이 작품은 E.S에 IMPRS 박사 학위 급여에 의해 지원되었다, V.P.에 EMBO 장기 펠로우십, 이 작품의 일부에 MPI-MPP 내부 자금은 PLAMORF를 통해 지원되었다, 유럽 연합 (EU의 호라이즌 2020 연구 및 혁신 프로그램)에 따라 유럽 연구 위원회 (ERC)에서 자금을받은 프로젝트 (그랜트 No.81) 연구 및 혁신 프로그램 (그랜트 No.) 81. 저자는 생물 정보 학에 대한 생물 학적 분석및 의견에 대한 페데리코 아펠트, 생물 정보 학적 분석을위한 마티유 바힌과 아미라 크람디에게 감사드립니다.

1. RNA 준비
<ol><li>분쇄 200 액체 질소분말 식물 조직의 mg, 조직이 절차를 통해 냉동 남아 있는지 확인.</li>
	<li>산 구아니늄 티오시네이트-페놀-클로로폼 추출 프로토콜에 따라 원하는 식물 조직으로부터 RNA를 추출한다. 상 분리 시 DNA로 RNA를 오염시킬 가능성을 줄이려면 클로로폼 대신 1-브로모-3-클로로프로판을 사용하십시오.<ol>
<li>분쇄된 식물 조직에 구아니딘 티오야네이트 및 산 페놀을 함유한 RNA 추출 시약 1mL을 추가합니다(100 mg 조직당 500 μL). 반전하여 잘 섞어서 모든 조직이 젖었는지 확인하십시오. 리보뉴클레오단백질 복합체를 해리하기 위해 실온에서 10분 동안 배양한다.</li>
		<li>원심분리기는 4°C에서 12,000 x g에서 10분 동안, 새로운 1.5mL 튜브로 상류부를 이송한다.</li>
		<li>1-브로모-3-클로로프로판(500μL RNA 추출 시약당 100μL)의 200 μL을 넣고 소용돌이를 적극적으로 넣습니다.</li>
		<li>원심분리기는 4°C에서 12,000 x g에서 15분 동안 원심분리기를 새로운 1.5mL 튜브로 상부 수성 상(약 500 μL)으로 이송한다.</li>
		<li>이소프로판올(500 μL)과 3M 아세테이트 pH 5.5(50 μL)의 0.1부피를 추가하면 -20°C에서 10분 반전하여 잘 섞는다. 참고: RNA 강수량을 향상시키기 위해 아세테이트 나트륨(NaOAc)을 사용하는 것이 좋습니다. 프로토콜은 몇 시간 또는 하룻밤 동안 RNA의 강수량을 연장하여이 시점에서 일시 중지 할 수 있습니다.</li>
		<li>원심분리기는 4°C에서 12,000 x g에서 30분 동안 원심분리기를 폐기하고 상류부를 폐기합니다.</li>
		<li>펠릿을 80% EtOH의 500 μL로 두 번 세척하고, 원심분리기는 4°C에서 12,000 x g에서 5분 동안 세척하고 폐기하십시오.</li>
		<li>펠릿을 500 μL 99% EtOH로 한 번 씻고, 원심분리기는 4°C에서 12,000 x g에서 5분 동안 세척하고 폐기하십시오.</li>
		<li>펠릿을 5-10분 동안 건조시키고 RNase 가 없는 H2O의 30 μL로 용해하십시오. 참고: 대신, 선택의 임의의 RNA 추출 프로토콜(예: 열 기반 시스템)을 사용하십시오. DNase 소화가 프로토콜에 포함된 경우 다음 단계(1.3단계)에서 건너뛰세요.</li>
	</ol></li>
	<li>RNA 농도(예를 들어, 분광계를 사용하여)를 측정하고 DNase를 사용하여 RNA의 20 μg를 소화한다. 참고: DNA는 m5C가 풍부하고 항체는 DNA와 RNA를 구별하지 않습니다.<ol>
<li>전형적인 DNase 반응에서, 50 μL 반응에서 RNA의 10 μg를 치료하십시오. 다음 성분을 혼합하고 반응(들)을 37°C에서 30분 동안 배양한다. RNA x μL 10 μg 10x DNase 버퍼 5 μL DNase 1 μL (2 단위) RNase 프리 H2O 최대 50 μL</li>
		<li>적절한 양의 DNase 비활성화 시약(DNase 키트에 포함되고 제조업체의 지침에 따라)을 추가하거나 정리 단계(예: 열 정화 또는 페놀/클로로폼 추출)를 수행하여 효소를 제거하십시오.</li>
	</ol></li>
	<li>모세관 전기포고에 의해 절연 된 RNA의 품질과 순도를 확인하고 RNA 무결성 번호 (RIN)가 7 보다 높은 경우, 샘플이 좋은 품질의 지확인합니다.</li>
	<li>선택 사항: rRNA 제거 키트를 사용하여 제조업체의 프로토콜에 따라 mRNA 함량의 샘플을 풍부하게 하기 위해 리보소말 RNA를 제거합니다.<ol>
<li>rRNA 고갈 반응(들)을 위해 이전 단계에서 DNase 처리된 RNA를 사용한다. 총 RNA의 양이 반응에 대해 제안된 최대 량보다 많은 경우 다중 반응을 수행한다.</li>
		<li>rRNA 고갈 후 입력 금액의 5-10%만 회수됩니다. rRNA 고갈 RNA (모든 샘플에 대해 동일한 양)를 진행하고 총 RNA를 참조할 때 다음 단계에서 언급 된 양을 무시합니다. 참고: 사용 가능한 rRNA 고갈 방법에 대한 비교 및 설명은 참조 참조 38,39,40을참조하십시오. rRNA는 총 RNA의 주요 부분이며 많은 유기체에서 m5C 메틸화된다.</li>
	</ol></li>
	<li>시험관 내 전사체(IVT)를 미리 준비하여 RNA 서열 조절으로 사용하고 시료에 추가한다.<ol>
<li>시험관 내 전사 키트를 사용하여 두 개의 뚜렷한 IVT를 생산, 비 메틸화 뉴클레오시드와 rCTP가 5 메틸 rCTP로 대체되는 하나 하나, MeRIP에서 각각 부정적이고 긍정적 인 대조군 역할을. 준비된 성적증명서는 EGFP와 레닐라 루시파라제였다. 참고: IVT는 분석중인 유기체의 전사체에 존재해서는 안됩니다. IVT가 동일한 템플릿(예: EGFP 모두)에서 온 경우 두 개의 서로 다른 샘플에 양수 및 음수 제어를 추가합니다. 순서가 다른 경우(예: EGFP 및 Renilla) 동일한 샘플에 추가할 수 있습니다.</li>
		<li>각 샘플에서 3 μg당 0.1 ng IVT를 대조군으로 스파이크합니다.</li>
	</ol></li>
	<li>RNA를 약 100nt 단편으로 초음파 처리합니다. 참고: RNA 전단의 조건은 사전에 조정되어야 하며 각 초음파 처리기마다 다릅니다. 여기에 사용되는 모델의 경우, 초음파 처리는 다음과 같은 조건으로 수행됩니다 : 피크 파워 174, 듀티 팩터 10, 사이클 / 버스트 200, 17 분.<ol>
<li>모든 시료에 대해 동일한 양의 RNA를 초음파 처리하여 총 부피 80 μL(최소 60 μL, 최대 100 μL)에서 샘플당 최소 12μg RNA를 음속화하여 RNase 가 없는 H2O로 채워지도록 합니다.</li>
	</ol></li>
	<li>모세관 전기포에 의한 RNA 시료의 초음파 처리 및 농도의 효율을 확인한다. 단편화된 RNA의 평균 크기는 약 100 nt이어야 합니다.</li>
</ol>2. 메틸화 RNA 면역 침전 (MeRIP)
<ol><li>저결합 튜브에서는 초음파 처리된 RNA 와 RNase 가 없는 H2O를 최대 60 μL(또는 농도에 따라)의 9μg을 추가합니다.</li>
	<li>10분 동안 수조에서 RNA를 70°C로 가열하고 얼음-물 혼합물에서 10분 동안 냉각하여 이차 구조물을 분리한다.</li>
	<li>샘플을 3부로 분할한다: 1/3(20 μL, 60 μL을 단계 2.1에서 채취한 경우)은 입력 샘플로서 -80°C에서 별도의 튜브에 저장된다. 나머지 40 μL을 RNase 가 없는 H2O에서 최대 860 μL로 채운 다음 두 개의 저결합 튜브로 분할합니다: IP용과 모의 제어용 튜브(각 430 μL).</li>
	<li>두 튜브에 추가: 10x MeRIP 버퍼의 50 μL RNase 억제제 의 10 μL 모의 샘플에서 H2O의 10 μL 당 IP 샘플에서 α-m5C 항체(10 μg)의 10 μL 참고: 이전에 사용한 항체 클론은 더 이상 상용화되지 않습니다. 그러나, 어떤 항-5-메틸세포신 단일 클론 항체도 유사하게 작동해야 한다. 항체는 MeRIP11,23에사용되기 전에 특이성을 시험해야 한다.</li>
	<li>파라필름으로 튜브를 밀봉하고 오버헤드 회전으로 4°C에서 12-14시간 동안 배양합니다.</li>
	<li>다음 날, 결합을 위한 단백질 G 자기 구슬을 준비합니다.<ol>
<li>각 튜브(IP 또는 모의 제어)에 대해 40 μL의 구슬을 사용하십시오. 15mL 튜브에 총 구슬(## x 40 μL, 예: 2개의 IP 및 2개의 모의 샘플, 160 μL의 비드가 필요) 샘플 당 1x MeRIP 버퍼(예: 튜브 x 800 μL 버퍼, 예: 3.g.g., 3.2m 샘플)를 추가하십시오.</li>
		<li>머리 위 회전으로 실온에서 5 분 동안 세척을 수행하고, 자기 랙의 도움으로 구슬을 수집하고 세척 버퍼를 폐기하십시오. 세 번째 세척 후, 구슬의 초기 부피와 동일한 양의 MeRIP 버퍼 (튜브 x 40 μL, 예를 들어, 2 IP 및 2 모의 샘플에 대한 1x MeRIP 버퍼의 160 μL)의 동일한 볼륨으로 구슬을 다시 중단합니다. 참고: 사용되는 단백질 G 비드의 양은 특정 항체 유형 및 사용되는 항체의 양에 대한 구슬의 결합 용량에 의해 결정됩니다. 이 경우, 구슬은 구슬 의 mg 당 마우스 IgG의 약 8 μg와 30 mg/mL 농도의 결합 용량을 갖는다. 따라서 40 μL은 항체의 약 9.6 μg를 결합하기에 충분합니다.</li>
	</ol>
</li>
	<li>각 IP 및 모의 샘플에 40 μL의 재일시 적구를 추가하고 오버 헤드 회전과 함께 4 °C에서 추가 로 2 시간 동안 배양하십시오.</li>
	<li>튜브를 자기 랙에 1분 동안 놓고 상체를 폐기하거나 컨트롤(비바운드 RNA 샘플)으로 저장합니다.</li>
	<li>구슬을 0.01% Tween 20으로 공급하고 오버헤드 회전이 있는 실온에서 10분 동안 인큐베이팅하여 1x MeRIP 버퍼의 700 μL로 재연하여 5회 세척합니다.</li>
	<li>단백질제 K 소화 버퍼의 200 μL에서 세척 된 구슬을 다시 중단하고 50 °C에서 3 시간 동안 Proteinase K. 인큐베이트의 3.5 μL을 추가하여 800 rpm에서 흔들어. 때때로, 배양 중에 구슬의 퇴적물이 형성되는 경우 튜브의 바닥을 수동으로 쓸어.</li>
	<li>RNA 추출 시약의 800 μL을 첨가하여 RNA를 추출하고 산과나디늄 티오시네이트-페놀-클로로폼 추출 프로토콜에 따라 1.2단계에서와 같이 계속한다. RNA 펠릿의 가시성을 높이기 위해 강수 단계에서 이소프로판올에 착색 된 강수제를 첨가 할 수 있습니다. RNase 가 없는 H2O의 20 μL에서 펠릿을 다시 중단합니다(또는 2.3단계에서 보관된 입력 부피와 동일).</li>
</ol>3. 다운스트림 분석
<ol><li>50개의 베이스 판독 길이(SE50)로 단일 단단 시퀀싱을 위한 입력 및 IP 샘플을 제출합니다.</li>
	<li>cutadapt41을 사용하여 3' 엔드 어댑터를 자르고 48NT보다 짧은 읽기를 폐기합니다.</li>
	<li>맵 트리밍은 STAR42를 사용하여 아라비놈게놈(TAIR10 주석)을 읽고, 불일치에 대한 6%의 컷오프와 최대 인트론 크기는 10kb입니다. 추가 분석을 위해 고유하게 매핑된 읽기를 유지합니다.</li>
	<li>두 가지 방법을 사용하여 입력에 비해 IP 샘플에서 농축 RNA 단편을 식별하고 두 가지 모두에 의해 현저하게 농축 된 것으로 발견되는 것을 고려하십시오.<ol>
<li>먼저 풀이 된 IP대 입력에서 MACS2 피크호출자(43)를 사용하여 MeRIP-seq 피크를 감지합니다.</li>
		<li>둘째, 마이어 외22 및 양 외17에설명된 바와 같이 MeRIP-seq 피크 호출에 대한 분석을 따르십시오.<ol>
<li>사용자 지정 R 스크립트를 사용하여, 뚜렷한 25 nt 창에서 게놈을 분할하고 마지막 매핑된 뉴클레오티드의 위치에 따라 각 창에 대해 고유하게 매핑된 읽기수를 계산합니다(읽기는 100nt RNA 단편에서 유래하기 때문에).</li>
			<li>피셔 정확한 테스트를 통해 입력에 비해 IP 샘플에서 상당히 농축된 창을 계산합니다.</li>
			<li>적어도 두 개의 연속 창에 걸쳐 상당히 농축 된 피크를 유지하고 하나의 창을 덮는 피크를 폐기합니다.</li>
		</ol>
</li>
	</ol>
</li>
	<li>두 방법 모두에서 발견되는 유전체(성적증명서)의 부도가 된 영역을 식별합니다.</li>
	<li>대안적으로 또는 보완적으로, IP 샘플에서 의 농축을 위한 특정 RNA 표적을 시험한다.<ol>
<li>무작위 hexamers와 RNA (입력, IP 및 모의 샘플의 동일한 볼륨)를 전사.</li>
		<li>ΔΔCt 방법을 통해 입력, IP 및 모의를 비교하여 선택한 대상에서 정량적 실시간 PCR을 수행합니다. 참고: 생성된 제품은 평균 조각화 크기이기 때문에 생성된 제품이 100bp를 초과해서는 안 됩니다.</li>
	</ol>
</li>
</ol>

저자는 공개 할 이해상충이 없습니다.

RNA는 에피레미네임(44)을 형성하는 100개 이상의 뚜렷한 염기 변형4를 운반한다. 이러한 수정은 번역 및 신호의 추가조절 계층을 추가합니다(5,6,8,20,45,46에서검토됨). 초기 연구는 RNA28,47에 전사 후 수정의 존재를 검출할 수 있었습니다 그러나 특정 수정한 RNA는 epitranscriptomics의 역할을 이해하기 위하여 확인될 필요가 있습니다. MeRIP는 RNA 메틸화 부위 를 매핑하는 방법으로 설계되었다 전사 적 폭21,22. 특정 항체가 가능한 경우 어떤 수정에 적응할 수 있다.
이 프로토콜의 주요 강점은 RNA 및 사용자(예를 들어, 5-azaC는 식물과 인간에게 매우 독성이 있음)에 비교적 간단하며 안전하며 서열 또는 효소 정보를 수정할 필요가 없다는 것입니다. 더욱이, IP에 의한 메틸화 된 RNA의 농축은 농축 단계를 포함하지 않는 비설피테 시퀀싱과 달리 검출될 가능성이 낮다. MeRIP의 두 개의 직렬 탄환이 수행되면, 메틸화 부위를 포함하는 RNA 단편의 농축은22더증가한다. MeRIP의 한계 중 하나는 특히 mRNA 메틸화 연구에 적용될 때 분석에 대한 입력으로 요구되는 다량의 RNA이다. 리보데플레이션 – 또는 폴리(A) 농축 – 단계는 심하게 변형된 리보소말 RNA에 기인한 배경을 감소시키지만 총 RNA의 90% 이상을 제거합니다. DNA는 또한 5메틸화 된 사이토신이 풍부하기 때문에 완전히 제거해야합니다. 또 다른 단점은 메틸화의 정확한 위치의 낮은 해상도입니다. 항체를 가진 잠복하기 전에 RNA의 초음파 처리는 100-200 뉴클레오티드로 수정을 포함하는 영역을 좁혀서 이 방향을 향해 돕는다. MeRIP가 심층 시퀀싱과 결합되면 시퀀싱 판독이 잠재적메틸화 부위 를 중심으로 가우시안 분포를 형성함에 따라 m5C 사이트 예측의 해상도가 증가합니다. 추가적으로, 항체의 특이성은 분석(예를 들어, RNA 도트 블롯 분석, 수정된 뉴클레오티드로 합성된 올리고체로 수행됨) 이전에 확인되어야 하지만, 항체가 실제로 밀접하게 관련된 수정(예를 들어, m6A 및 m6Am)을구별할 수 있는 정도까지는48,499의분야에서 논쟁의 포인트이다. 더욱이, 고도로 구조화된 RNA는 항체-항원 상호작용을 방해할 수 있으며, IP 이전에 RNA의 단편화 및 탈약으로 주로 해결되는 또 다른 제한이다. 반대로, 이차 구조물에 의해도 영향을 받는 비설피테 염기서열분석은 단편화 단계를 포함하지 않으며, 이는 비설피테 시퀀싱16 및 MeRIP-seq11,17에의해 예측된m5C 사이트와 mRNA 사이의 불일치를 유발하는 한 가지 이유가 될 수 있다. 다른 사이토신 변형 (예를 들어, hm5C)도 비설피티 중재 탈약(35)에내성이 있습니다.
MeRIP-seq의 변형은 광액활성 리보뉴클레오시드(사진-크로스링크-어시스트 m6A-seq, PA-m6A-seq 50)또는 UV 라이트를 이용하여 IP(miCLIP49,미클립에 설명된 miCLIP-30, 미CLIP-30)의 도입과 다른 방법)을 도입한 교차연결 단계를 포함한다. 미래에, RNA 메틸화에 대한 지식이 축적됨에 따라, 메틸화가 나타나는 효소 및/또는 합의 서열에 기초하여 더 많은 표적 접근법이 바람직할 수 있다. 독자 단백질의 식별은 전사 후 수정의 분자 및 신호 기능에 대한 이해에 필수적입니다. 나노포어 시퀀싱 기술은 이미 RNA17의 사전 치료 없이 수정된 뉴클레오티드의 직접 식별을 허용하지만, 서열 깊이 및 생물정보 분석에 관한 이 분야에 대한 개선의 여지가 여전히 존재한다. 전반적으로, MeRIP-seq는 현재 메틸화 된 RNA 전사체를 식별하기 위해 확립되고 신뢰할 수 있으며 편견없는 접근 방식입니다.

An erratum was issued for:&#160;<a href="https://www.jove.com/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.
The author list was updated from:
Eleftheria Saplaoura1, Valentina Perrera2, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua
to:
Eleftheria Saplaoura1, Valentina Perrera2, Vincent Colot3, Friedrich Kragler1 
1Max Planck Institute of Molecular Plant Physiology 
2Department of Molecular Medicine, Medical School, University of Padua 
3Biologie de l&#39;Ecole Normale Sup&#233;rieure (IBENS),&#160;Paris, France

An erratum was issued for:&#160;<a href="https://www.jove.com/t/61231">Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis</a>. The author list was updated.

Erratum: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

생명의 모든 세 왕국에서, RNA 종은 전사 후 수정을 겪고 이러한 기능적으로 관련된 생화학 적 변형에 대한 연구는 "epitranscriptomics"라고합니다. 상피학은 성장하는 분야이며 RNA 분자에 대한 수정을 연구하고 매핑하기 위해 다양한 방법이 개발되고있다(1,2에서검토됨). 100개 이상의 RNA 수정이 발견되었으며, rRNA, tRNA, 기타 ncRNAs뿐만 아니라 mRNA3,4에서검출되었다. tRNA 및 rRNA에서 화학적으로 다양한 전사 후 변형의 존재와 기능은광범위하게연구되어 있지만5,6,7,8,최근에만 mRNA 변형이 특징지어지고 있다. 식물에서, 많은 mRNA 수정은 캡 구조9,m 1 A10,hm5C11,12및 소변13에서m7G를 포함하여 현재까지 확인되었다. 그러나, 만 m6A10,14,15,m5C11,16,17, 및 슈도우리딘(18)은 아라비도시스에서 전사를 매핑했다. 전사 후 mRNA 기본 수정은 여러 발달 과정에관여한다(19,20).
상피학에서 가장 일반적으로 사용되는 접근법 중 하나는 깊은 시퀀싱 (MeRIP-seq)과 결합 된 메틸화 RNA 면역 침전입니다. MeRIP-seq는 2012년에 포유류 세포21,22에서m6A를 연구하기 위해 개발되었다. 원하는 변형을 위해 항체의 사용을 요구하고 변형된 뉴클레오티드(들)를 운반하는 RNA 단편을 농축하는 것을 목표로 한다. 그것은 일반적으로 특정 RNA 표적을 확인하기 위하여 농축된 단편 또는 정량PCR을 확인하고 지도하기 위하여 깊은 순서에 선행됩니다. MeRIP의 정확도는 유사한 수정(예를 들어, m5C 및 hm5C11,23)을통해 수정된 뉴클레오티드를 인식하기 위해 항체의 특이성에 기초한다. m6A 외에, MeRIP-seq는 또한 여러유기체에서m 1 A 및 m5C RNA 메틸화를 연구하도록 적용되었습니다11,17,23,24,25.
제5 탄소 위치(m5C)에서 사이토신의 메틸화는 가장 널리 퍼진 DNA변형(26,27) 및 가장 일반적인 RNA 수정 중 하나도3,4이다. m5C는 1975년28년진핵mRNA에서 검출되었지만, 최근에는 코딩 및 비코딩 RNA11,16,17,23, 29,30,31,32,33, 34로수정 전사를 매핑하는 데 초점을 맞춘 연구가 최근에있다.
m5 CRNA 연구에서 사용되는 대체 방법은 비메틸화 사이토신을 우라실로 화학적 변환(bisulfite 시퀀싱) 및 면역침전 분석법은 알려진 RNA 사이토신 메틸 전달제의 돌이킬 수 없는 결합을 기반으로 RNA 표적(miCLIP, aza-IP)을 포함한다. 간단히 말해서, 비황피테 시퀀싱은 5메틸화 된 시토신의 특징을 우라실에 수정되지 않은 사이토신을 분해하는 비설피트 나트륨 치료에 내성이 있습니다. 이 방법은 DNA를 위해 처음 개발되었지만 RNA에 맞게 조정되었으며 많은연구가 RNA16,23,29,32,34,35에서m5C 부위를 검출하는 이접근법을선택했습니다. miCLIP과 aza-IP 모두 RNA 시토신 메틸 트랜스퍼라제및 각각의 항체의 사용에 대한 이전의 지식을 필요로 한다. miCLIP의 경우(메틸화 개인-뉴클레오티드-해상도 교차 연결 및 면역 침전), 메틸 트랜스퍼라제는 RNA 기판에 결합하지만30을방출할 수 없도록 단일 아미노산 돌연변이를 전달한다. 아자-IP(5-아자시티딘-중재 RNA 면역침전)에서 돌이킬 수 없는 결합은 5-azaC 뉴클레오시드와 RNA 사이균성 메틸전달효소 사이에 형성되며 외인성 제공시 5-아자C는 RNA 폴리머라제에 의해 표적 RNA분자(31)로통합된다.
이 세 가지 방법의 주요 장점은 m5C의 단일 뉴클레오티드 분해능 매핑을 허용한다는 것입니다. 또한, miCLIP 및 aza-IP는 선택된 RNA 사이토신 메틸 트랜스퍼라제의 특정 표적에 대한 정보를 제공하여 전사 후 RNA 수정의 메커니즘과 역할을 더 깊게 해독한다. 그러나, MeRIP-seq 접근법은 사전 지식이 필요 없이 전사 폭 m5C 영역을 식별할 수 있으며, 5-azaC를 가진 bisulfite 처리 또는 잠복과 같은 가혹한 화학 및 온도 조건을 피할 수 있습니다. MeRIP 및 bisulfite 염열은 이차 RNA구조(36)에의해 억제될 수 있다. 면역 침전 전에 MeRIP 분석체에 포함된 단편화 단계는 항체 결합을 용이하게 하고 m5C 식별의 해상도를 높이는 것을 목표로 한다.
언급 할 가치가있는 또 다른 방법은 RNA 뉴클레오시드의 질량 분석법 (MS)입니다. MS는 DNA와 RNA모두에서 모든 유형의 수정을 감지하고 구별할 수 있습니다. 간략하게, RNA는 추출되고 DNase소화되고, 그 때 탈염되고 단 하나 뉴클레오시드로 소화됩니다. RNA 뉴클레오시드는 질량 분광계에 의해 분석된다. 이 방법은 각 수정의 수준을 정량화하는 데 사용할 수 있으며 항체 또는 화학 적 변환에 의존하지 않습니다. 그러나, 주요 단점은 RNA 수정의 존재에 대 한 대량 정보를 제공 하는 것입니다. 수정을 매핑하기 위해 MS는 인간 tRNALeu(CAA)37의경우와 같이 특정 RNA 분자에 대한 RNase 소화 및 시퀀싱 정보와 결합되어야합니다.
여기서, 우리는 설명하고 아라비도시스에서 m5C RNA 메틸화를 연구하는 데 사용되는 MeRIP 분석체를17.

<table>
	<tbody>
		<tr>
			<td>&#945;&#8208;m5C antibody</td>
			<td>ZymoResearch</td>
			<td>A3001 (discontinued), A3002 available</td>
			<td>Clone 10G4 (discontinued), 7D21 available</td>
		</tr>
		<tr>
			<td>Chip and reagents for capillary electrophoresis</td>
			<td>Agilent</td>
			<td>5067-1511</td>
			<td>RNA 6000 Nano kit</td>
		</tr>
		<tr>
			<td>Dnase</td>
			<td>Ambion</td>
			<td>AM1907</td>
			<td>TURBO DNA-free kit</td>
		</tr>
		<tr>
			<td>Co-precipitant of nucleic acids</td>
			<td>Ambion</td>
			<td>AM9515</td>
			<td>Glycoblue, 15 mg/mL</td>
		</tr>
		<tr>
			<td>In vitro transcription kit</td>
			<td>Promega</td>
			<td>P1300</td>
			<td>T7 RiboMAX Large Scale RNA Production System</td>
		</tr>
		<tr>
			<td>Low-binding reaction tubes</td>
			<td>Kisker Biotech</td>
			<td>G017</td>
			<td>1.7 ml microcentrifuge tubes</td>
		</tr>
		<tr>
			<td>Protein G magnetic beads</td>
			<td>Invitrogen</td>
			<td>10003D</td>
			<td>Dynabeads Protein G</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Ambion</td>
			<td>AM2546</td>
			<td>20mg/mL stock solution, RNA grade</td>
		</tr>
		<tr>
			<td>RNase inhibitor</td>
			<td>Promega</td>
			<td>N2615</td>
			<td>RNasin Plus 40 U/&#956;l</td>
		</tr>
		<tr>
			<td>rRNA removal kit</td>
			<td>Epicentre</td>
			<td>RZPL11016</td>
			<td>Ribo-Zero rRNA removal kit (Plant leaf)</td>
		</tr>
		<tr>
			<td>Sonication tubes</td>
			<td>Covaris</td>
			<td>520045</td>
			<td>microtube AFA Fiber Pre-Slit Snap-Cap 6x16mm</td>
		</tr>
		<tr>
			<td>RNA extraction reagent</td>
			<td>Ambion</td>
			<td>15596018</td>
			<td>TRIzol reagent</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Capillary electrophoresis machine</td>
			<td>Agilent</td>
			<td>G2939BA</td>
			<td>2100 Bioanalyzer System</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>DynaMag-2</td>
		</tr>
		<tr>
			<td>Microentrifuge</td>
			<td>Eppendorf</td>
			<td>discontinued</td>
			<td>5417R model</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Benchmark</td>
			<td>R4040</td>
			<td>RotoBot Mini</td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Covaris</td>
			<td>500217</td>
			<td>S220 Focused-ultrasonicator</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>ThermoFisher Scientific</td>
			<td>ND-ONEC-W</td>
			<td>NanoDrop OneC</td>
		</tr>
		<tr>
			<td>Waterbath</td>
			<td>GFL</td>
			<td>1012</td>
			<td>1012 Incubation bath</td>
		</tr>
	</tbody>
</table>

methylated rna immunoprecipitation assay to study m5c modification in arabidopsis

m5C와 같은 RNA에 대한 이차 염기 수정은 변형된 RNA 분자의 구조및 기능에 영향을 미칩니다. 메틸화 RNA 면역 침전 및 시퀀싱 (MeRIP-seq)은 메틸화 된 RNA를 풍부하게하고 궁극적으로 수정 된 성적 증명서를 식별하는 것을 목표로하는 방법입니다. 간략하게, 초음파 처리된 RNA는 5-메틸화 된 사이토신을 위한 항체로 배양되고 단백질 G 비드의 도움으로 침전됩니다. 농축된 조각은 시퀀스되고 잠재적인 메틸화 사이트는 읽기 및 피크 검출의 분포를 기반으로 매핑됩니다. MeRIP는 어떤 이전 서열 또는 효소 지식을 수정할 필요가 없기 때문에 어떤 유기체든지에 적용될 수 있습니다. 또한, 단편화 외에 RNA는 다른 화학적 또는 온도 처리를 거치지 않는다. 그러나, MeRIP-seq는 메틸화 부위를 다른 방법으로메틸화 부위의 단일 뉴클레오티드 예측을 제공하지 않지만, 메틸화 부위는 몇 가지 뉴클레오티드로 좁힐 수 있다. 상이한 변형 특이적 항체의 사용은 MeRIP가 RNA에 존재하는 상이한 기저 변형을 위해 조정될 수 있게 하여, 이 방법의 가능한 적용을 확대한다.

방법의 회로도는 도 1에제공됩니다. 프로토콜의 첫 번째 중요한 단계는 좋은 품질의 RNA를 얻고 (RIN ≥ 7) 약 100 nt 단편으로 초음파 처리된다. 두 단계의 효율은 칩 기반 모세관 전기 포근 기계에 의해 검사됩니다. 도 2A에서,양호한 RNA 샘플의 대표적인 실행이 도시된다. 샘플은 사용되는 키트의 검출 범위(5-5-500 ng/μL)에 있는 농도를 갖기 위해 칩에 적재하기 전에 1:10을 희석한다. 동일한 샘플도 초음파 처리 후 실행되며 도 2B에표시됩니다. 약 100개의 뉴클레오티드 의 크기로 다이어그램의 왼쪽으로 이동한 하나의 균일한 피크의 존재를 주목한다. 낮은 농도는 단편화 중 RNA의 손실뿐만 아니라 시료의 부피 증가(60-100 μL, 단계 1.7.1)로 인해 발생합니다.
IP 및 모의 샘플의 품질은 qRT-PCR에 의해 평가될 수 있다. 이를 위해, 스파이크인 IVT는 긍정적이고 부정적인 대조군 역할을 합니다: 모든 사이토신 위치에서 m5C가 있는 메틸화 IVT는 IP 샘플에서 매우 풍부해질 것으로 예상됩니다. 반대로, 비메틸화 IVT는 IP와 Mock의 차이가 없어야 합니다. 두 컨트롤 IVTs(EGFP 및 레닐라 루시파라라제)에 대한 qRT-PCR 분석에 사용되는 프라이머는 표 1에나열됩니다. 실제로, 도 3에도시된 바와 같이, 메틸화 IVT의 약 80%가 IP 샘플에서 회수되었고, 모의에서는 약 2%에 불과했다. 메틸화되지 않은 컨트롤의 경우 IP 및 모의 샘플 모두에서 회복이 1% 미만이었습니다. 이는 메틸화된 RNA 단편이 침전되고 농축되었다는 MeRIP의 효율을 검증하며, 시료가 다운스트림 분석에 사용될 수 있다는 좋은 지표이다. 또한, 비메틸화 IVT(IP 대 모의 비율)의 접이식 농축은 qRT-PCR 분석에서 농축의 중요성을 추정하기 위한 임계값으로 적용될 수 있다.
판독을 게놈(도4)에정렬한 후, 단계 3.4.1 및 3.4.2 단계에 기재된 피크 호출 알고리즘이 적용되어 입력에 비해 IP 샘플에서 농축된 통계적으로 유의한 창을 식별한다. 이러한 창에 대응하는 시퀀스는 보존된 메틸화 관련모티프(11,17)를검색하는 등 더 사용될 수 있다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61231/61231fig01.jpg"> 그림 1: MeRIP-seq 프로토콜의 회로도 표현. RNA 샘플은 5-메틸화 된 사이토신에 대한 항체로 배양되고 복합체는 결합 된 RNA와 함께 항체를 캡처하는 단백질 G 자기 구슬로 당겨. 용출된 RNA 샘플은 심층 염기서열 분석 및 qRT-PCR에 의해 분석됩니다. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61231/61231fig02.jpg"> 그림 2: RNA 샘플의 품질 분석에서 대표적인 결과. (A)자격을 갖춘 총 RNA 식물 샘플의 대표적인 프로파일. (B)초음파 처리 후 RNA 샘플의 대표적인 프로파일을 100 nt 단편으로 하였다. 모세관 전기 포근 소프트웨어에서 출력 파일. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61231/61231fig03.jpg"> 그림 3: 제어 IVT의 qRT-PCR 분석. 체외 내 메틸화 및 비메틸화 된 메틸화 된 MeRIP 분석기의 긍정적이고 부정적인 제어로 각각 사용되었습니다. 면역 침전 후, 메틸화 IVT는 IP 샘플(녹색)에서 매우 농축되지만 모의 샘플에서는 그렇지 않습니다(항m5C항체; 보라색 제외). 메틸화되지 않은 IVT는 IP와 Mock의 농축과 차이가 없음을 보여주었습니다. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/61231/61231fig04.jpg"> 그림 4: 대표적인 성적증명서 주위에 MeRIP 전후의 정렬을 읽어보십시오. 입력 샘플(위쪽 행)과 두 개의 IP 복제(가운데 및 아래쪽 행)의 특정 성적증명서에 정렬된 읽기입니다. 블랙 박스는 MACS243 및 MeRIP-seq22 피크 콜링 분석을 기반으로 식별 된 농축 된 50 nt 긴 창을 보여줍니다. <a href="https://www.jove.com/files/ftp_upload/61231/61231fig04large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>대상</td>
			<td colspan="2">프라이머 페어</td>
			<td colspan="2">제품 시퀀스</td>
			<td>제품 길이</td>
		</tr>
<tr>
<td rowspan="2">EGFP</td>
			<td colspan="2">For: 5'-GGCAACTACAAGACCCGCGCC -3'</td>
			<td colspan="2" rowspan="2">GGCAACTACAAGCGCGCCGAG GTGAAGTTCGAGGCGACACTG GTGAACCGCCGAGCTGAAGGGC</td>
			<td rowspan="2">72 bp</td>
		</tr>
<tr>
<td colspan="2">레브: 5'-GCCCTTCAGCTCGTGCGGTT -3'</td>
		</tr>
<tr>
<td rowspan="2">레닐라 루시파라제</td>
			<td colspan="2">에 대 한: 5'- 가가ATAACTTCTCTTCGTGGAAAC -3'</td>
			<td colspan="2" rowspan="2">가가와타액트CTCTTCGTGGAACC ATGTTGCCATCAAAAAAAATCATCATGAGAA 아그타가아치아가아가아가트가가이타트GC</td>
			<td rowspan="2">75 bp</td>
		</tr>
<tr>
<td colspan="2">레브: 5'-GCTGCAAATTCTCTCTCTCTAA -3'</td>
		</tr>
</tbody></table>표 1: qRT-PCR 분석을 위한 프라이머 및 생성된 제품에 대한 정보입니다.
버퍼 레시피. <a href="https://www.jove.com/files/ftp_upload/61231/Buffer%20Recipes%20MeRIP.xlsx" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis at JoVE.com

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

메틸화 RNA 면역 침전 분석법은 메틸화 RNA 단편을 농축하는 데 사용되는 항체 기반 방법입니다. 깊은 시퀀싱과 결합하여 m5C수정을 운반하는 성적 증명서를 식별합니다.

메틸화 RNA 면역 침전 분석연구 m5C 변형에 대한 애비독증

Secondary base modifications on RNA, such as m5C, affect the structure and function of the modified RNA molecules. Methylated RNA Immunoprecipitation and ...

methylated-rna-immunoprecipitation-assay-to-study-m5c-modification

Nanyang Technological University

Research

JoVE Journal

Genetics

Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

6.5K 조회수.  Max Planck Institute of Molecular Plant Physiology. 메틸화 RNA 면역 침전 분석법은 메틸화 RNA 단편을 농축하는 데 사용되는 항체 기반 방법입니다. 깊은 시퀀싱과 결합하여 m5C수정을 운반하는 성적 증명서를 식별합니다.

비디오: Methylated RNA Immunoprecipitation Assay to Study m5C Modification in Arabidopsis

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the replacement of the entire gene with a selectable marker via homologous recombination. During homologous recombination, exchange of DNA takes place between sequences with high similarity. Therefore, linear genomic sequences flanking a target gene can be used to specifically direct a selectable marker to the desired integration site. Blunt ends of the deletion construct activate the cell&#39;s DNA repair systems and thereby promote integration of the construct either via homologous recombination or by non-homologous-end-joining. In organisms with efficient homologous recombination, the rate of successful gene deletion can reach more than 50% making this strategy a valuable gene disruption system. The smut fungus Ustilago maydis is a eukaryotic model microorganism showing such efficient homologous recombination. Out of its about 6,900 genes, many have been functionally characterized with the help of deletion mutants, and repeated failure of gene replacement attempts points at essential function of the gene. Subsequent characterization of the gene function by tagging with fluorescent markers or mutations of predicted domains also relies on DNA exchange via homologous recombination. Here, we present the U. maydis strain generation strategy in detail using the simplest example, the gene deletion.

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

We describe a robust gene replacement strategy to genetically manipulate the smut fungus Ustilago maydis. This protocol explains how to generate deletion mutants to investigate infection phenotypes. It can be extended to modify genes in any desired way, e.g., by adding a sequence encoding a fluorescent protein tag.

플랜트 병원체의 유전자 조작<em&gt; Ustilago maydis</em&gt; 곰팡이 생물과 식물 미생물 상호 작용을 연구하는

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the ...

연구

유전학

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative without tools to study gene function. The development and sharing of detailed protocols for the establishment of new model systems in laboratories, and for tools to carry out functional studies, is thus crucial for leveraging the power of genomics. Coleoptera (beetles) are the largest clade of insects and occupy virtually all types of habitats on the planet. In addition to providing ideal models for fundamental research, studies of beetles can have impacts on pest control as they are often pests of households, agriculture, and food industries. Detailed protocols for rearing and maintenance of D. maculatus laboratory colonies and for carrying out dsRNA-mediated interference in D. maculatus are presented. Both embryonic and parental RNAi procedures-including apparatus set up, preparation, injection, and post-injection recovery-are described. Methods are also presented for analyzing embryonic phenotypes, including viability, patterning defects in hatched larvae, and cuticle preparations for unhatched larvae. These assays, together with in situ hybridization and immunostaining for molecular markers, make D. maculatus an accessible model system for basic and applied research. They further provide useful information for establishing procedures in other emerging insect model systems.

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Here, we present protocols for rearing an intermediate-germ beetle, Dermestes maculatus (D. maculatus) in the lab. We also share protocols for embryonic and parental RNAi and methods for analyzing embryonic phenotypes to study gene function in this species.

양육 및 숨기기 비틀에 RNA 매개 유전자 최저를 두 번 좌초,<em&gt; Dermestes maculatus</em

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Chromatin Immunoprecipitation (ChIP) in Mouse T-cell Lines

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Chromatin Immunoprecipitation ChIP in Mouse T-cell Lines

This work describes a protocol for chromatin immunoprecipitation (ChIP) using a mature mouse T-cell line. This protocol is suitable to investigate the distribution of specific histone marks at specific promoter sites or genome-wide.

마우스 T- 세포주에서 Chromatin Immunoprecipitation (ChIP)

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational ...

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 104 - 5 x 105 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Here, we describe a chromatin immunoprecipitation (ChIP) and ChIP-seq library preparation protocol to generate global epigenomic profiles from low-abundance chicken embryonic samples.

낮은 풍부 배아 샘플 chromatin Immunoprecipitation (칩) 프로토콜

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

Investigation of RNA Synthesis Using 5-Bromouridine Labelling and Immunoprecipitation

When steady state RNA levels are compared between two conditions, it is not possible to distinguish whether changes are caused by alterations in production or degradation of RNA. This protocol describes a method for measurement of RNA production, using 5-Bromouridine labelling of RNA followed by immunoprecipitation, which enables investigation of RNA synthesized within a short timeframe (e.g., 1 h). The advantage of 5-Bromouridine-labelling and immunoprecipitation over the use of toxic transcriptional inhibitors, such as &#945;-amanitin and actinomycin D, is that there are no or very low effects on cell viability during short-term use. However, because 5-Bromouridine-immunoprecipitation only captures RNA produced within the short labelling time, slowly produced as well as rapidly degraded RNA can be difficult to measure by this method. The 5-Bromouridine-labelled RNA captured by 5-Bromouridine-immunoprecipitation can be analyzed by reverse transcription, quantitative polymerase chain reaction, and next generation sequencing. All types of RNA can be investigated, and the method is not limited to measuring mRNA as is presented in this example.

This method can be used to measure RNA synthesis. 5-Bromouridine is added to cells and incorporated into synthesized RNA. RNA synthesis is measured by RNA extraction immediately after labelling, followed by 5-Bromouridine-targeted immunoprecipitation of labelled RNA and analysis by reverse transcription and quantitative polymerase chain reaction.

5-Bromouridine 라벨 및 Immunoprecipitation를 사용 하 여 RNA 합성의 조사

When steady state RNA levels are compared between two conditions, it is not possible to distinguish whether changes are caused by alterations in ...

RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA

Long non-coding RNA (lncRNA), which are sequences of more than 200 nucleotides without a defined reading frame, belong to the regulatory non-coding RNA&#39;s family. Although their biological functions remain largely unknown, the number of these lncRNAs has steadily increased and it is now estimated that humans may have more than 10,000 such transcripts. Some of these are known to be involved in important regulatory pathways of gene expression which take place at the transcriptional level, but also at different steps of RNA co- and post-transcriptional maturation. In the latter cases, RNAs that are targeted by the lncRNA have to be identified. That&#39;s the reason why it is useful to develop a method enabling the identification of RNAs associated directly or indirectly with a lncRNA of interest.
This protocol, which was inspired by previously published protocols allowing the isolation of a lncRNA together with its associated chromatin sequences, was adapted to permit the isolation of associated RNAs. We determined that two steps are critical for the efficiency of this protocol. The first is the design of specific anti-sense DNA oligonucleotide probes able to hybridize to the lncRNA of interest. To this end, the lncRNA secondary structure was predicted by bioinformatics and anti-sense oligonucleotide probes were designed with a strong affinity for regions that display a low probability of internal base pairing. The second crucial step of the procedure relies on the fixative conditions of the tissue or cultured cells that have to preserve the network between all molecular partners. Coupled with high throughput RNA sequencing, this RNA pull-down protocol can provide the whole RNA interactome of a lncRNA of interest.

This RNA pull-down method allows identifying the RNA targets of a long non-coding RNA (lncRNA). Based on the hybridization of home-made, designed anti-sense DNA oligonucleotide probes specific to this lncRNA in an appropriately fixed tissue or cell line, it efficiently allows the capture of all RNA targets of the lncRNA.

오래 비 코딩 RNA의 RNA 표적 식별에 RNA 풀 다운 절차

Long non-coding RNA (lncRNA), which are sequences of more than 200 nucleotides without a defined reading frame, belong to the regulatory non-coding ...

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell type-specific fashion. AS expression patterns are typically analyzed by RT-PCR and RNA-seq using RNA samples isolated from a population of cells. In situ examination of AS expression patterns for a particular biological structure can be carried out by RNA in situ hybridization (ISH) using exon-specific probes. However, this particular use of ISH has been limited because alternative exons are generally too short to design exon-specific probes. In this report, the use of BaseScope, a recently developed technology that employs short antisense oligonucleotides in RNA ISH, is described to analyze AS expression patterns in mouse brain sections. Exon 23a of neurofibromatosis type 1 (Nf1) is used as an example to illustrate that short exon-exon junction probes exhibit robust hybridization signals with high specificity in RNA ISH analysis on mouse brain sections. More importantly, signals detected with exon inclusion- and skipping-specific probes can be used to reliably calculate the percent spliced in values of Nf1 exon 23a expression in different anatomical areas of a mouse brain. The experimental protocol and calculation method for AS analysis are presented. The results indicate that BaseScope provides a powerful new tool to assess AS expression patterns in situ.

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

An in situ hybridization (ISH) protocol that uses short antisense oligonucleotides to detect alternative pre-mRNA splicing patterns in mouse brain sections is described.

대체 사전 mRNA 접합 교 잡 시험 현장에서 RNA를 사용 하 여 마우스 뇌 섹션에서의 정량 분석

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

효 모 신경 Proteinopathy 모델에서 특성화 히스톤 포스트 번역 상 수정 변경

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

Chromatin Immunoprecipitation Assay Using Micrococcal Nucleases in Mammalian Cells

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene expression. The cellular transcriptional machinery and its chromatin modification proteins coordinate to regulate transcription. To analyze transcriptional regulation at the molecular level, several experimental methods such as electrophoretic mobility shift, transient reporter and chromatin immunoprecipitation (ChIP) assays are available. We describe a modified ChIP assay in detail in this article because of its advantages in directly showing histone modifications and the interactions between proteins and DNA in cells. One of the key steps in a successful ChIP assay is chromatin shearing. Although sonication is commonly used for shearing chromatin, it is difficult to identify reproducible conditions. Instead of shearing chromatin by sonication, we utilized enzymatic digestion with micrococcal nuclease (MNase) to obtain more reproducible results. In this article, we provide a straightforward ChIP assay protocol using MNase.

Chromatin immunoprecipitation (ChIP) is a powerful tool for understanding the molecular mechanisms of gene regulation. However, the method involves difficulties in obtaining reproducible chromatin fragmentation by mechanical shearing. Here, we provide an improved protocol for a ChIP assay using enzymatic digestion.

포유류 세포에서 미세 Coccal 뉴클레아제사용 염색질 면역침전 분석

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene ...

An Assay for Quantifying Protein-RNA Binding in Bacteria

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding of an RNA binding protein (RBP) to the initiation region of the mRNA, which interferes with ribosome binding. In the presented method, we utilize this blocking phenomenon to quantify the binding affinity of RBPs to their cognate and non-cognate binding sites. To do this, we insert a test binding site in the initiation region of a reporter mRNA and induce the expression of the test RBP. In the case of RBP-RNA binding, we observed a sigmoidal repression of the reporter expression as a function of RBP concentration. In the case of no-affinity or very low affinity between binding site and RBP, no significant repression was observed. The method is carried out in live bacterial cells, and does not require expensive or sophisticated machinery. It is useful for quantifying and comparing between the binding affinities of different RBPs that are functional in bacteria to a set of designed binding sites. This method may be inappropriate for binding sites with high structural complexity. This is due to the possibility of repression of ribosomal initiation by complex mRNA structure in the absence of RBP, which would result in lower basal reporter gene expression, and thus less-observable reporter repression upon RBP binding.

In this method, we quantify the binding affinity of RNA binding proteins (RBPs) to cognate and non-cognate binding sites using a simple, live, reporter assay in bacterial cells. The assay is based on repression of a reporter gene.

박테리아에서 단백질 RNA 결합을 정량화하기위한 분석

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding ...

메틸화 RNA 면역 침전 분석연구 m⁵C 변형에 대한 애비독증

요약

더 많은 비디오 탐색

이 비디오의 챕터

플랜트 병원체의 유전자 조작

양육 및 숨기기 비틀에 RNA 매개 유전자 최저를 두 번 좌초,