이 작품은 E.S에 IMPRS 박사 학위 급여에 의해 지원되었다, V.P.에 EMBO 장기 펠로우십, 이 작품의 일부에 MPI-MPP 내부 자금은 PLAMORF를 통해 지원되었다, 유럽 연합 (EU의 호라이즌 2020 연구 및 혁신 프로그램)에 따라 유럽 연구 위원회 (ERC)에서 자금을받은 프로젝트 (그랜트 No.81) 연구 및 혁신 프로그램 (그랜트 No.) 81. 저자는 생물 정보 학에 대한 생물 학적 분석및 의견에 대한 페데리코 아펠트, 생물 정보 학적 분석을위한 마티유 바힌과 아미라 크람디에게 감사드립니다.

1. RNA 준비
<ol><li>분쇄 200 액체 질소분말 식물 조직의 mg, 조직이 절차를 통해 냉동 남아 있는지 확인.</li>
	<li>산 구아니늄 티오시네이트-페놀-클로로폼 추출 프로토콜에 따라 원하는 식물 조직으로부터 RNA를 추출한다. 상 분리 시 DNA로 RNA를 오염시킬 가능성을 줄이려면 클로로폼 대신 1-브로모-3-클로로프로판을 사용하십시오.<ol>
<li>분쇄된 식물 조직에 구아니딘 티오야네이트 및 산 페놀을 함유한 RNA 추출 시약 1mL을 추가합니다(100 mg 조직당 500 μL). 반전하여 잘 섞어서 모든 조직이 젖었는지 확인하십시오. 리보뉴클레오단백질 복합체를 해리하기 위해 실온에서 10분 동안 배양한다.</li>
		<li>원심분리기는 4°C에서 12,000 x g에서 10분 동안, 새로운 1.5mL 튜브로 상류부를 이송한다.</li>
		<li>1-브로모-3-클로로프로판(500μL RNA 추출 시약당 100μL)의 200 μL을 넣고 소용돌이를 적극적으로 넣습니다.</li>
		<li>원심분리기는 4°C에서 12,000 x g에서 15분 동안 원심분리기를 새로운 1.5mL 튜브로 상부 수성 상(약 500 μL)으로 이송한다.</li>
		<li>이소프로판올(500 μL)과 3M 아세테이트 pH 5.5(50 μL)의 0.1부피를 추가하면 -20°C에서 10분 반전하여 잘 섞는다. 참고: RNA 강수량을 향상시키기 위해 아세테이트 나트륨(NaOAc)을 사용하는 것이 좋습니다. 프로토콜은 몇 시간 또는 하룻밤 동안 RNA의 강수량을 연장하여이 시점에서 일시 중지 할 수 있습니다.</li>
		<li>원심분리기는 4°C에서 12,000 x g에서 30분 동안 원심분리기를 폐기하고 상류부를 폐기합니다.</li>
		<li>펠릿을 80% EtOH의 500 μL로 두 번 세척하고, 원심분리기는 4°C에서 12,000 x g에서 5분 동안 세척하고 폐기하십시오.</li>
		<li>펠릿을 500 μL 99% EtOH로 한 번 씻고, 원심분리기는 4°C에서 12,000 x g에서 5분 동안 세척하고 폐기하십시오.</li>
		<li>펠릿을 5-10분 동안 건조시키고 RNase 가 없는 H2O의 30 μL로 용해하십시오. 참고: 대신, 선택의 임의의 RNA 추출 프로토콜(예: 열 기반 시스템)을 사용하십시오. DNase 소화가 프로토콜에 포함된 경우 다음 단계(1.3단계)에서 건너뛰세요.</li>
	</ol></li>
	<li>RNA 농도(예를 들어, 분광계를 사용하여)를 측정하고 DNase를 사용하여 RNA의 20 μg를 소화한다. 참고: DNA는 m5C가 풍부하고 항체는 DNA와 RNA를 구별하지 않습니다.<ol>
<li>전형적인 DNase 반응에서, 50 μL 반응에서 RNA의 10 μg를 치료하십시오. 다음 성분을 혼합하고 반응(들)을 37°C에서 30분 동안 배양한다. RNA x μL 10 μg 10x DNase 버퍼 5 μL DNase 1 μL (2 단위) RNase 프리 H2O 최대 50 μL</li>
		<li>적절한 양의 DNase 비활성화 시약(DNase 키트에 포함되고 제조업체의 지침에 따라)을 추가하거나 정리 단계(예: 열 정화 또는 페놀/클로로폼 추출)를 수행하여 효소를 제거하십시오.</li>
	</ol></li>
	<li>모세관 전기포고에 의해 절연 된 RNA의 품질과 순도를 확인하고 RNA 무결성 번호 (RIN)가 7 보다 높은 경우, 샘플이 좋은 품질의 지확인합니다.</li>
	<li>선택 사항: rRNA 제거 키트를 사용하여 제조업체의 프로토콜에 따라 mRNA 함량의 샘플을 풍부하게 하기 위해 리보소말 RNA를 제거합니다.<ol>
<li>rRNA 고갈 반응(들)을 위해 이전 단계에서 DNase 처리된 RNA를 사용한다. 총 RNA의 양이 반응에 대해 제안된 최대 량보다 많은 경우 다중 반응을 수행한다.</li>
		<li>rRNA 고갈 후 입력 금액의 5-10%만 회수됩니다. rRNA 고갈 RNA (모든 샘플에 대해 동일한 양)를 진행하고 총 RNA를 참조할 때 다음 단계에서 언급 된 양을 무시합니다. 참고: 사용 가능한 rRNA 고갈 방법에 대한 비교 및 설명은 참조 참조 38,39,40을참조하십시오. rRNA는 총 RNA의 주요 부분이며 많은 유기체에서 m5C 메틸화된다.</li>
	</ol></li>
	<li>시험관 내 전사체(IVT)를 미리 준비하여 RNA 서열 조절으로 사용하고 시료에 추가한다.<ol>
<li>시험관 내 전사 키트를 사용하여 두 개의 뚜렷한 IVT를 생산, 비 메틸화 뉴클레오시드와 rCTP가 5 메틸 rCTP로 대체되는 하나 하나, MeRIP에서 각각 부정적이고 긍정적 인 대조군 역할을. 준비된 성적증명서는 EGFP와 레닐라 루시파라제였다. 참고: IVT는 분석중인 유기체의 전사체에 존재해서는 안됩니다. IVT가 동일한 템플릿(예: EGFP 모두)에서 온 경우 두 개의 서로 다른 샘플에 양수 및 음수 제어를 추가합니다. 순서가 다른 경우(예: EGFP 및 Renilla) 동일한 샘플에 추가할 수 있습니다.</li>
		<li>각 샘플에서 3 μg당 0.1 ng IVT를 대조군으로 스파이크합니다.</li>
	</ol></li>
	<li>RNA를 약 100nt 단편으로 초음파 처리합니다. 참고: RNA 전단의 조건은 사전에 조정되어야 하며 각 초음파 처리기마다 다릅니다. 여기에 사용되는 모델의 경우, 초음파 처리는 다음과 같은 조건으로 수행됩니다 : 피크 파워 174, 듀티 팩터 10, 사이클 / 버스트 200, 17 분.<ol>
<li>모든 시료에 대해 동일한 양의 RNA를 초음파 처리하여 총 부피 80 μL(최소 60 μL, 최대 100 μL)에서 샘플당 최소 12μg RNA를 음속화하여 RNase 가 없는 H2O로 채워지도록 합니다.</li>
	</ol></li>
	<li>모세관 전기포에 의한 RNA 시료의 초음파 처리 및 농도의 효율을 확인한다. 단편화된 RNA의 평균 크기는 약 100 nt이어야 합니다.</li>
</ol>2. 메틸화 RNA 면역 침전 (MeRIP)
<ol><li>저결합 튜브에서는 초음파 처리된 RNA 와 RNase 가 없는 H2O를 최대 60 μL(또는 농도에 따라)의 9μg을 추가합니다.</li>
	<li>10분 동안 수조에서 RNA를 70°C로 가열하고 얼음-물 혼합물에서 10분 동안 냉각하여 이차 구조물을 분리한다.</li>
	<li>샘플을 3부로 분할한다: 1/3(20 μL, 60 μL을 단계 2.1에서 채취한 경우)은 입력 샘플로서 -80°C에서 별도의 튜브에 저장된다. 나머지 40 μL을 RNase 가 없는 H2O에서 최대 860 μL로 채운 다음 두 개의 저결합 튜브로 분할합니다: IP용과 모의 제어용 튜브(각 430 μL).</li>
	<li>두 튜브에 추가: 10x MeRIP 버퍼의 50 μL RNase 억제제 의 10 μL 모의 샘플에서 H2O의 10 μL 당 IP 샘플에서 α-m5C 항체(10 μg)의 10 μL 참고: 이전에 사용한 항체 클론은 더 이상 상용화되지 않습니다. 그러나, 어떤 항-5-메틸세포신 단일 클론 항체도 유사하게 작동해야 한다. 항체는 MeRIP11,23에사용되기 전에 특이성을 시험해야 한다.</li>
	<li>파라필름으로 튜브를 밀봉하고 오버헤드 회전으로 4°C에서 12-14시간 동안 배양합니다.</li>
	<li>다음 날, 결합을 위한 단백질 G 자기 구슬을 준비합니다.<ol>
<li>각 튜브(IP 또는 모의 제어)에 대해 40 μL의 구슬을 사용하십시오. 15mL 튜브에 총 구슬(## x 40 μL, 예: 2개의 IP 및 2개의 모의 샘플, 160 μL의 비드가 필요) 샘플 당 1x MeRIP 버퍼(예: 튜브 x 800 μL 버퍼, 예: 3.g.g., 3.2m 샘플)를 추가하십시오.</li>
		<li>머리 위 회전으로 실온에서 5 분 동안 세척을 수행하고, 자기 랙의 도움으로 구슬을 수집하고 세척 버퍼를 폐기하십시오. 세 번째 세척 후, 구슬의 초기 부피와 동일한 양의 MeRIP 버퍼 (튜브 x 40 μL, 예를 들어, 2 IP 및 2 모의 샘플에 대한 1x MeRIP 버퍼의 160 μL)의 동일한 볼륨으로 구슬을 다시 중단합니다. 참고: 사용되는 단백질 G 비드의 양은 특정 항체 유형 및 사용되는 항체의 양에 대한 구슬의 결합 용량에 의해 결정됩니다. 이 경우, 구슬은 구슬 의 mg 당 마우스 IgG의 약 8 μg와 30 mg/mL 농도의 결합 용량을 갖는다. 따라서 40 μL은 항체의 약 9.6 μg를 결합하기에 충분합니다.</li>
	</ol>
</li>
	<li>각 IP 및 모의 샘플에 40 μL의 재일시 적구를 추가하고 오버 헤드 회전과 함께 4 °C에서 추가 로 2 시간 동안 배양하십시오.</li>
	<li>튜브를 자기 랙에 1분 동안 놓고 상체를 폐기하거나 컨트롤(비바운드 RNA 샘플)으로 저장합니다.</li>
	<li>구슬을 0.01% Tween 20으로 공급하고 오버헤드 회전이 있는 실온에서 10분 동안 인큐베이팅하여 1x MeRIP 버퍼의 700 μL로 재연하여 5회 세척합니다.</li>
	<li>단백질제 K 소화 버퍼의 200 μL에서 세척 된 구슬을 다시 중단하고 50 °C에서 3 시간 동안 Proteinase K. 인큐베이트의 3.5 μL을 추가하여 800 rpm에서 흔들어. 때때로, 배양 중에 구슬의 퇴적물이 형성되는 경우 튜브의 바닥을 수동으로 쓸어.</li>
	<li>RNA 추출 시약의 800 μL을 첨가하여 RNA를 추출하고 산과나디늄 티오시네이트-페놀-클로로폼 추출 프로토콜에 따라 1.2단계에서와 같이 계속한다. RNA 펠릿의 가시성을 높이기 위해 강수 단계에서 이소프로판올에 착색 된 강수제를 첨가 할 수 있습니다. RNase 가 없는 H2O의 20 μL에서 펠릿을 다시 중단합니다(또는 2.3단계에서 보관된 입력 부피와 동일).</li>
</ol>3. 다운스트림 분석
<ol><li>50개의 베이스 판독 길이(SE50)로 단일 단단 시퀀싱을 위한 입력 및 IP 샘플을 제출합니다.</li>
	<li>cutadapt41을 사용하여 3' 엔드 어댑터를 자르고 48NT보다 짧은 읽기를 폐기합니다.</li>
	<li>맵 트리밍은 STAR42를 사용하여 아라비놈게놈(TAIR10 주석)을 읽고, 불일치에 대한 6%의 컷오프와 최대 인트론 크기는 10kb입니다. 추가 분석을 위해 고유하게 매핑된 읽기를 유지합니다.</li>
	<li>두 가지 방법을 사용하여 입력에 비해 IP 샘플에서 농축 RNA 단편을 식별하고 두 가지 모두에 의해 현저하게 농축 된 것으로 발견되는 것을 고려하십시오.<ol>
<li>먼저 풀이 된 IP대 입력에서 MACS2 피크호출자(43)를 사용하여 MeRIP-seq 피크를 감지합니다.</li>
		<li>둘째, 마이어 외22 및 양 외17에설명된 바와 같이 MeRIP-seq 피크 호출에 대한 분석을 따르십시오.<ol>
<li>사용자 지정 R 스크립트를 사용하여, 뚜렷한 25 nt 창에서 게놈을 분할하고 마지막 매핑된 뉴클레오티드의 위치에 따라 각 창에 대해 고유하게 매핑된 읽기수를 계산합니다(읽기는 100nt RNA 단편에서 유래하기 때문에).</li>
			<li>피셔 정확한 테스트를 통해 입력에 비해 IP 샘플에서 상당히 농축된 창을 계산합니다.</li>
			<li>적어도 두 개의 연속 창에 걸쳐 상당히 농축 된 피크를 유지하고 하나의 창을 덮는 피크를 폐기합니다.</li>
		</ol>
</li>
	</ol>
</li>
	<li>두 방법 모두에서 발견되는 유전체(성적증명서)의 부도가 된 영역을 식별합니다.</li>
	<li>대안적으로 또는 보완적으로, IP 샘플에서 의 농축을 위한 특정 RNA 표적을 시험한다.<ol>
<li>무작위 hexamers와 RNA (입력, IP 및 모의 샘플의 동일한 볼륨)를 전사.</li>
		<li>ΔΔCt 방법을 통해 입력, IP 및 모의를 비교하여 선택한 대상에서 정량적 실시간 PCR을 수행합니다. 참고: 생성된 제품은 평균 조각화 크기이기 때문에 생성된 제품이 100bp를 초과해서는 안 됩니다.</li>
	</ol>
</li>
</ol>

저자는 공개 할 이해상충이 없습니다.

RNA는 에피레미네임(44)을 형성하는 100개 이상의 뚜렷한 염기 변형4를 운반한다. 이러한 수정은 번역 및 신호의 추가조절 계층을 추가합니다(5,6,8,20,45,46에서검토됨). 초기 연구는 RNA28,47에 전사 후 수정의 존재를 검출할 수 있었습니다 그러나 특정 수정한 RNA는 epitranscriptomics의 역할을 이해하기 위하여 확인될 필요가 있습니다. MeRIP는 RNA 메틸화 부위 를 매핑하는 방법으로 설계되었다 전사 적 폭21,22. 특정 항체가 가능한 경우 어떤 수정에 적응할 수 있다.
이 프로토콜의 주요 강점은 RNA 및 사용자(예를 들어, 5-azaC는 식물과 인간에게 매우 독성이 있음)에 비교적 간단하며 안전하며 서열 또는 효소 정보를 수정할 필요가 없다는 것입니다. 더욱이, IP에 의한 메틸화 된 RNA의 농축은 농축 단계를 포함하지 않는 비설피테 시퀀싱과 달리 검출될 가능성이 낮다. MeRIP의 두 개의 직렬 탄환이 수행되면, 메틸화 부위를 포함하는 RNA 단편의 농축은22더증가한다. MeRIP의 한계 중 하나는 특히 mRNA 메틸화 연구에 적용될 때 분석에 대한 입력으로 요구되는 다량의 RNA이다. 리보데플레이션 – 또는 폴리(A) 농축 – 단계는 심하게 변형된 리보소말 RNA에 기인한 배경을 감소시키지만 총 RNA의 90% 이상을 제거합니다. DNA는 또한 5메틸화 된 사이토신이 풍부하기 때문에 완전히 제거해야합니다. 또 다른 단점은 메틸화의 정확한 위치의 낮은 해상도입니다. 항체를 가진 잠복하기 전에 RNA의 초음파 처리는 100-200 뉴클레오티드로 수정을 포함하는 영역을 좁혀서 이 방향을 향해 돕는다. MeRIP가 심층 시퀀싱과 결합되면 시퀀싱 판독이 잠재적메틸화 부위 를 중심으로 가우시안 분포를 형성함에 따라 m5C 사이트 예측의 해상도가 증가합니다. 추가적으로, 항체의 특이성은 분석(예를 들어, RNA 도트 블롯 분석, 수정된 뉴클레오티드로 합성된 올리고체로 수행됨) 이전에 확인되어야 하지만, 항체가 실제로 밀접하게 관련된 수정(예를 들어, m6A 및 m6Am)을구별할 수 있는 정도까지는48,499의분야에서 논쟁의 포인트이다. 더욱이, 고도로 구조화된 RNA는 항체-항원 상호작용을 방해할 수 있으며, IP 이전에 RNA의 단편화 및 탈약으로 주로 해결되는 또 다른 제한이다. 반대로, 이차 구조물에 의해도 영향을 받는 비설피테 염기서열분석은 단편화 단계를 포함하지 않으며, 이는 비설피테 시퀀싱16 및 MeRIP-seq11,17에의해 예측된m5C 사이트와 mRNA 사이의 불일치를 유발하는 한 가지 이유가 될 수 있다. 다른 사이토신 변형 (예를 들어, hm5C)도 비설피티 중재 탈약(35)에내성이 있습니다.
MeRIP-seq의 변형은 광액활성 리보뉴클레오시드(사진-크로스링크-어시스트 m6A-seq, PA-m6A-seq 50)또는 UV 라이트를 이용하여 IP(miCLIP49,미클립에 설명된 miCLIP-30, 미CLIP-30)의 도입과 다른 방법)을 도입한 교차연결 단계를 포함한다. 미래에, RNA 메틸화에 대한 지식이 축적됨에 따라, 메틸화가 나타나는 효소 및/또는 합의 서열에 기초하여 더 많은 표적 접근법이 바람직할 수 있다. 독자 단백질의 식별은 전사 후 수정의 분자 및 신호 기능에 대한 이해에 필수적입니다. 나노포어 시퀀싱 기술은 이미 RNA17의 사전 치료 없이 수정된 뉴클레오티드의 직접 식별을 허용하지만, 서열 깊이 및 생물정보 분석에 관한 이 분야에 대한 개선의 여지가 여전히 존재한다. 전반적으로, MeRIP-seq는 현재 메틸화 된 RNA 전사체를 식별하기 위해 확립되고 신뢰할 수 있으며 편견없는 접근 방식입니다.

An erratum was issued for:&#160;<a href="https://www.jove.com/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.
The author list was updated from:
Eleftheria Saplaoura1, Valentina Perrera2, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua
to:
Eleftheria Saplaoura1, Valentina Perrera2, Vincent Colot3, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua 
3Biologie de l&#39;Ecole Normale Sup&#233;rieure (IBENS),&#160;Paris, France

An erratum was issued for:&#160;<a href="https://www.jove.com/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.

Erratum: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

생명의 모든 세 왕국에서, RNA 종은 전사 후 수정을 겪고 이러한 기능적으로 관련된 생화학 적 변형에 대한 연구는 "epitranscriptomics"라고합니다. 상피학은 성장하는 분야이며 RNA 분자에 대한 수정을 연구하고 매핑하기 위해 다양한 방법이 개발되고있다(1,2에서검토됨). 100개 이상의 RNA 수정이 발견되었으며, rRNA, tRNA, 기타 ncRNAs뿐만 아니라 mRNA3,4에서검출되었다. tRNA 및 rRNA에서 화학적으로 다양한 전사 후 변형의 존재와 기능은광범위하게연구되어 있지만5,6,7,8,최근에만 mRNA 변형이 특징지어지고 있다. 식물에서, 많은 mRNA 수정은 캡 구조9,m 1 A10,hm5C11,12및 소변13에서m7G를 포함하여 현재까지 확인되었다. 그러나, 만 m6A10,14,15,m5C11,16,17, 및 슈도우리딘(18)은 아라비도시스에서 전사를 매핑했다. 전사 후 mRNA 기본 수정은 여러 발달 과정에관여한다(19,20).
상피학에서 가장 일반적으로 사용되는 접근법 중 하나는 깊은 시퀀싱 (MeRIP-seq)과 결합 된 메틸화 RNA 면역 침전입니다. MeRIP-seq는 2012년에 포유류 세포21,22에서m6A를 연구하기 위해 개발되었다. 원하는 변형을 위해 항체의 사용을 요구하고 변형된 뉴클레오티드(들)를 운반하는 RNA 단편을 농축하는 것을 목표로 한다. 그것은 일반적으로 특정 RNA 표적을 확인하기 위하여 농축된 단편 또는 정량PCR을 확인하고 지도하기 위하여 깊은 순서에 선행됩니다. MeRIP의 정확도는 유사한 수정(예를 들어, m5C 및 hm5C11,23)을통해 수정된 뉴클레오티드를 인식하기 위해 항체의 특이성에 기초한다. m6A 외에, MeRIP-seq는 또한 여러유기체에서m 1 A 및 m5C RNA 메틸화를 연구하도록 적용되었습니다11,17,23,24,25.
제5 탄소 위치(m5C)에서 사이토신의 메틸화는 가장 널리 퍼진 DNA변형(26,27) 및 가장 일반적인 RNA 수정 중 하나도3,4이다. m5C는 1975년28년진핵mRNA에서 검출되었지만, 최근에는 코딩 및 비코딩 RNA11,16,17,23, 29,30,31,32,33, 34로수정 전사를 매핑하는 데 초점을 맞춘 연구가 최근에있다.
m5 CRNA 연구에서 사용되는 대체 방법은 비메틸화 사이토신을 우라실로 화학적 변환(bisulfite 시퀀싱) 및 면역침전 분석법은 알려진 RNA 사이토신 메틸 전달제의 돌이킬 수 없는 결합을 기반으로 RNA 표적(miCLIP, aza-IP)을 포함한다. 간단히 말해서, 비황피테 시퀀싱은 5메틸화 된 시토신의 특징을 우라실에 수정되지 않은 사이토신을 분해하는 비설피트 나트륨 치료에 내성이 있습니다. 이 방법은 DNA를 위해 처음 개발되었지만 RNA에 맞게 조정되었으며 많은연구가 RNA16,23,29,32,34,35에서m5C 부위를 검출하는 이접근법을선택했습니다. miCLIP과 aza-IP 모두 RNA 시토신 메틸 트랜스퍼라제및 각각의 항체의 사용에 대한 이전의 지식을 필요로 한다. miCLIP의 경우(메틸화 개인-뉴클레오티드-해상도 교차 연결 및 면역 침전), 메틸 트랜스퍼라제는 RNA 기판에 결합하지만30을방출할 수 없도록 단일 아미노산 돌연변이를 전달한다. 아자-IP(5-아자시티딘-중재 RNA 면역침전)에서 돌이킬 수 없는 결합은 5-azaC 뉴클레오시드와 RNA 사이균성 메틸전달효소 사이에 형성되며 외인성 제공시 5-아자C는 RNA 폴리머라제에 의해 표적 RNA분자(31)로통합된다.
이 세 가지 방법의 주요 장점은 m5C의 단일 뉴클레오티드 분해능 매핑을 허용한다는 것입니다. 또한, miCLIP 및 aza-IP는 선택된 RNA 사이토신 메틸 트랜스퍼라제의 특정 표적에 대한 정보를 제공하여 전사 후 RNA 수정의 메커니즘과 역할을 더 깊게 해독한다. 그러나, MeRIP-seq 접근법은 사전 지식이 필요 없이 전사 폭 m5C 영역을 식별할 수 있으며, 5-azaC를 가진 bisulfite 처리 또는 잠복과 같은 가혹한 화학 및 온도 조건을 피할 수 있습니다. MeRIP 및 bisulfite 염열은 이차 RNA구조(36)에의해 억제될 수 있다. 면역 침전 전에 MeRIP 분석체에 포함된 단편화 단계는 항체 결합을 용이하게 하고 m5C 식별의 해상도를 높이는 것을 목표로 한다.
언급 할 가치가있는 또 다른 방법은 RNA 뉴클레오시드의 질량 분석법 (MS)입니다. MS는 DNA와 RNA모두에서 모든 유형의 수정을 감지하고 구별할 수 있습니다. 간략하게, RNA는 추출되고 DNase소화되고, 그 때 탈염되고 단 하나 뉴클레오시드로 소화됩니다. RNA 뉴클레오시드는 질량 분광계에 의해 분석된다. 이 방법은 각 수정의 수준을 정량화하는 데 사용할 수 있으며 항체 또는 화학 적 변환에 의존하지 않습니다. 그러나, 주요 단점은 RNA 수정의 존재에 대 한 대량 정보를 제공 하는 것입니다. 수정을 매핑하기 위해 MS는 인간 tRNALeu(CAA)37의경우와 같이 특정 RNA 분자에 대한 RNase 소화 및 시퀀싱 정보와 결합되어야합니다.
여기서, 우리는 설명하고 아라비도시스에서 m5C RNA 메틸화를 연구하는 데 사용되는 MeRIP 분석체를17.

<table><tbody><tr><td>anti-m&lt;sup&gt;5&lt;/sup&gt;C antibody</td><td>ZymoResearch</td><td>A3001 (discontinued), A3002 available</td><td>Clone 10G4 (discontinued), 7D21 available</td></tr><tr><td>Chip and reagents for capillary electrophoresis</td><td>Agilent</td><td>5067-1511</td><td>RNA 6000 Nano kit</td></tr><tr><td>Dnase</td><td>Ambion</td><td>AM1907</td><td>TURBO DNA-free kit</td></tr><tr><td>Co-precipitant of nucleic acids</td><td>Ambion</td><td>AM9515</td><td>Glycoblue, 15 mg/mL</td></tr><tr><td>&lt;em&gt;In vitro&lt;/em&gt; transcription kit</td><td>Promega</td><td>P1300</td><td>T7 RiboMAX Large Scale RNA Production System</td></tr><tr><td>Low-binding reaction tubes</td><td>Kisker Biotech</td><td>G017</td><td>1.7 ml microcentrifuge tubes</td></tr><tr><td>Protein G magnetic beads</td><td>Invitrogen</td><td>10003D</td><td>Dynabeads Protein G</td></tr><tr><td>Proteinase K</td><td>Ambion</td><td>AM2546</td><td>20mg/mL stock solution, RNA grade</td></tr><tr><td>RNase inhibitor</td><td>Promega</td><td>N2615</td><td>RNasin Plus 40 U/&amp;mu;l</td></tr><tr><td>rRNA removal kit</td><td>Epicentre</td><td>RZPL11016</td><td>Ribo-Zero rRNA removal kit (Plant leaf)</td></tr><tr><td>Sonication tubes</td><td>Covaris</td><td>520045</td><td>microtube AFA Fiber Pre-Slit Snap-Cap 6x16mm</td></tr><tr><td>RNA extraction reagent</td><td>Ambion</td><td>15596018</td><td>TRIzol reagent</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Capillary electrophoresis machine</td><td>Agilent</td><td>G2939BA</td><td>2100 Bioanalyzer System</td></tr><tr><td>Magnetic rack</td><td>Invitrogen</td><td>12321D</td><td>DynaMag-2</td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>discontinued</td><td>5417R model</td></tr><tr><td>Rotator</td><td>Benchmark</td><td>R4040</td><td>RotoBot Mini</td></tr><tr><td>Sonicator</td><td>Covaris</td><td>500217</td><td>S220 Focused-ultrasonicator</td></tr><tr><td>Spectrophotometer</td><td>ThermoFisher Scientific</td><td>ND-ONEC-W</td><td>NanoDrop OneC</td></tr><tr><td>Waterbath</td><td>GFL</td><td>1012</td><td>1012 Incubation bath</td></tr></tbody></table>

methylated rna immunoprecipitation assay to study m5c modification in arabidopsis

m5C와 같은 RNA에 대한 이차 염기 수정은 변형된 RNA 분자의 구조및 기능에 영향을 미칩니다. 메틸화 RNA 면역 침전 및 시퀀싱 (MeRIP-seq)은 메틸화 된 RNA를 풍부하게하고 궁극적으로 수정 된 성적 증명서를 식별하는 것을 목표로하는 방법입니다. 간략하게, 초음파 처리된 RNA는 5-메틸화 된 사이토신을 위한 항체로 배양되고 단백질 G 비드의 도움으로 침전됩니다. 농축된 조각은 시퀀스되고 잠재적인 메틸화 사이트는 읽기 및 피크 검출의 분포를 기반으로 매핑됩니다. MeRIP는 어떤 이전 서열 또는 효소 지식을 수정할 필요가 없기 때문에 어떤 유기체든지에 적용될 수 있습니다. 또한, 단편화 외에 RNA는 다른 화학적 또는 온도 처리를 거치지 않는다. 그러나, MeRIP-seq는 메틸화 부위를 다른 방법으로메틸화 부위의 단일 뉴클레오티드 예측을 제공하지 않지만, 메틸화 부위는 몇 가지 뉴클레오티드로 좁힐 수 있다. 상이한 변형 특이적 항체의 사용은 MeRIP가 RNA에 존재하는 상이한 기저 변형을 위해 조정될 수 있게 하여, 이 방법의 가능한 적용을 확대한다.

방법의 회로도는 도 1에제공됩니다. 프로토콜의 첫 번째 중요한 단계는 좋은 품질의 RNA를 얻고 (RIN ≥ 7) 약 100 nt 단편으로 초음파 처리된다. 두 단계의 효율은 칩 기반 모세관 전기 포근 기계에 의해 검사됩니다. 도 2A에서,양호한 RNA 샘플의 대표적인 실행이 도시된다. 샘플은 사용되는 키트의 검출 범위(5-5-500 ng/μL)에 있는 농도를 갖기 위해 칩에 적재하기 전에 1:10을 희석한다. 동일한 샘플도 초음파 처리 후 실행되며 도 2B에표시됩니다. 약 100개의 뉴클레오티드 의 크기로 다이어그램의 왼쪽으로 이동한 하나의 균일한 피크의 존재를 주목한다. 낮은 농도는 단편화 중 RNA의 손실뿐만 아니라 시료의 부피 증가(60-100 μL, 단계 1.7.1)로 인해 발생합니다.
IP 및 모의 샘플의 품질은 qRT-PCR에 의해 평가될 수 있다. 이를 위해, 스파이크인 IVT는 긍정적이고 부정적인 대조군 역할을 합니다: 모든 사이토신 위치에서 m5C가 있는 메틸화 IVT는 IP 샘플에서 매우 풍부해질 것으로 예상됩니다. 반대로, 비메틸화 IVT는 IP와 Mock의 차이가 없어야 합니다. 두 컨트롤 IVTs(EGFP 및 레닐라 루시파라라제)에 대한 qRT-PCR 분석에 사용되는 프라이머는 표 1에나열됩니다. 실제로, 도 3에도시된 바와 같이, 메틸화 IVT의 약 80%가 IP 샘플에서 회수되었고, 모의에서는 약 2%에 불과했다. 메틸화되지 않은 컨트롤의 경우 IP 및 모의 샘플 모두에서 회복이 1% 미만이었습니다. 이는 메틸화된 RNA 단편이 침전되고 농축되었다는 MeRIP의 효율을 검증하며, 시료가 다운스트림 분석에 사용될 수 있다는 좋은 지표이다. 또한, 비메틸화 IVT(IP 대 모의 비율)의 접이식 농축은 qRT-PCR 분석에서 농축의 중요성을 추정하기 위한 임계값으로 적용될 수 있다.
판독을 게놈(도4)에정렬한 후, 단계 3.4.1 및 3.4.2 단계에 기재된 피크 호출 알고리즘이 적용되어 입력에 비해 IP 샘플에서 농축된 통계적으로 유의한 창을 식별한다. 이러한 창에 대응하는 시퀀스는 보존된 메틸화 관련모티프(11,17)를검색하는 등 더 사용될 수 있다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61231/61231fig01.jpg"> 그림 1: MeRIP-seq 프로토콜의 회로도 표현. RNA 샘플은 5-메틸화 된 사이토신에 대한 항체로 배양되고 복합체는 결합 된 RNA와 함께 항체를 캡처하는 단백질 G 자기 구슬로 당겨. 용출된 RNA 샘플은 심층 염기서열 분석 및 qRT-PCR에 의해 분석됩니다. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61231/61231fig02.jpg"> 그림 2: RNA 샘플의 품질 분석에서 대표적인 결과. (A)자격을 갖춘 총 RNA 식물 샘플의 대표적인 프로파일. (B)초음파 처리 후 RNA 샘플의 대표적인 프로파일을 100 nt 단편으로 하였다. 모세관 전기 포근 소프트웨어에서 출력 파일. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61231/61231fig03.jpg"> 그림 3: 제어 IVT의 qRT-PCR 분석. 체외 내 메틸화 및 비메틸화 된 메틸화 된 MeRIP 분석기의 긍정적이고 부정적인 제어로 각각 사용되었습니다. 면역 침전 후, 메틸화 IVT는 IP 샘플(녹색)에서 매우 농축되지만 모의 샘플에서는 그렇지 않습니다(항m5C항체; 보라색 제외). 메틸화되지 않은 IVT는 IP와 Mock의 농축과 차이가 없음을 보여주었습니다. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/61231/61231fig04.jpg"> 그림 4: 대표적인 성적증명서 주위에 MeRIP 전후의 정렬을 읽어보십시오. 입력 샘플(위쪽 행)과 두 개의 IP 복제(가운데 및 아래쪽 행)의 특정 성적증명서에 정렬된 읽기입니다. 블랙 박스는 MACS243 및 MeRIP-seq22 피크 콜링 분석을 기반으로 식별 된 농축 된 50 nt 긴 창을 보여줍니다. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig04large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>대상</td>
			<td colspan="2">프라이머 페어</td>
			<td colspan="2">제품 시퀀스</td>
			<td>제품 길이</td>
		</tr>
<tr>
<td rowspan="2">EGFP</td>
			<td colspan="2">For: 5'-GGCAACTACAAGACCCGCGCC -3'</td>
			<td colspan="2" rowspan="2">GGCAACTACAAGCGCGCCGAG GTGAAGTTCGAGGCGACACTG GTGAACCGCCGAGCTGAAGGGC</td>
			<td rowspan="2">72 bp</td>
		</tr>
<tr>
<td colspan="2">레브: 5'-GCCCTTCAGCTCGTGCGGTT -3'</td>
		</tr>
<tr>
<td rowspan="2">레닐라 루시파라제</td>
			<td colspan="2">에 대 한: 5'- 가가ATAACTTCTCTTCGTGGAAAC -3'</td>
			<td colspan="2" rowspan="2">가가와타액트CTCTTCGTGGAACC ATGTTGCCATCAAAAAAAATCATCATGAGAA 아그타가아치아가아가아가트가가이타트GC</td>
			<td rowspan="2">75 bp</td>
		</tr>
<tr>
<td colspan="2">레브: 5'-GCTGCAAATTCTCTCTCTCTAA -3'</td>
		</tr>
</tbody></table>표 1: qRT-PCR 분석을 위한 프라이머 및 생성된 제품에 대한 정보입니다.
버퍼 레시피. <a href="https://www.jove.com/files/ftp_upload/61231/Buffer%20Recipes%20MeRIP.xlsx" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis at JoVE.com

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

메틸화 RNA 면역 침전 분석법은 메틸화 RNA 단편을 농축하는 데 사용되는 항체 기반 방법입니다. 깊은 시퀀싱과 결합하여 m5C수정을 운반하는 성적 증명서를 식별합니다.

메틸화 RNA 면역 침전 분석연구 m5C 변형에 대한 애비독증

Secondary base modifications on RNA, such as m5C, affect the structure and function of the modified RNA molecules. Methylated RNA Immunoprecipitation and ...

methylated-rna-immunoprecipitation-assay-to-study-m5c-modification

Research

JoVE Journal

Genetics

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

6.5K 조회수.  Max Planck Institute of Molecular Plant Physiology. 메틸화 RNA 면역 침전 분석법은 메틸화 RNA 단편을 농축하는 데 사용되는 항체 기반 방법입니다. 깊은 시퀀싱과 결합하여 m5C수정을 운반하는 성적 증명서를 식별합니다.

비디오: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

A Method for Measuring RNA N6-methyladenosine Modifications in Cells and Tissues

N6-Methyladenosine (m6A) modifications of RNA are diverse and ubiquitous amongst eukaryotes. They occur in mRNA, rRNA, tRNA, and microRNA. Recent studies have revealed that these reversible RNA modifications affect RNA splicing, translation, degradation, and localization. Multiple physiological processes, like circadian rhythms, stem cell pluripotency, fibrosis, triglyceride metabolism, and obesity are also controlled by m6A modifications. Immunoprecipitation/sequencing, mass spectrometry, and modified northern blotting are some of the methods commonly employed to measure m6A modifications. Herein, we present a northeastern blotting technique for measuring m6A modifications. The current protocol provides good size separation of RNA, better accommodation and standardization for various experimental designs, and clear delineation of m6A modifications in various sources of RNA. While m6A modifications are known to have a crucial impact on human physiology relating to circadian rhythms and obesity, their roles in other (patho)physiological states are unclear. Therefore, investigations on m6A modifications have immense possibility to provide key insights into molecular physiology.

A Method for Measuring RNA N6-methyladenosine Modifications in Cells and Tissues

A modified northern blotting method for measuring N6-methyladenosine (m6A) modifications in RNA is described. The current method can detect modifications in diverse RNAs and controls under various experimental designs.

RNA 측정 방법<em&gt; N</em<sup&gt; 6</sup세포와 조직에서&gt; -methyladenosine 수정

N6-Methyladenosine (m6A) modifications of RNA are diverse and ubiquitous amongst eukaryotes. They occur in mRNA, rRNA, tRNA, and microRNA. Recent studies ...

연구

생화학

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

DNA 수정에 대 한 Immunostaining: 공초점 이미지의 계산 분석

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

유전학

Antibody-Free Assay for RNA Methyltransferase Activity Analysis

There are more than 100 chemically distinct modifications of RNA, two thirds of which consist of methylations. Interest in RNA modifications, and especially methylations, has re-emerged due to the important roles played by the enzymes that write and erase them in biological processes relevant to disease and cancer. Here, a sensitive in vitro assay for accurate analysis of RNA methylation writer activity on synthetic or in vitro transcribed RNAs is provided. This assay uses a tritiated form of S-adenosyl-methionine, resulting in direct labeling of methylated RNA with tritium. The low energy of tritium radiation makes the method safe, and pre-existing methods of tritium signal amplification, make it possible to quantify and to visualize the methylated RNA without the use of antibodies, which are commonly prone to artifacts. While this method is written for RNA methylation, few tweaks make it applicable to the study of other RNA modifications that can be radioactively labeled, such as RNA acetylation with 14C acetyl coenzyme A. Overall, this assay allows to quickly assess RNA methylation conditions, inhibition with small molecule inhibitors, or the effect of RNA or enzyme mutants, and provides a powerful tool to validate and expand results obtained in cells.

Here, an antibody-free in vitro assay for direct analysis of methyltransferase activity on synthetic or in vitro transcribed RNA is described.

RNA 메틸 트랜스퍼라제 활성 분석을 위한 항체 무첨가 분석

There are more than 100 chemically distinct modifications of RNA, two thirds of which consist of methylations. Interest in RNA modifications, and ...

Immunohistochemical Detection of 5-Methylcytosine and 5-Hydroxymethylcytosine in Developing and Postmitotic Mouse Retina

The epigenetics of retinal development is a well-studied research field, which promises to bring a new level of understanding about the mechanisms of a variety of human retinal degenerative diseases and pinpoint new treatment approaches. The nuclear architecture of mouse retina is organized in two different patterns: conventional and inverted. Conventional pattern is universal where heterochromatin is localized to the periphery of the nucleus, while active euchromatin resides in the nuclear interior. In contrast, inverted nuclear pattern is unique to the adult rod photoreceptor cell nuclei where heterochromatin localizes to the nuclear center, and euchromatin resides in the nuclear periphery. DNA methylation is predominantly observed in chromocenters. DNA methylation is a dynamic covalent modification on the cytosine residues (5-methylcytosine, 5mC) of CpG dinucleotides that are enriched in the promoter regions of many genes. Three DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) participate in methylation of DNA during development. Detecting 5mC with immunohistochemical techniques is very challenging, contributing to variability in results, as all DNA bases including 5mC modified bases are hidden within the double-stranded DNA helix. However, detailed delineation of 5mC distribution during development is very informative. Here, we describe a reproducible technique for robust immunohistochemical detection of 5mC and another epigenetic DNA marker 5-hydroxymethylcytosine (5hmC), which colocalizes with the &#34;open&#34;, transcriptionally active chromatin in developing and postmitotic mouse retina.

The objective of this report is to describe the protocol for robust immunohistochemical detection of epigenetic markers, 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) in developing and postmitotic mouse retina.

5-Methylcytosine 개발에 5-Hydroxymethylcytosine의 Immunohistochemical 검출 및 Postmitotic 마우스 망막

The epigenetics of retinal development is a well-studied research field, which promises to bring a new level of understanding about the mechanisms of a ...

발생학

Characterizing RNA Modifications in Single Neurons Using Mass Spectrometry

Post-transcriptional modifications (PTMs) of RNA represent an understudied mechanism involved in the regulation of translation in the central nervous system (CNS). Recent evidence has linked specific neuronal RNA modifications to learning and memory paradigms. Unfortunately, conventional methods for the detection of these epitranscriptomic features are only capable of characterizing highly abundant RNA modifications in bulk tissues, precluding the assessment of unique PTM profiles that may exist for individual neurons within the activated behavioral circuits. In this protocol, an approach is described&#8212;single-neuron RNA modification analysis by mass spectrometry (SNRMA-MS)&#8212;to simultaneously detect and quantify numerous modified ribonucleosides in single neurons. The approach is validated using individual neurons of the marine mollusk, Aplysia californica, beginning with surgical isolation and enzymatic treatment of major CNS ganglia to expose neuron cell bodies, followed by manual single-neuron isolation using sharp needles and a micropipette. Next, mechanical and thermal treatment of the sample in a small volume of buffer is done to liberate RNA from an individual cell for subsequent RNA digestion. Modified nucleosides are then identified and quantified using an optimized liquid chromatography-mass spectrometry method. SNRMA-MS is employed to establish RNA modification patterns for single, identified neurons from A. californica that have known morphologies and functions. Examples of qualitative and quantitative SNRMA-MS are presented that highlight the heterogeneous distribution of RNA modifications across individual neurons in neuronal networks.

Post-transcriptional modifications of RNA represent an understudied layer of translation regulation that has recently been linked to central nervous system plasticity. Here, sample preparation and liquid chromatography-tandem mass spectrometry approach is described for simultaneous characterization of numerous RNA modifications in single neurons.

질량 분광법을 사용하여 단일 뉴런의 RNA 변형 특성화

Post-transcriptional modifications (PTMs) of RNA represent an understudied mechanism involved in the regulation of translation in the central nervous ...

화학

Determination of DNA Methylation of Imprinted Genes in Arabidopsis Endosperm

Arabidopsis thaliana is an excellent model organism for studying epigenetic mechanisms. One of the reasons is the loss-of-function null mutant of DNA methyltransferases is viable, thus providing a system to study how loss of DNA methylation in a genome affects growth and development. Imprinting refers to differential expression of maternal and paternal alleles and plays an important role in reproduction development in both mammal and plants. DNA methylation is critical for determining whether the maternal or paternal alleles of an imprinted gene is expressed or silenced. In flowering plants, there is a double fertilization event in reproduction: one sperm cell fertilizes the egg cell to form embryo and a second sperm fuses with the central cell to give rise to endosperm. Endosperm is the tissue where imprinting occurs in plants. MEDEA, a SET domain Polycomb group gene, and FWA, a transcription factor regulating flowering, are the first two genes shown to be imprinted in endosperm and their expression is controlled by DNA methylation and demethylation in plants. In order to determine imprinting status of a gene and methylation pattern in endosperm, we need to be able to isolate endosperm first. Since seed is tiny in Arabidopsis, it remains challenging to isolate Arabidopsis endosperm and examine its methylation. In this video protocol, we report how to conduct a genetic cross, to isolate endosperm tissue from seeds, and to determine the methylation status by bisulfite sequencing.

Determination of DNA Methylation of Imprinted Genes in Arabidopsis Endosperm

Imprinting is a phenomenon in plant and mammal reproduction. DNA methylation plays an important role in mechanisms of imprinting. Isolating endosperm and determining methylation status of imprinted genes in Arabidopsis can be difficult. In this protocol, we describe how to isolate endosperm and determine methylation by bisulfite sequencing.

에 각인 유전자의 DNA Methylation의 결정 Arabidopsis 배젖

Arabidopsis thaliana is an excellent model organism for studying epigenetic mechanisms. One of the reasons is the loss-of-function null mutant of DNA ...

생물학

Detection of Histone Modifications in Plant Leaves

Chromatin structure is important for the regulation of gene expression in eukaryotes. In this process, chromatin remodeling, DNA methylation, and covalent modifications on the amino-terminal tails of histones H3 and H4 play essential roles1-2. H3 and H4 histone modifications include methylation of lysine and arginine, acetylation of lysine, and phosphorylation of serine residues1-2. These modifications are associated either with gene activation, repression, or a primed state of gene that supports more rapid and robust activation of expression after perception of appropriate signals (microbe-associated molecular patterns, light, hormones, etc.)3-7. 
Here, we present a method for the reliable and sensitive detection of specific chromatin modifications on selected plant genes. The technique is based on the crosslinking of (modified) histones and DNA with formaldehyde8,9, extraction and sonication of chromatin, chromatin immunoprecipitation (ChIP) with modification-specific antibodies9,10, de-crosslinking of histone-DNA complexes, and gene-specific real-time quantitative PCR. The approach has proven useful for detecting specific histone modifications associated with C4 photosynthesis in maize5,11 and systemic immunity in Arabidopsis3.

A reliable and useful approach to detect histone modifications on specific plant genes is described. The approach combines chromatin immunoprecipitation (ChIP) and real-time quantitative PCR. It allows detection of histone modifications on specific genes with a role in diverse physiological processes.

식물 잎에서 히스톤 수정을 감지

Chromatin structure is important for the regulation of gene expression in eukaryotes. In this process, chromatin remodeling, DNA methylation, and covalent ...

The Detection of 5-Hydroxymethylcytosine in Neural Stem Cells and Brains of Mice

Multiple&#160;DNA modifications have been identified in the mammalian genome. Of that, 5-methylcytosine and 5-hydroxymethylcytosine-mediated epigenetic mechanisms have been intensively studied. 5-hydroxymethylcytosine displays dynamic features during embryonic and postnatal development of the brain, plays a regulatory function in gene expression, and is involved in multiple neurological disorders. Here, we describe the detailed methods including immunofluorescence staining and&#160;DNA dot-blot to detect 5-hydroxymethylcytosine in cultured cells and brain tissues of mouse.

Here, we present a protocol to detect 5-hydroxymethylcytosine in cells and brain tissues, utilizing immunofluorescence staining and DNA dot-blot methods.

신경 줄기 세포와 쥐의 뇌에서 5-하이드록시메틸시토신의 검출

Multiple&#160;DNA modifications have been identified in the mammalian genome. Of that, 5-methylcytosine and 5-hydroxymethylcytosine-mediated epigenetic ...

신경과학

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

애기 장대 단백질 DNA 상호 작용의 식별을위한 염색질 면역 침전 분석<em&gt; 생체</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Exploring m6A and m5C Epitranscriptomes upon Viral Infection: an Example with HIV

The role of RNA modifications in biological processes has been the focus of an increasing number of studies in the last few years and is known nowadays as epitranscriptomics. Among others, N6-methyladenosine (m6A) and 5-methylcytosine (m5C) RNA modifications have been described on mRNA molecules and may have a role in modulating cellular processes. Epitranscriptomics is thus a new layer of regulation that must be considered in addition to transcriptomic analyses, as it can also be altered or modulated by exposure to any chemical or biological agent, including viral infections.
Here, we present a workflow that allows analysis of the joint cellular and viral epitranscriptomic landscape of the m6A and m5C marks simultaneously, in cells infected or not with the human immunodeficiency virus (HIV). Upon mRNA isolation and fragmentation from HIV- infected and non-infected cells, we used two different procedures: MeRIP-Seq, an RNA immunoprecipitation-based technique, to enrich for RNA fragments containing the m6A mark and BS-Seq, a bisulfite conversion-based technique, to identify the m5C mark at a single nucleotide resolution. Upon methylation-specific capture, RNA libraries are prepared for high-throughput sequencing. We also developed a dedicated bioinformatics pipeline to identify differentially methylated (DM) transcripts independently from their basal expression profile.
Overall, the methodology allows exploration of multiple epitranscriptomic marks simultaneously and provides an atlas of DM transcripts upon viral infection or any other cell perturbation. This approach offers new opportunities to identify novel players and novel mechanisms of cell response, such as cellular factors promoting or restricting viral replication.

Exploring m6A and m5C Epitranscriptomes upon Viral Infection: an Example with HIV

The role of RNA modifications in viral infections is just starting to be explored and could highlight new viral-host interaction mechanisms. In this work, we provide a pipeline to investigate m6A and m5C RNA modifications in the context of viral infections.

바이러스 감염시 m6A 및 m5C 에피레미테롬 탐험: HIV를 가진 예

The role of RNA modifications in biological processes has been the focus of an increasing number of studies in the last few years and is known nowadays as ...

메틸화 RNA 면역 침전 분석연구 m⁵C 변형에 대한 애비독증

요약

더 많은 비디오 탐색

이 비디오의 챕터

RNA 측정 방법