We thank Anuja Kibe and Jun. Prof. Redmond Smyth for critically reviewing the manuscript. We thank Tatyana Koch for expert technical assistance. We thank Kristyna Pekarkova for the help with recording experimental videos. The work in our laboratory is supported by the Helmholtz Association and funding from the European Research Council (ERC) Grant Nr. 948636 (to NC).

1. Sample preparation
<ol>
	<li>Clone the sequence of interest into the vector containing the Lambda DNA fragments, which serve&#160;as the handle sequences (Figure 2)43,50.</li>
	<li>First generate a DNA template for subsequent in vitro transcription via PCR (Figure 2B; reaction 1). At this PCR step, the T7 promoter is added in the 5&#39; end of the sense DNA molecule32,33,43,50. Set the PCR reaction according to Table 1. Run the PCR in 50 &#181;L aliquots with appropriate cycles in the thermocycler.</li>
	<li>Prepare the handles by two separate PCR reactions (Table 1, Figure 2B; reaction 2 and 3). First, generate the 5&#39; handle by PCR. Then, generate the 3&#39; handle and simultaneously label it with digoxigenin by using a 5&#39; digoxigenin-labeled primer32,33,43,50.</li>
	<li>After the PCR, purify the DNA using silica spin columns.</li>
	<li>Carry out the in vitro transcription reaction using T7 RNA polymerase (Table 2)32,33,43,50. Incubate the reaction at 37 &#176;C for 2-4 h depending on the length of the RNA. Next, add DNase I to the reaction and incubate at 37 &#176;C for 30 min to digest the DNA template. Purify the RNA using silica spin columns.</li>
	<li>During the labeling reaction of the 5&#39; handle (Table 3), add biotin-16-dUTP at the 3&#39; end of the handle by T4 DNA polymerase38,50. Perform the reaction at room temperature for 1-2 h. Afterwards, purify the DNA using silica spin columns. 
	NOTE: Since the 5&#39; handle must be labeled at its 3&#39; end (Figure 2B), the labeling cannot be performed during the PCR.</li>
	<li>Mix the components mentioned above - 5&#39; handle (3&#39; labeled with biotin), 3&#39; handle (5&#39; labeled with digoxigenin), and RNA - in a 1:1:1 molar ratio in annealing buffer (80% formamide, 400 mM NaCl, 40 mM HEPES, pH 7.5, 0.5 mM EDTA, pH 8), to obtain the desired RNA/DNA hybrid (Table 4). Heat the annealing mixture up to 85 &#176;C for 10 min and then slowly cool down to 4 &#176;C.</li>
	<li>Mix the annealed sample with 1/10 of volume of 3 M sodium acetate (pH 5), 3 volumes of ice-cold ethanol and incubate at -80 &#176;C for at least 1 h or at -20 &#176;C overnight.</li>
	<li>Centrifuge the samples at 15,000 &#215; g for 30 min at 4 &#176;C. Discard the supernatant and dry the pellet (usually not visible) under vacuum.</li>
	<li>Finally, resuspend, the pellet in 50 &#181;L of RNase-free water and make aliquots. Store the aliquots at -80 &#176;C until used. For short term storage, the samples can be also stored at -20 &#176;C.</li>
</ol>
2. Instrument setup
NOTE: The following protocol is optimized for the commercial optical tweezers instrument C-Trap from LUMICKS company. Therefore, adjustments to the presented steps might be necessary while using other optical tweezers instruments. If not used, the microfluidics system of the machine is kept in bleach (sodium hypochlorite solution) and must be washed before use.
<ol>
	<li>Discard the bleach and fill the syringes with 1 mL of RNase-free water.</li>
	<li>Add 50 &#181;L of 0.5 M sodium thiosulfate to at least 1 mL of the RNase-free water and thoroughly wash the system (1 bar, at least 0.5 mL) to eliminate the remaining bleach in the system.</li>
	<li>Discard the sodium thiosulfate solution from the syringes. Replace syringes with fresh ones and wash the system with at least 0.5 mL of RNase-free water. 
	NOTE: Be careful, that the microfluidics system never runs dry to avoid air bubbles in the system.</li>
	<li>Put 2 drops of immersion oil (refractive index of 1.33) or approximately 70 &#181;L of water on top of the objective.</li>
	<li>Place the flow cell inside the holding frame in its position.</li>
	<li>Put 2 drops of immersion oil (refractive index of 1.51) on top of the flow cell.</li>
	<li>Turn on the laser device in the tweezers machine. Once it is running, turn on the trapping laser in the software interface at 100%.</li>
	<li>Using diagnostic cameras (Z-finder), adjust the Z-axis to the middle of the chamber between the second and the third reflections (interfaces) where the refraction rings are the biggest, by turning the micro screw. 
	NOTE: Each time the objective is moved closer to the measuring chamber and the focal plane of the objective crosses the interface between two phases, a reflection can be recognized in the Z-finder mode. There are 4 interfaces possible: (i) water/immersion oil and bottom glass (ii) bottom glass and buffer inside the chamber (iii) buffer inside the chamber and top glass (iv) top glass and immersion oil for condenser.</li>
	<li>Adjust the condenser position (set trapping laser to approximately 50%) so the condenser touches the immersion oil on top of the measuring chamber.</li>
	<li>Adjust the focus by moving slowly down/up with the condenser, so approx. 10 light bands are shown in the moon mode (diagnostic cameras).</li>
</ol>
3. Sample measurement
<ol>
	<li>Incubate anti-digoxigenin-coated beads (AD) with the sample constructs (3 &#181;L of 0.1% (w/v) AD bead suspension + 4 &#181;L of sample) and with 1 &#181;L of RNase inhibitors and 8 &#181;L of the assay buffer (300 mM KCl, 5 mM MgCl2, 20 mM HEPES, pH 7.6, 0.05% Tween 20, 5 mM DTT) at RT for 10-20 min. After the incubation, dilute the sample in 500 &#181;L of assay buffer. 
	NOTE: It is recommended to add oxygen scavengers, particularly during fluorescence measurements to the buffer in order to prevent oxidative damage. Here oxygen scavenger system containing glucose (8.3 mg/mL), glucose oxidase (40 U/mL) and catalase (185 U/mL) was used.</li>
	<li>Mix 0.8 &#181;L of 1% (w/v) streptavidin-coated (SA) beads with 1 mL of assay buffer.</li>
	<li>Discard water from the syringes and fill the syringes with respective suspensions/solutions. Wash for at least 2 min at approximately 1 bar, and then start catching beads. 
	NOTE: Depending on the experimental set-up, different channel arrangements may be used (Figure 3). Typically, one flow channel is filled with anti-digoxigenin beads carrying the RNA molecule. A second channel is filled with the streptavidin-coated beads. Buffer channel is used to form the tethers. A fourth channel can be employed to load the RNA binding protein (Figure 3C), or alternatively RBP can be added directly in the buffer channel (Figure 3B).</li>
	<li>To capture the beads, move the optical traps apart from each other. First move to the AD channel and catch an AD-bead in trap 1. Next, move the stage to the SA-channel and catch a single SA bead by trap 2. 
	NOTE: Try to stay at the interface of the buffer and bead channels to avoid losing the already caught bead, or to prevent catching multiple beads by the same trap.</li>
	<li>Once the beads of the right size are captured, move to the buffer channel and stop the laminar flow. Next, perform force calibration to check trap stiffness. The respective stiffness values should not differ in the x/y axis by more than 10-15%. 
	NOTE: Adjust the laser power or the laser split between the traps according to bead size. Force calibration does not have to be done for every bead pair as long as the bead templates match (similarity score &#62; 0.9). However, it should be performed regularly, or at least every time assay conditions are changed.</li>
	<li>Start fishing for a tether by moving the beads close to each other, waiting for a few seconds, and then moving them back apart, repeat until a tether is formed. A tether formation results in an increase of measured force upon pulling the two beads away from each other. 
	NOTE: To avoid formation of multiple tethers, the beads should not be moved too close. Upon catching a tether between the two beads, tether quality can be checked by finding the overstretching plateau. The plateau should be between 50 to 60 pN for a single tether.</li>
	<li>Upon obtaining a tether, start the measurement. Depending on the phenomenon studied different measurement setups should be chosen (Figure 1B-D). 
	NOTE: Usually at the beginning of the experiment, a force-ramp experiment is conducted to check the tether quality and probe the behavior. Afterward, one may also start the constant-force or constant-position experiments to study the state transitions further. Once sufficient number of measurements have been performed on an RNA sample to determine its behavior, labeled factors can be added to the system to perform confocal measurements.</li>
	<li>To perform fluorescence measurements, turn on the confocal lasers and photon counter unit in the optical tweezers instrument.</li>
	<li>Turn on the excitation laser of desired wavelength in the software interface and set the power of the laser to 5% or higher, depending on the fluorophore. 
	NOTE: While not measuring lower the power setting of the excitation laser to 0% to avoid excessive photodamage to the sample.</li>
	<li>Start imaging the sample by using image functions of the software. 
	NOTE: In order to get well-focused images, the focal plane of the confocal microscope and optical traps have to be aligned. For this purpose, autofluorescence of the polystyrene beads in the blue laser channel can be employed. The focal plane of optical traps is moved up or down in the z-axis until the image of beads reaches its highest diameter. At this position, the fluorescence signal from the molecule tethered between the beads can be measured.</li>
	<li>To use the kymograph function, specify the x-y position of the kymograph axis so that it allows detection of the tether between the beads.</li>
	<li>Throughout the measurement, buffer composition can be easily changed by either moving the beads to different channels or by changing the buffer supplied in the microfluidics system.</li>
</ol>
4. Data analysis
<ol>
	<li>Raw data pre-processing
	<ol>
		<li>By using a simple script, downsample the raw data enough to (i) allow faster subsequent data processing but (ii) still contain all the critical information (Figure 4A). Usually, 100-5000 Hz is suitable for this purpose. 
		NOTE: The data gathering frequency in optical tweezers experiments is often higher than it is necessary for the analysis - in the presented experiments, the data gathering frequency is set to 78 125 Hz by default. Since storage space is limited, it is convenient and timesaving to reduce the sampling rate of the data. Here, the raw data were downsampled by a factor of 30.</li>
		<li>Next, employ a signal filter to reduce the high frequency measurement noise from the signal (Figure 4A). Adjust the filter degree and cut-off frequency parameters accordingly to optimize data output of different experiments (Figure 5). 
		NOTE: Amongst signal filters, Butterworth filter51 is one of the most widely used. A custom-written python script allowing the pre-processing of raw data is provided in the supplementary data. Downsampling and signal filtering parameters (cut-off frequency, filter degree) need to be optimized for different experiments.</li>
	</ol>
	</li>
	<li>For force-ramp data analysis, use the following steps.
	<ol>
		<li>Mark the steps either manually by finding corresponding points on the force trajectory plot or by using custom-written scripts. Unfolding steps are characterized by a sudden drop in force combined with an increase in distance in the force-distance (FD) curve.</li>
		<li>Once unfolding events are marked, fit different regions of the FD curve using appropriate models (Figure 4D). 
		NOTE: For the region before the first unfolding step, the tether can be considered &#34;double-stranded&#34; and is commonly fit using an extensible Worm-like-chain model (WLC)47,52,53. The parts after the first unfolding event are considered a combination of double-stranded nucleotides (handles) and single-stranded nucleotides (unfolded RNA molecule). Therefore, data fitting&#160;is more complex - usually a combination of 2 WLC models or WLC and Freely-jointed chain (FJC) models are employed36,39,52. The extensible WLC model has two main fit parameters the contour length (LC) and the persistence length (LP). Contour length corresponds to the length of the fully stretched molecule and persistence length defines the bending properties of the molecule of interest. The model can be described with the following equation (1). WLC can be used to model the behavior of both folded as well as unfolded regions, although for each of these a separate model with different parameters has to be employed. 
		(1) <img alt="Equation 1" src="/files/ftp_upload/62589/62589eq01.jpg" /> 
		where x is extension, LC is contour length, F is force, LP is persistence length, kB is Boltzmann constant, T is Thermodynamic temperature, and S is stretch modulus. 
		The second model called Freely-jointed chain (FJC) is commonly used to describe behavior of unfolded single stranded regions. It uses similar parameters of the polymers but treats each unit of the &#34;chain&#34; as a rigid rod, here corresponding to the nucleotides of the unfolded single stranded region. The following equation (2) describes this model: 
		(2) <img alt="Equation 2" src="/files/ftp_upload/62589/62589eq02.jpg" /> 
		NOTE: Our lab has recently developed an algorithm that allows batch processing of the raw force-ramp data called &#34;Practical Optical Tweezers Analysis TOol (POTATO)54.&#34; The algorithm downsamples and filters the data, then it identifies possible unfolding steps and finally performs data fitting. The POTATO is built in a user-friendly graphical user interface (GUI) (https://github.com/REMI-HIRI/POTATO).</li>
	</ol>
	</li>
	<li>Process constant-force data as follows: 
	NOTE: The following instructions can be analogically applied on constant-position data.
	<ol>
		<li>For the constant-force data, plot the distance over time (Figure 5). A histogram showing the frequency (counts) of different conformations over the relative change in position is a useful way to characterize various dominant and minor states (Figure 7).</li>
		<li>Fit the histogram using (multiple) Gaussian functions to estimate the overall percentage of individual conformers at a given force (Figure 7C). The Gaussian fits, mean position, and the standard deviation outlines the force-related relationship among different populations. 
		NOTE: A custom-written python script allowing pre-processing and basic bimodal Gaussian fitting of constant-force data is provided in the supplementary data. Parameters (cut-off frequency, filter degree, expected means, standard deviation values and amplitudes) need to be optimized for different experiments.</li>
		<li>Next, employ the Hidden Markov model to further analyze the states, which may uncover additional folding intermediates (conformers)55. For further information on the constant-force and Hidden Markov model, one may refer to55,56,57,58.</li>
	</ol>
	</li>
</ol>

The authors have nothing to disclose.

Here, we demonstrate the use of fluorescence-coupled optical tweezers to study interactions and dynamic behavior of RNA molecules with various ligands. Below, critical steps and limitations of the present technique are discussed.
Critical steps in the protocol 
As for many other methods, the quality of the sample is pivotal to obtain reliable data. Therefore, to obtain the highest possible quality samples, it is worth it to spend time to optimize the procedure for sample ...

Transfer of genetic information from DNA to proteins through mRNAs is a complex biochemical process, which is precisely regulated on all levels through macromolecular interactions inside cells. For translational regulation, RNA-protein interactions confer a critical role to rapidly react to various stimuli and signals1,2. Some RNA-protein interactions affect mRNA stability and thereby alter the time an RNA is translationally active. Other RNA-protein interactions are associated with recoding mechanisms such as stop-codon readthrough, bypassing, or programmed ribosomal frameshifting (PRF)3,4,5,6,7. Recently, a number of RNA-binding proteins (RBPs) have been demonstrated to interact with stimulatory mRNA elements and the translation machinery to dictate when and how much recoding will occur in the cell7,8,9,10,11. Thus, to dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is pivotal to study the interaction principles and mechanical properties of these RNA-protein complexes in detail.
Decades of work have laid the foundation to study the multi-step and multi-component process of translation, which relies on intricate communication between the RNA and protein components of the translation machinery to achieve speed and accuracy12,13,14. A crucial next step in understanding complex regulatory events is determining the forces, timescales, and structural determinants during translation at high precision12,15,16,17. The study of RNA conformational dynamics and especially how trans-acting auxiliary factors act on the RNA structure during translation have been further illuminated by the emergence of single-molecule tools, including optical tweezers or zero-mode waveguides16,17,18,19,20,21,22,23,24,25,26.
Optical tweezers (OT) represent a highly precise single-molecule technique, which has been applied to study many sorts of RNA-dependent dynamic processes including transcription, and translation26,27,28,29,30,31,32. The use of optical tweezers has allowed probing of molecular interactions, nucleic acid structures, and thermodynamic properties, kinetics, and energetics of these processes in detail16,17,22,33,34,35,36,37,38,39. Optical tweezers assay is based on the entrapment of microscopic objects with a focused laser beam. In a typical OT experiment, the molecule of interest is tethered between two transparent (usually polystyrene) beads (Figure 1A)27. These beads are then caught by optical traps, which behave like springs. Thus, the force applied on the molecule can be calculated based on the bead&#39;s displacement from the center of the focused laser beam (trap center). Recently, optical tweezers have been combined with confocal microscopy (Figure 1B), enabling fluorescence or F&#246;rster resonance energy transfer (FRET) measurements40,41,42. This opens a whole new field of possible experiments allowing simultaneous measurement and, therefore, precise correlation of force spectroscopy and fluorescence data.
Here, we demonstrate experiments using the optical tweezers combined with confocal microscopy to study protein-RNA interactions regulating translational frameshifting. Between the objective and the condenser, a flow cell with five channels enables continuous sample application with laminar flow. Through the microfluidic channels, various components can be injected directly, which decreases the hands-on time as well as allowing very little sample consumption throughout the experiment.
First, a basic guideline to assist the design of OT experiments is proposed and advantages as well as pitfalls of various setups are discussed. Next, the preparation of samples and experimental workflows are described, and a protocol for the data analysis is provided. To represent an example, we outline the results obtained from RNA stretching experiments to study the SARS-CoV-2 frameshifting RNA element (Figure 2A) with the trans-acting factor the short isoform of zinc-finger antiviral protein (ZAP), which alters the translation of the viral RNA from an alternative reading frame43. Additionally, it is demonstrated that fluorescence-labeled ribosomes can be employed in this OT confocal assay, which would be useful to monitor the processivity and speed of the translation machinery. The method presented here can be used to rapidly test the effect of different buffers, ligands, or other cellular components to study various aspects of translation. Finally, common experimental pitfalls and how to troubleshoot them are discussed. Below, some crucial points in experimental design are outlined.
Construct design 
In principle, there are two common approaches to create an OT-compatible RNA construct. The first approach employs a long RNA molecule that is hybridized with complementary DNA handles, thus yielding a construct consisting of two RNA/DNA hybrid regions flanking a single-stranded RNA sequence in the middle (Figure 2B). This approach is employed in most OT RNA experiments33,44,45.
The second approach takes advantage of dsDNA handles with short (around 20 nt) overhangs15,17. These overhangs are then hybridized with the RNA molecule. Although more complicated in design, the use of dsDNA handles overcomes some of limitations of the DNA/RNA-hybrid system. In principle, even very long handles (&#62;10kb) can be implemented, which is more convenient for confocal measurements. In addition, the RNA molecule can be ligated to DNA handles to increase tether stability.
End-labeling strategy 
The construct must be tethered to beads via a strong molecular interaction. While there are approaches available for covalent bonding of handles to beads46, strong but non-covalent interactions such as streptavidin-biotin and digoxigenin-antibody are commonly used in OT experiments15,33,35,45. In the described protocol, the construct is labeled with biotin or digoxigenin, and the beads are coated with streptavidin or antibodies against digoxigenin, respectively (Figure 1A). This approach would be suitable for applying forces up to approximately 60 pN (per tether)47. Furthermore, the use of different 5&#39; and 3&#39; labeling strategies allow determining the orientation of the tether formed between the beads17.
Protein labeling for fluorescence measurements 
For the confocal imaging, there are several commonly used approaches for fluorescence labeling. For instance, fluorophores can be covalently attached to amino acid residues that are found natively in proteins or introduced by site-directed mutagenesis through a reactive organic group. Thiol or amine-reactive dyes can be used for labeling of cysteine and lysine residues, respectively. There are several reversible protection methods to increase the specificity of labeling48,49, however native proteins would typically be labeled at multiple residues. Although the small size of the fluorophore may confer an advantage, non-specific labeling might interfere with the protein activity and thus signal intensity may vary49. Also, depending on the labeling efficiency signal intensity may differ between different experiments. Therefore, an activity check should be performed prior to the experiment.
In case the protein of interest contains an N- or C-terminal tag, such as a His-tag or strep-tag, specific labeling of these tags represents another popular approach. Moreover, tag-targeted labeling reduces the chance of the fluorophore interfering with protein activity and can enhance solubility49. However, tag-specific labeling usually yields mono-fluorophore labeled proteins, which might be challenging to detect. Another way of specific labeling can be accomplished by employing antibodies.
Microfluidics setup 
The combination of OT with a microfluidics system allows a rapid transition between different experimental conditions. Moreover, current systems take advantage of maintaining the laminar flow inside the flow cell, which precludes the mixing of liquids from other channels in the perpendicular direction relative to the flow direction. Therefore, laminar flow is particularly advantageous for the experimental design. Currently, flow cells with up to 5 channels are commonly employed (Figure 3).

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Bacterial Strains</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli HB101</td>
			<td>lab collection</td>
			<td>N/A</td>
			<td>cloning of the vectors</td>
		</tr>
		<tr>
			<td>Chemicals and enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma-Aldrich</td>
			<td>31424</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Biotin-16-dUTP</td>
			<td>Roche</td>
			<td>11093070910</td>
			<td>Biotinylation</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A4737</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Catalase</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>Oxygen scavanger system</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>Melford Labs</td>
			<td>D11000</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>DNAse I from bovine pancreas</td>
			<td>Sigma-Aldrich</td>
			<td>D4527</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>Th.Geyer</td>
			<td>11786181</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sigma-Aldrich</td>
			<td>E9884</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Sigma-Aldrich</td>
			<td>11814320001</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma-Aldrich</td>
			<td>G8270-1KG</td>
			<td>Oxygen scavanger system</td>
		</tr>
		<tr>
			<td>Glucose-oxidase</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>Oxygen scavanger system</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Carl Roth</td>
			<td>HN78.3</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>Carl Roth</td>
			<td>2189.1</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Phusion DNA polymerase</td>
			<td>NEB</td>
			<td>M0530L</td>
			<td>Gibson assembly, cloning</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Merck</td>
			<td>529552-1KG</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>PrimeSTAR GXL DNA Polymerase</td>
			<td>Takara Bio Clontech</td>
			<td>R050A</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>Pyrophosphotase, thermostabile, inorganic</td>
			<td>NEB</td>
			<td>M0296L</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>Molox</td>
			<td>1000379515</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>rNTPS</td>
			<td>life technologies</td>
			<td>R0481</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>Sodium thiosulophate</td>
			<td>Sigma-Aldrich</td>
			<td>S6672-500G</td>
			<td>Bleach deactivation</td>
		</tr>
		<tr>
			<td>Sytox Green</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>confocal measurements</td>
		</tr>
		<tr>
			<td>T4 DNA Polymerase</td>
			<td>NEB</td>
			<td>M0203S</td>
			<td>Biotinylation</td>
		</tr>
		<tr>
			<td>T5 exonuclease</td>
			<td>NEB</td>
			<td>M0363S</td>
			<td>Gibson assembly, cloning</td>
		</tr>
		<tr>
			<td>T7 RNA polymerase</td>
			<td>Produced in-house</td>
			<td>N/A</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>NEB</td>
			<td>M0267S</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>Taq ligase</td>
			<td>Biozym</td>
			<td>L6060L</td>
			<td>Gibson assembly, cloning</td>
		</tr>
		<tr>
			<td>TWEEN 20 BioXtra</td>
			<td>Sigma-Aldrich</td>
			<td>P7949</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Kits</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive)</td>
			<td>Nanotemper</td>
			<td>MO-L011</td>
			<td>Used for ribosome labeling</td>
		</tr>
		<tr>
			<td>Purefrex 2.0</td>
			<td>GeneFrontier</td>
			<td>PF201-0.25-EX</td>
			<td>Ribosomes used for the labeling</td>
		</tr>
		<tr>
			<td>Oligonucleotides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5&#39; handle T7 forward</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#8217; - CTTAATACGACTCACTATAGGTC 
			CTTTCTGTGGACGCC - 3&#8217;, used to generate OT in vitro transcription template in PCR 1</td>
		</tr>
		<tr>
			<td>3&#8217; handle reverse</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; -&#160; GTCAAAGTGCGCCCCGTTATCC - 3&#39;, used to generate OT in vitro transcription template in PCR 1</td>
		</tr>
		<tr>
			<td>5&#39; handle forward</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; - TCCTTTCTGTGGACGCCGC - 3&#39; , used to generate 5&#39; handle in PCR 2</td>
		</tr>
		<tr>
			<td>5&#8217; handle reverse</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#8217; - CATAAATACCTCTTTACTAATATA 
			TATACCTTCGTAAGCTAGCGT - 3&#8217;, used to generate 5&#39; handle in PCR 2</td>
		</tr>
		<tr>
			<td>3&#8217; handle forward</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; - ATCCTGCAACCTGCTCTTCGCC 
			AG - 3&#39;, used to generate 3&#39; handle in PCR 3</td>
		</tr>
		<tr>
			<td>3&#8217; handle reverse 5&#8217;labeled with digoxigenin</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; -[Dig]-GTCAAAGTGCGCCCCGTTATCC - 3&#39;, used to generate 3&#39; handle in PCR 3</td>
		</tr>
		<tr>
			<td>DNA vectors</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pMZ_OT</td>
			<td>produced in-house</td>
			<td>N/A</td>
			<td>further description in &#34;Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control&#34; 
			Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley 
			bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035</td>
		</tr>
		<tr>
			<td>Software and Algorithms</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Atom</td>
			<td>https://atom.io/packages/ide-python</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Bluelake</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Graphpad</td>
			<td>https://www.graphpad.com/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>InkScape 0.92.3</td>
			<td>https://inkscape.org/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Matlab</td>
			<td>https://www.mathworks.com/products/matlab.html</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>POTATO</td>
			<td>https://github.com/lpekarek/POTATO.git</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAstructure</td>
			<td>https://rna.urmc.rochester.edu/RNAstructure.html</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Spyder</td>
			<td>https://www.spyder-ide.org/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Other</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin Coated Polystyrene Particles, 1.5-1.9 &#181;m, 5 ml, 1.0% w/v</td>
			<td>Spherotech</td>
			<td>SVP-15-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 &#181;m, 2 ml, 0.1% w/v</td>
			<td>Spherotech</td>
			<td>DIGP-20-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringes</td>
			<td>VWR</td>
			<td>TERUMO SS+03L1</td>
			<td></td>
		</tr>
		<tr>
			<td>Devices</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>C-trap</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>&#160;optical tweezers coupled with confocal microscopy</td>
		</tr>
	</tbody>
</table>

optical tweezers to study rna-protein interactions in translation regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

In this section, focus is mainly given on measurements of RNA-protein/ligand interactions by the fluorescence optical tweezers. For a description of general RNA optical tweezers experiments and corresponding representative results, see32. For more detailed discussion of the RNA/DNA-protein interactions, also see1,2,26,59,60.
<p clas...

Watch this Scientific Journal Video about Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation at JoVE.com

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the ...

optical-tweezers-to-study-rna-protein-interactions-translation

Research

JoVE Journal

Biochemistry

4.8K Views.  Helmholtz Zentrum für Infektionsforschung (Helmholtz Centre for Infection Research). This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

Video: Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

Isolation of Cognate RNA-protein Complexes from Cells Using Oligonucleotide-directed Elution

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. They are composed of position-dependent, cis-acting RNA elements and unique combinations of RNA binding proteins. Defining the composition of a specific RNP is essential to achieving a fundamental understanding of gene regulation. The isolation of a select RNP is akin to finding a needle in a haystack. Here, we demonstrate an approach to isolate RNPs associated at the 5' untranslated region of a select mRNA in asynchronous, transfected cells. This cognate RNP has been demonstrated to be necessary for the translation of select viruses and cellular stress-response genes.
The demonstrated RNA-protein co-precipitation protocol is suitable for the downstream analysis of protein components through proteomic analyses, immunoblots, or suitable biochemical identification assays. This experimental protocol demonstrates that DHX9/RNA helicase A is enriched at the 5' terminus of cognate retroviral RNA and provides preliminary information for the identification of its association with cell stress-associated huR and junD cognate mRNAs.

This manuscript describes an approach to isolate select cognate RNPs formed in eukaryotic cells via a specific oligonucleotide-directed enrichment. We demonstrate the applicability of this approach by isolating a cognate RNP bound to the retroviral 5' untranslated region that is composed of DHX9/RNA helicase A.

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. ...

Fluorescence Anisotropy as a Tool to Study Protein-protein Interactions

Protein-protein interactions play an essential role in the function of a living organism. Once an interaction has been identified and validated it is necessary to characterize it at the structural and mechanistic level. Several biochemical and biophysical methods exist for such purpose. Among them, fluorescence anisotropy is a powerful technique particularly used when the fluorescence intensity of a fluorophore-labeled protein remains constant upon protein-protein interaction. In this technique, a fluorophore-labeled protein is excited with vertically polarized light of an appropriate wavelength that selectively excites a subset of the fluorophores according to their relative orientation with the incoming beam. The resulting emission also has a directionality whose relationship in the vertical and horizontal planes defines anisotropy (r) as follows: r=(IVV-IVH)/(IVV+2IVH), where IVV and IVH are the fluorescence intensities of the vertical and horizontal components, respectively. Fluorescence anisotropy is sensitive to the rotational diffusion of a fluorophore, namely the apparent molecular size of a fluorophore attached to a protein, which is altered upon protein-protein interaction. In the present text, the use of fluorescence anisotropy as a tool to study protein-protein interactions was exemplified to address the binding between the protein mutated in the Shwachman-Diamond Syndrome (SBDS) and the Elongation factor like-1 GTPase (EFL1). Conventionally, labeling of a protein with a fluorophore is carried out on the thiol groups (cysteine) or in the amino groups (the N-terminal amine or lysine) of the protein. However, SBDS possesses several cysteines and lysines that did not allow site directed labeling of it. As an alternative technique, the dye 4&#39;,5&#39;-bis(1,3,2 dithioarsolan-2-yl) fluorescein was used to specifically label a tetracysteine motif, Cys-Cys-Pro-Gly-Cys-Cys, genetically engineered in the C-terminus of the recombinant SBDS protein. Fitting of the experimental data provided quantitative and mechanistic information on the binding mode between these proteins.

Protein interactions are at the heart of a cell&#39;s function. Calorimetric and spectroscopic techniques are commonly used to characterize them. Here we describe fluorescence anisotropy as a tool to study the interaction between the protein mutated in the Shwachman-Diamond Syndrome (SBDS) and the Elongation factor-like 1 GTPase (EFL1).

Protein-protein interactions play an essential role in the function of a living organism. Once an interaction has been identified and validated it is ...

Time-resolved ElectroSpray Ionization Hydrogen-deuterium Exchange Mass Spectrometry for Studying Protein Structure and Dynamics

Intrinsically disordered proteins (IDPs) have long been a challenge to structural biologists due to their lack of stable secondary structure elements. Hydrogen-Deuterium Exchange (HDX) measured at rapid time scales is uniquely suited to detect structures and hydrogen bonding networks that are briefly populated, allowing for the characterization of transient conformers in native ensembles. Coupling of HDX to mass spectrometry offers several key advantages, including high sensitivity, low sample consumption and no restriction on protein size. This technique has advanced greatly in the last several decades, including the ability to monitor HDX labeling times on the millisecond time scale. In addition, by incorporating the HDX workflow onto a microfluidic platform housing an acidic protease microreactor, we are able to localize dynamic properties at the peptide level. In this study, Time-Resolved ElectroSpray Ionization Mass Spectrometry (TRESI-MS) coupled to HDX was used to provide a detailed picture of residual structure in the tau protein, as well as the conformational shifts induced upon hyperphosphorylation.

Conformational flexibility plays a critical role in protein function. Herein, we describe the use of time-resolved electrospray ionization mass spectrometry coupled to hydrogen-deuterium exchange for probing the rapid structural changes that drive function in ordered and disordered proteins.

Intrinsically disordered proteins (IDPs) have long been a challenge to structural biologists due to their lack of stable secondary structure elements. ...

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biotinylated Cell-penetrating Peptides to Study Intracellular Protein-protein Interactions

Here we present a protocol to study intracellular protein-protein interactions that is based on the widely used biotin-avidin pull-down system. The modification presented includes the combination of this technique with cell-penetrating sequences. We propose to design cell-penetrating baits that can be incubated with living cells instead of cell lysates and therefore the interactions found will reflect those that occur within the intracellular context. Connexin43 (Cx43), a protein that forms gap junction channels and hemichannels is down-regulated in high-grade gliomas. The Cx43 region comprising amino acids 266-283 is responsible for the inhibition of the oncogenic activity of c-Src in glioma cells. Here we use TAT as the cell-penetrating sequence, biotin as the pull-down tag and the region of Cx43 comprised between amino acids 266-283 as the target to find intracellular interactions in the hard-to-transfect human glioma stem cells. One of the limitations of the proposed method is that the molecule used as bait could fail to fold properly and, consequently, the interactions found could not be associated with the effect. However, this method can be especially interesting for the interactions involved in signal transduction pathways because they are usually carried out by intrinsically disordered regions and, therefore, they do not require an ordered folding. In addition, one of the advantages of the proposed method is that the relevance of each residue on the interaction can be easily studied. This is a modular system; therefore, other cell-penetrating sequences, other tags, and other intracellular targets can be employed. Finally, the scope of this protocol is far beyond protein-protein interaction because this system can be applied to other bioactive cargoes such as RNA sequences, nanoparticles, viruses or any molecule that can be transduced with cell-penetrating sequences and fused to pull-down tags to study their intracellular mechanism of action.

This is a protocol to study intracellular protein-protein interactions based on the biotin-avidin pull-down system with the novelty of combining cell-penetrating sequences. The main advantage is that the target sequence is incubated with living cells instead of cell lysates and therefore the interactions will occur within the cellular context.

Here we present a protocol to study intracellular protein-protein interactions that is based on the widely used biotin-avidin pull-down system. The ...

Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription reflect changes in protein synthesis, but many exceptions have been observed. Recently, a technique called ribosome profiling (or Ribo-Seq) has emerged as a powerful method that allows identification, with high accuracy, which regions of mRNA are translated into proteins and quantification of translation at the genome-wide level. Here, we present a generalized protocol for genome-wide quantification of translation using Ribo-Seq in budding yeast. In addition, combining Ribo-Seq data with mRNA abundance measurements allows us to simultaneously quantify translation efficiency of thousands of mRNA transcripts in the same sample and compare changes in these parameters in response to experimental manipulations or in different physiological states. We describe a detailed protocol for generation of ribosome footprints using nuclease digestion, isolation of intact ribosome-footprint complexes via sucrose gradient fractionation, and preparation of DNA libraries for deep sequencing along with appropriate quality controls necessary to ensure accurate analysis of in vivo translation.

Translational regulation plays an important role in the control of protein abundance. Here, we describe a high-throughput method for quantitative analysis of translation in the budding yeast Saccharomyces cerevisiae.

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription ...

Using Three-color Single-molecule FRET to Study the Correlation of Protein Interactions

Single-molecule F&#246;rster resonance energy transfer (smFRET) has become a widely used biophysical technique to study the dynamics of biomolecules. For many molecular machines in a cell proteins have to act together&#160;with interaction partners in a functional cycle to fulfill their task. The extension of two-color to multi-color smFRET makes it possible to simultaneously probe more than one interaction or conformational change. This not only adds a new dimension to smFRET experiments but it also offers the unique possibility to directly study the sequence of events and to detect correlated interactions when using an immobilized sample and a total internal reflection fluorescence microscope (TIRFM). Therefore, multi-color smFRET is a versatile tool for studying biomolecular complexes in a quantitative manner and in a previously unachievable detail.
Here, we demonstrate how to overcome the special challenges of multi-color smFRET experiments on proteins. We present detailed protocols for obtaining the data and for extracting kinetic information. This includes trace selection criteria, state separation, and the recovery of state trajectories from the noisy data using a 3D ensemble Hidden Markov Model (HMM). Compared to other methods, the kinetic information is not recovered from dwell time histograms but directly from the HMM. The maximum likelihood framework allows us to critically evaluate the kinetic model and to provide meaningful uncertainties for the rates.
By applying our method to the heat shock protein 90 (Hsp90), we are able to disentangle the nucleotide binding and the global conformational changes of the protein. This allows us to directly observe the cooperativity between the two nucleotide binding pockets of the Hsp90 dimer.

Here, we present a protocol to obtain three-color smFRET data and its analysis with a 3D ensemble Hidden Markov Model. With this approach, scientists can extract kinetic information from complex protein systems, including cooperativity or correlated interactions.

Single-molecule F&#246;rster resonance energy transfer (smFRET) has become a widely used biophysical technique to study the dynamics of biomolecules. For ...

Small-Scale Colorimetric Assays of Intracellular Lactate and Pyruvate in the Nematode Caenorhabditis elegans

Lactate and pyruvate are key intermediates of intracellular energy metabolic pathways. Monitoring the lactate/pyruvate ratio in cells helps to determine whether there is an imbalance in age-related energy metabolism between mitochondrial oxidative phosphorylation and aerobic glycolysis. Here, we show the utilization of commercial colorimetric assay kits for lactate and pyruvate in the model organism C. elegans. Recently, the sensitivity and accuracy of the colorimetric/fluorimetric assay kits have been improved greatly by the research and development conducted by reagent manufacturers. The improved reagents have enabled the use of small-scale assays with a 96-well plate in C. elegans. In general, a fluorimetric assay is superior in sensitivity to a colorimetric assay; however, the colorimetric approach is more suitable for the use in common laboratories. Another important issue in these assays for quantitative determination is protein precipitation of homogenized C. elegans samples. In our protein precipitation method, common precipitants (e.g., trichloroacetic acid, perchloric acid and metaphosphoric acid) are used for sample preparation. A protein-free assay sample is prepared by directly adding cold precipitant (final concentration of 5%) during homogenization.

Small-Scale Colorimetric Assays of Intracellular Lactate and Pyruvate in the Nematode Caenorhabditis elegans

We describe a modified small-scale extraction and colorimetric assays of lactate and pyruvate in the nematode C. elegans. When utilizing commercial assay kits, the technical development of their sensitivity and accuracy is important. Protein precipitation in extraction is the most critical step for the quantitative determination of intracellular metabolites.

Lactate and pyruvate are key intermediates of intracellular energy metabolic pathways. Monitoring the lactate/pyruvate ratio in cells helps to determine ...

In Vivo Hydroxyl Radical Protein Footprinting for the Study of Protein Interactions in Caenorhabditis elegans

Fast oxidation of proteins (FPOP) is a hydroxyl radical protein footprinting (HRPF) method used to study protein structure, protein-ligand interactions, and protein-protein interactions. FPOP utilizes a KrF excimer laser at 248 nm for photolysis of hydrogen peroxide to generate hydroxyl radicals which in turn oxidatively modify solvent-accessible amino acid side chains. Recently, we expanded the use of FPOP of in vivo oxidative labeling in Caenorhabditis elegans (C. elegans), entitled IV-FPOP. The transparent nematodes have been used as model systems for many human diseases. Structural studies in C. elegans by IV-FPOP is feasible because of the animal&#8217;s ability to uptake hydrogen peroxide, their transparency to laser irradiation at 248 nm, and the irreversible nature of the modification. The assembly of a microfluidic flow system for IV-FPOP labeling, IV-FPOP parameters, protein extraction, and LC-MS/MS optimized parameters are described herein.

In Vivo Hydroxyl Radical Protein Footprinting for the Study of Protein Interactions in Caenorhabditis elegans

In vivo fast photochemical oxidation of proteins (IV-FPOP) is a hydroxyl radical protein footprinting technique that allows for mapping of protein structure in their native environment. This protocol describes the assembly and set-up of the IV-FPOP microfluidic flow system.

Fast oxidation of proteins (FPOP) is a hydroxyl radical protein footprinting (HRPF) method used to study protein structure, protein-ligand interactions, ...

Dual-Color Fluorescence Cross-Correlation Spectroscopy to Study Protein-Protein Interaction and Protein Dynamics in Live Cells

We present a protocol and workflow to perform live cell dual-color fluorescence cross-correlation spectroscopy (FCCS) combined with F&#246;rster Resonance Energy transfer (FRET) to study membrane receptor dynamics in live cells using modern fluorescence labeling techniques. In dual-color FCCS, where the fluctuations in fluorescence intensity represent the dynamic &#34;fingerprint&#34; of the respective fluorescent biomolecule, we can probe co-diffusion or binding of the receptors. FRET, with its high sensitivity to molecular distances, serves as a well-known &#34;nanoruler&#34; to monitor intramolecular changes. Taken together, conformational changes and key parameters such as local receptor concentrations and mobility constants become accessible in cellular settings.
Quantitative fluorescence approaches are challenging in cells due to high noise levels and the vulnerability of the sample. Here we show how to perform this experiment, including the calibration steps using dual-color labeled &#946;2-adrenergic receptor (&#946;2AR) labeled with eGFP and SNAP-tag-TAMRA. A step-by-step data analysis procedure is provided using open-source software and templates that are easy to customize.
Our guideline enables researchers to unravel molecular interactions of biomolecules in live cells in situ with high reliability despite the limited signal-to-noise levels in live cell experiments. The operational window of FRET and particularly FCCS at low concentrations allows quantitative analysis at near-physiological conditions.

We present an experimental protocol and data analysis workflow to perform live cell dual-color fluorescence cross correlation spectroscopy (FCCS) combined with F&#246;rster Resonance Energy transfer (FRET) to study membrane receptor dynamics in live cells using modern fluorescence labeling techniques.

We present a protocol and workflow to perform live cell dual-color fluorescence cross-correlation spectroscopy (FCCS) combined with F&#246;rster Resonance ...

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Isolation of Cognate RNA-protein Complexes from Cells Using Oligonucleotide-directed Elution

Fluorescence Anisotropy as a Tool to Study Protein-protein Interactions

Time-resolved ElectroSpray Ionization Hydrogen-deuterium Exchange Mass Spectrometry for Studying Protein Structure and Dynamics

Quantitative Immunofluorescence to Measure Global Localized Translation

Biotinylated Cell-penetrating Peptides to Study Intracellular Protein-protein Interactions

Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Using Three-color Single-molecule FRET to Study the Correlation of Protein Interactions

Small-Scale Colorimetric Assays of Intracellular Lactate and Pyruvate in the Nematode Caenorhabditis elegans

In Vivo Hydroxyl Radical Protein Footprinting for the Study of Protein Interactions in Caenorhabditis elegans

Dual-Color Fluorescence Cross-Correlation Spectroscopy to Study Protein-Protein Interaction and Protein Dynamics in Live Cells