analyzing embryonic phenotypes, including viability, patterning defects in hatched larvae, and cuticle preparations for unhatched larvae. These assays, together with in situ hybridization and immunostaining for molecular markers, make D. maculatus an accessible model system for basic and applied research. They further provide useful information for establishing procedures in other emerging insect model systems.

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Here, we present protocols for rearing an intermediate-germ beetle, Dermestes maculatus (D. maculatus) in the lab. We also share protocols for embryonic and parental RNAi and methods for analyzing embryonic phenotypes to study gene function in this species.

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Chromatin Immunoprecipitation (ChIP) in Mouse T-cell Lines

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Chromatin Immunoprecipitation ChIP in Mouse T-cell Lines

This work describes a protocol for chromatin immunoprecipitation (ChIP) using a mature mouse T-cell line. This protocol is suitable to investigate the distribution of specific histone marks at specific promoter sites or genome-wide.

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational ...

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 104 - 5 x 105 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Here, we describe a chromatin immunoprecipitation (ChIP) and ChIP-seq library preparation protocol to generate global epigenomic profiles from low-abundance chicken embryonic samples.

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

Investigation of RNA Synthesis Using 5-Bromouridine Labelling and Immunoprecipitation

When steady state RNA levels are compared between two conditions, it is not possible to distinguish whether changes are caused by alterations in production or degradation of RNA. This protocol describes a method for measurement of RNA production, using 5-Bromouridine labelling of RNA followed by immunoprecipitation, which enables investigation of RNA synthesized within a short timeframe (e.g., 1 h). The advantage of 5-Bromouridine-labelling and immunoprecipitation over the use of toxic transcriptional inhibitors, such as &#945;-amanitin and actinomycin D, is that there are no or very low effects on cell viability during short-term use. However, because 5-Bromouridine-immunoprecipitation only captures RNA produced within the short labelling time, slowly produced as well as rapidly degraded RNA can be difficult to measure by this method. The 5-Bromouridine-labelled RNA captured by 5-Bromouridine-immunoprecipitation can be analyzed by reverse transcription, quantitative polymerase chain reaction, and next generation sequencing. All types of RNA can be investigated, and the method is not limited to measuring mRNA as is presented in this example.

This method can be used to measure RNA synthesis. 5-Bromouridine is added to cells and incorporated into synthesized RNA. RNA synthesis is measured by RNA extraction immediately after labelling, followed by 5-Bromouridine-targeted immunoprecipitation of labelled RNA and analysis by reverse transcription and quantitative polymerase chain reaction.

When steady state RNA levels are compared between two conditions, it is not possible to distinguish whether changes are caused by alterations in ...

RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA

Long non-coding RNA (lncRNA), which are sequences of more than 200 nucleotides without a defined reading frame, belong to the regulatory non-coding RNA&#39;s family. Although their biological functions remain largely unknown, the number of these lncRNAs has steadily increased and it is now estimated that humans may have more than 10,000 such transcripts. Some of these are known to be involved in important regulatory pathways of gene expression which take place at the transcriptional level, but also at different steps of RNA co- and post-transcriptional maturation. In the latter cases, RNAs that are targeted by the lncRNA have to be identified. That&#39;s the reason why it is useful to develop a method enabling the identification of RNAs associated directly or indirectly with a lncRNA of interest.
This protocol, which was inspired by previously published protocols allowing the isolation of a lncRNA together with its associated chromatin sequences, was adapted to permit the isolation of associated RNAs. We determined that two steps are critical for the efficiency of this protocol. The first is the design of specific anti-sense DNA oligonucleotide probes able to hybridize to the lncRNA of interest. To this end, the lncRNA secondary structure was predicted by bioinformatics and anti-sense oligonucleotide probes were designed with a strong affinity for regions that display a low probability of internal base pairing. The second crucial step of the procedure relies on the fixative conditions of the tissue or cultured cells that have to preserve the network between all molecular partners. Coupled with high throughput RNA sequencing, this RNA pull-down protocol can provide the whole RNA interactome of a lncRNA of interest.

This RNA pull-down method allows identifying the RNA targets of a long non-coding RNA (lncRNA). Based on the hybridization of home-made, designed anti-sense DNA oligonucleotide probes specific to this lncRNA in an appropriately fixed tissue or cell line, it efficiently allows the capture of all RNA targets of the lncRNA.

Long non-coding RNA (lncRNA), which are sequences of more than 200 nucleotides without a defined reading frame, belong to the regulatory non-coding ...

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell type-specific fashion. AS expression patterns are typically analyzed by RT-PCR and RNA-seq using RNA samples isolated from a population of cells. In situ examination of AS expression patterns for a particular biological structure can be carried out by RNA in situ hybridization (ISH) using exon-specific probes. However, this particular use of ISH has been limited because alternative exons are generally too short to design exon-specific probes. In this report, the use of BaseScope, a recently developed technology that employs short antisense oligonucleotides in RNA ISH, is described to analyze AS expression patterns in mouse brain sections. Exon 23a of neurofibromatosis type 1 (Nf1) is used as an example to illustrate that short exon-exon junction probes exhibit robust hybridization signals with high specificity in RNA ISH analysis on mouse brain sections. More importantly, signals detected with exon inclusion- and skipping-specific probes can be used to reliably calculate the percent spliced in values of Nf1 exon 23a expression in different anatomical areas of a mouse brain. The experimental protocol and calculation method for AS analysis are presented. The results indicate that BaseScope provides a powerful new tool to assess AS expression patterns in situ.

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

An in situ hybridization (ISH) protocol that uses short antisense oligonucleotides to detect alternative pre-mRNA splicing patterns in mouse brain sections is described.

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

Chromatin Immunoprecipitation Assay Using Micrococcal Nucleases in Mammalian Cells

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene expression. The cellular transcriptional machinery and its chromatin modification proteins coordinate to regulate transcription. To analyze transcriptional regulation at the molecular level, several experimental methods such as electrophoretic mobility shift, transient reporter and chromatin immunoprecipitation (ChIP) assays are available. We describe a modified ChIP assay in detail in this article because of its advantages in directly showing histone modifications and the interactions between proteins and DNA in cells. One of the key steps in a successful ChIP assay is chromatin shearing. Although sonication is commonly used for shearing chromatin, it is difficult to identify reproducible conditions. Instead of shearing chromatin by sonication, we utilized enzymatic digestion with micrococcal nuclease (MNase) to obtain more reproducible results. In this article, we provide a straightforward ChIP assay protocol using MNase.

Chromatin immunoprecipitation (ChIP) is a powerful tool for understanding the molecular mechanisms of gene regulation. However, the method involves difficulties in obtaining reproducible chromatin fragmentation by mechanical shearing. Here, we provide an improved protocol for a ChIP assay using enzymatic digestion.

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene ...

An Assay for Quantifying Protein-RNA Binding in Bacteria

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding of an RNA binding protein (RBP) to the initiation region of the mRNA, which interferes with ribosome binding. In the presented method, we utilize this blocking phenomenon to quantify the binding affinity of RBPs to their cognate and non-cognate binding sites. To do this, we insert a test binding site in the initiation region of a reporter mRNA and induce the expression of the test RBP. In the case of RBP-RNA binding, we observed a sigmoidal repression of the reporter expression as a function of RBP concentration. In the case of no-affinity or very low affinity between binding site and RBP, no significant repression was observed. The method is carried out in live bacterial cells, and does not require expensive or sophisticated machinery. It is useful for quantifying and comparing between the binding affinities of different RBPs that are functional in bacteria to a set of designed binding sites. This method may be inappropriate for binding sites with high structural complexity. This is due to the possibility of repression of ribosomal initiation by complex mRNA structure in the absence of RBP, which would result in lower basal reporter gene expression, and thus less-observable reporter repression upon RBP binding.

In this method, we quantify the binding affinity of RNA binding proteins (RBPs) to cognate and non-cognate binding sites using a simple, live, reporter assay in bacterial cells. The assay is based on repression of a reporter gene.

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding ...

Antibody-Free Assay for RNA Methyltransferase Activity Analysis

There are more than 100 chemically distinct modifications of RNA, two thirds of which consist of methylations. Interest in RNA modifications, and especially methylations, has re-emerged due to the important roles played by the enzymes that write and erase them in biological processes relevant to disease and cancer. Here, a sensitive in vitro assay for accurate analysis of RNA methylation writer activity on synthetic or in vitro transcribed RNAs is provided. This assay uses a tritiated form of S-adenosyl-methionine, resulting in direct labeling of methylated RNA with tritium. The low energy of tritium radiation makes the method safe, and pre-existing methods of tritium signal amplification, make it possible to quantify and to visualize the methylated RNA without the use of antibodies, which are commonly prone to artifacts. While this method is written for RNA methylation, few tweaks make it applicable to the study of other RNA modifications that can be radioactively labeled, such as RNA acetylation with 14C acetyl coenzyme A. Overall, this assay allows to quickly assess RNA methylation conditions, inhibition with small molecule inhibitors, or the effect of RNA or enzyme mutants, and provides a powerful tool to validate and expand results obtained in cells.

Here, an antibody-free in vitro assay for direct analysis of methyltransferase activity on synthetic or in vitro transcribed RNA is described.