This research was supported by the Research and Development Funding from Aptagen LLC.

NOTE: Figure 2 shows the main steps of the ITC experiment for determining the thermodynamic and kinetic association of a DNA aptamer and tetracycline.
1. Preparation of samples
NOTE: Samples for ITC need to be prepared in the same buffer for both the aptamer and ligand to avoid heat release caused by mixing different buffers from the sample cell and syringe. This is typically achieved through dialysis of all materials into the same buffer. The buffer is exchanged using a protocol adapted from the protocol of a 3 kDa molecular weight cutoff (MWC) concentrator with some modifications, as below:
<ol>
	<li>Activate the membrane of the dialysis column (3 kDa MWC) with 1x PBS, pH 7.4, purchased from the manufacturer, using the following steps: fill with 1x buffer (PBS), equilibrate for 10 min at RT, and centrifuge at 5,000 x g for 15 min.</li>
	<li>Remove the buffer and load 500 &#181;L of aptamer samples into the column, centrifuge at 5,000 x g, and repeat it 4x to exchange the original buffer for 1x PBS. When the buffer goes through the membrane, all molecules with a mass less than 3 kDa will go through the membrane, and the aptamer will remain on the upper side of the membrane.</li>
	<li>Collect the dialyzed DNA aptamer using a pipet and transfer it to the new 1.5 mL tube(s).</li>
	<li>Collect the last flowthrough buffer to dissolve tetracycline. Tetracycline powder is pure and small, so dialysis is not needed. However, use the previous dialyzed buffer for DNA for the target to ensure that the buffer for the experiment in the syringe matches the buffer in the reference cell.</li>
	<li>Determine the aptamer concentration again using a UV-visible spectrometer. Use the last exchange buffer to adjust the concentration to 40 &#181;M tetracycline and 2 &#181;M aptamer.</li>
	<li>Fold the DNA aptamer by heating at 90 &#176;C for 10 min, cooling at 4 &#176;C for 10 min, and then returning to RT for 20 min.</li>
	<li>Degas the folded aptamer and dialyzed tetracycline using a degassing station or vacuum pump set to 600 mmHg at 25 &#176;C for 25 min to eliminate dissolved gases.</li>
</ol>
2. Washing the instrument and running the test kit
<ol>
	<li>Clean the solvent ports to ensure the entire sample path is clear. Clean by discarding the waste solution and loading them with pure methanol, water, and buffer. Each port contains more than 250 mL to ensure enough solution for cleaning. 
	NOTE: The cleaning process is automatically completed by user-programmable ITC control software.</li>
	<li>Test the cleanliness of the machine by running ITC using buffer into a buffer (i.e., 1x PBS into 1x PBS). 
	NOTE: A normal noise baseline is visible between the tiny buffer into buffer injection peaks. When the titration syringe and cannulas are adequately cleaned and completely dry, the baseline will be stable; an increase or decrease in the baseline reflects dirty instrumentation or bubbles inside the instrument, which need to be corrected before running actual samples.</li>
	<li>Test the accuracy of the machine with a standard kit that includes EDTA and CaCl2 (Figure 3), using the default program and following the instructions from the manufacturer.</li>
</ol>
3. Running the sample to determine the binding between aptamer and tetracycline
<ol>
	<li>Set up the running parameters: a stirring rate of 200 rpm, running at 25 &#176;C, 2 &#181;M aptamer and 40 &#181;M tetracycline, 30 injections with 2.0 &#181;L each, a delaying time of 180 s.</li>
	<li>Check the required volumes using a running program calculator. With this running parameter, perform ITC measurement with 230 &#181;L of 40 &#181;M tetracycline in the ITC syringe and 485 &#181;L of 2 &#181;M aptamer in the ITC sample cell using the ITC.</li>
	<li>Load the dialyzed tetracycline syringe plates and the folded aptamer into the sample cell, avoiding bubbles, using a pipette.</li>
	<li>Start running the ITC instrument by clicking on the start button on the software. 
	&#8203;NOTE: The ITC instrument running process is fully automated after manually filling the reference cell and titrant sample plates.</li>
</ol>
4. Analyzing data using software
<ol>
	<li>Open the data analysis software by double clicking to start analyzing the data.</li>
	<li>Open the path of the saved raw data to know the tendency of binding.</li>
	<li>Open the modeling tab and use different binding models to find the best fit for the data curve. Then, the software automatically calculates the ITC thermogram and various thermodynamic parameters, including enthalpy (&#916;H), entropy (&#916;S), free energy (&#916;G), equilibrium binding constant (Ka), and stoichiometry.</li>
	<li>Collect the thermodynamic parameters determined from the data and fitting model information.</li>
	<li>Create a report, including pictures of the ITC thermogram and various thermodynamic parameters, as shown in Figure 4 and Table 1.</li>
</ol>

<ol>
	<li>Ellington, A. D., Szostak, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+RNA+molecules+that+bind+specific+ligands.">In vitro selection of RNA molecules that bind specific ligands.</a> Nature. 346 (6287), 818-822 (1990).</li><li>Tuerk, C., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evolution+of+ligands+by+exponential+enrichment:+RNA+ligands+to+bacteriophage+T4+DNA+polymerase.">Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.</a> Science. 249 (4968), 505-510 (1990).</li><li>Kim, S. H., Thoa, T. T. T., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptasensors+for+environmental+monitoring+of+contaminants+in+water+and+soil.">Aptasensors for environmental monitoring of contaminants in water and soil.</a> Current Opinion in Environmental Science &amp; Health. 10, 9-21 (2019).</li><li>Dunn, M. R., Jimenez, R. M., Chaput, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+discovery+and+technology.">Analysis of aptamer discovery and technology.</a> Nature Reviews Chemistry. 1, 0076 (2017).</li><li>Stoltenburg, R., Reinemann, C., Strehlitz, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SELEX--A+(r)evolutionary+method+to+generate+high-affinity+nucleic+acid+ligands.">SELEX--A (r)evolutionary method to generate high-affinity nucleic acid ligands.</a> Biomolecular Engineering. 24 (4), 381-403 (2007).</li><li>Wang, Y., Wang, G., Moitessier, N., Mittermaier, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzyme+kinetics+by+isothermal+titration+calorimetry:+Allostery,+inhibition,+and+dynamics.">Enzyme kinetics by isothermal titration calorimetry: Allostery, inhibition, and dynamics.</a> Frontiers in Molecular Biosciences. 7, 583826 (2020).</li><li>Velazquez-Campoy, A., Freire, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+titration+calorimetry+to+determine+association+constants+for+high-affinity+ligands.">Isothermal titration calorimetry to determine association constants for high-affinity ligands.</a> Nature Protocols. 1 (1), 186-191 (2006).</li><li>Niazi, J. H., Lee, S. J., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-stranded+DNA+aptamers+specific+for+antibiotics+tetracyclines.">Single-stranded DNA aptamers specific for antibiotics tetracyclines.</a> Bioorganic and Medicinal Chemistry. 16 (15), 7245-7253 (2008).</li><li>Kim, Y. J., Kim, Y. S., Niazi, J. H., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+aptasensor+for+tetracycline+detection.">Electrochemical aptasensor for tetracycline detection.</a> Bioprocess and Biosystems Engineering. 33 (1), 31-37 (2010).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+indirect+competitive+assay-based+aptasensor+for+highly+sensitive+detection+of+tetracycline+residue+in+honey.">Development of an indirect competitive assay-based aptasensor for highly sensitive detection of tetracycline residue in honey.</a> Biosensors &amp; Bioelectronics. 57, 192-198 (2014).</li><li>Kim, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+colorimetric+aptasensor+using+gold+nanoparticle+for+a+highly+sensitive+and+specific+detection+of+oxytetracycline.">A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline.</a> Biosensors &amp; Bioelectronics. 26 (4), 1644-1649 (2010).</li><li>Thoa, T. T., Minagawa, N., Aigaki, T., Ito, Y., Uzawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+photosensitisation+processes+by+an+RNA+aptamer.">Regulation of photosensitisation processes by an RNA aptamer.</a> Scientific Reports. 7, 43272 (2017).</li><li>Horowitz, E. D., Lilavivat, S., Holladay, B. W., Germann, M. W., Hud, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+structure+and+thermodynamics+of+2',5'+RNA+intercalation.">Solution structure and thermodynamics of 2',5' RNA intercalation.</a> Journal of the American Chemical Society. 131 (16), 5831-5838 (2009).</li><li>Sigurskjold, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exact+analysis+of+competition+ligand+binding+by+displacement+isothermal+titration+calorimetry.">Exact analysis of competition ligand binding by displacement isothermal titration calorimetry.</a> Analytical Biochemistry. 277 (2), 260-266 (2000).</li><li>Neves, M. A. D., Slavkovic, S., Churcher, Z. R., Johnson, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salt-mediated+two-site+ligand+binding+by+the+cocaine-binding+aptamer.">Salt-mediated two-site ligand binding by the cocaine-binding aptamer.</a> Nucleic Acids Research. 45 (3), 1041-1048 (2017).</li><li>Turnbull, W. B., Daranas, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+value+of+c:+Can+low+affinity+systems+be+studied+by+isothermal+titration+calorimetry.">On the value of c: Can low affinity systems be studied by isothermal titration calorimetry.</a> Journal of the American Chemical Society. 125 (48), 14859-14866 (2003).</li><li>Van Ness, J., Van Ness, L. K., Galas, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+reactions+for+the+amplification+of+oligonucleotides.">Isothermal reactions for the amplification of oligonucleotides.</a> Proceedings of the National Academy of Sciences of the United States of America. 100 (8), 4504-4509 (2003).</li></ol>

The authors declare no competing financial interests.

The method presented here was modified according to instruction from TA Instruments and is sufficient to determine the binding affinity and thermodynamics of many selected aptamers and targets at our center. Crucial steps from this procedure include exchanging the buffer to have a target matching the ligand, running samples with proper parameters, and finding the appropriate binding fitting model to analyze the data. Continuous recording of heat release requires eliminating all noise heat, such as from mismatch of the bu...

Aptamers are ssDNA or RNA fragments selected through an evolution process with high binding affinity and specificity to the desired targets1,2, which can work as advanced recognition elements or chemical antibodies3,4,5. Thus, the binding affinity and specificity of aptamers to their targets play a crucial role in the selection and application of an aptamer, and Isothermal Titration Calorimetry (ITC) has been widely used for these characterization purposes. Many approaches have been used to determine the affinity of aptamers, including ITC, surface plasmon resonance (SPR), colorimetric titration, microscale thermophoresis (MST), and Bio-Layer Interferometry (BLI). Among them, ITC is one of the latest techniques to determine the thermodynamic and kinetic association of two molecules in the solution phase. This approach conducts continuous titration using label-free molecules and records released heat over time upon the binding events produced by each titration6,7. Unlike other methods, ITC can offer binding affinity, several binding sites, and thermodynamic and kinetic association&#160;(Figure 1A). From these initial parameters, the Gibbs free energy changes and entropy changes are determined using the following relationship:
&#916;G = &#916;H-T&#916;S
That means that ITC offers a complete thermodynamic profile of the molecular interaction to elucidate the binding mechanisms (Figure 1B). Determining the binding affinity for small molecules with an aptamer is difficult due to the drastically different sizes between aptamer and target. Meanwhile, ITC can provide sensitive measurement without labeling and immobilizing molecules, which provides a means of keeping the natural structure of the aptamer and target during measurement. With the mentioned attributes, ITC can be used as the standard method for the characterization of binding between an aptamer and small targets.
After selection by the Gu group, this aptamer was integrated with different platforms, including electrochemical aptamer-based biosensors, a competitive enzyme-linked aptamer assay, and a microtiter plate, which can achieve high-throughput detection of tetracycline8,9,10. However, its binding characteristics have not been elucidated well enough to choose the proper platform8; it is worth characterizing the binding of the aptamer to the tetracycline using ITC.

<table><tbody><tr><td>5&#039;-CGTACGGAATTCG CTAGCCCCCCGGCAGGCCACGG&lt;br/&gt; C TTGGGTTGGTCCCACTGCGCG&lt;br/&gt; TGGATCCGAGCTCCAC GTG-3&#039;</td><td>Integrated DNA Technologies, Inc</td><td></td><td>The sequence is adopted from Gu&#039;s research, which has not identified Kd using ITC (refer references 8 and 9)</td></tr><tr><td>Affinity ITC Auto Low Volume (190 &amp;micro;L) System Complete&amp;ndash;Gold Cells</td><td>TA Instruments</td><td>61000.901</td><td>Isothermal titration calorimetry system</td></tr><tr><td>CaCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Avantor (VWR)</td><td>E506-100ML</td><td>Calcium chloride 1 M in aqueous solution, Biotechnology Grade, sterile</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417R</td><td>The Eppendorf 5417R is unsurpassed in safety, reliability and ease-of-use. Very easy to maintain with a brushless motor that spins up to 16,400 RPM with maximum RCF up to 25,000 x g.</td></tr><tr><td>Complete Degassing Station (110/230V)</td><td>TA Instruments</td><td>6326</td><td>This degasser provides a self-contained stirring platform, vacuum chamber, vacuum port, temperature control and electronic timer for proper sample preparation.</td></tr><tr><td>EDTA</td><td>TekNova</td><td>E0375</td><td>EDTA 500 mM, pH 7.5</td></tr><tr><td>NanoDrop One Microvolume UV-Vis Spectrophotometer</td><td>ThermoFisher</td><td>ND-ONE-W</td><td>UV-Vis Spectrophotometer</td></tr><tr><td>Nanosep, Nanosep MF and NAB Centrifugal Devices</td><td>Pall Laboratory</td><td>OD030C34</td><td>3 kDa molecular weight cutoff concentrator</td></tr><tr><td>PBS pH 7.4</td><td>IBI Scientific</td><td>IB70165</td><td>Buffer containing Sodium phosphate, Sodium chloride, Potassium phosphate, and Potassium chloride Ultra-Pure Grade Sterile filtered using 0.2 &amp;micro;m filter. Autoclaved at 121 &amp;deg;C for greater than 20 min.</td></tr><tr><td>Posi-Click 1.7 mL Large Cap Microcentrifuge Tubes</td><td>labForce (a Thomas Scientific Brand)</td><td>1149K01</td><td></td></tr><tr><td>Tetracycline, Hydrochoride</td><td>EMD Millipore Corperation</td><td>CAS64-75-5</td><td></td></tr></tbody></table>

determining the thermodynamic and kinetic association of a dna aptamer and tetracycline using isothermal titration calorimetry

The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for application. Due to the drastic differences between the aptamer and small molecules, scientists need to put much effort into characterizing their binding properties. Isothermal Titration Calorimetry (ITC) is a powerful approach for this purpose. ITC goes beyond determining disassociation constants (Kd) and can provide the enthalpy changes and binding stoichiometry of the interaction between two molecules in the solution phase. This approach conducts continuous titration using label-free molecules and records released heat over time upon the binding events produced by each titration, so the process can sensitively measure the binding between macromolecules and their small targets. Herein, the article introduces a step-by-step procedure of the ITC measurement of a selected aptamer with a small target, tetracycline. This example proves the versatility of the technique and its potential for other applications.

ITC provides an accurate disassociation constant (Kd), the binding stoichiometry, and the thermodynamic parameters of two-molecule interactions6. In this example, the aptamer selected by Kim et al.9,11 binds to tetracycline with binding affinities of Kd 1 = 13 &#181;M, Kd 2 = 53 nM. Interestingly, this binding was determined using the equilibrium filtration method and a reported K...

Watch this Scientific Journal Video about Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry at JoVE.com

Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry

The present protocol describes the use of Isothermal Titration Calorimetry (ITC) to analyze the association and dissociation kinetics of the binding between a DNA aptamer and tetracycline, including sample preparation, running standards and samples, and interpreting the resulting data.

The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for ...

determining-thermodynamic-kinetic-association-dna-aptamer

Research

JoVE Journal

Biochemistry

2.8K Views.  Aptagen LLC. The present protocol describes the use of Isothermal Titration Calorimetry (ITC) to analyze the association and dissociation kinetics of the binding between a DNA aptamer and tetracycline, including sample preparation, running standards and samples, and interpreting the resulting data. 

Video: Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry

Mapping the Binding Site of an Aptamer on ATP Using MicroScale Thermophoresis

Characterization of molecular interactions in terms of basic binding parameters such as binding affinity, stoichiometry, and thermodynamics is an essential step in basic and applied science. MicroScale Thermophoresis (MST) is a sensitive biophysical method to obtain this important information. Relying on a physical effect called thermophoresis, which describes the movement of molecules through temperature gradients, this technology allows for the fast and precise determination of binding parameters in solution and allows the free choice of buffer conditions (from buffer to lysates/sera). MST uses the fact that an unbound molecule displays a different thermophoretic movement than a molecule that is in complex with a binding partner. The thermophoretic movement is altered in the moment of molecular interaction due to changes in size, charge, and hydration shell. By comparing the movement profiles of different molecular ratios of the two binding partners, quantitative information such as binding affinity (pM to mM) can be determined. Even challenging interactions between molecules of small sizes, such as aptamers and small compounds, can be studied by MST. Using the well-studied model interaction between the DH25.42 DNA aptamer and ATP, this manuscript provides a protocol to characterize aptamer-small molecule interactions. This study demonstrates that MST is highly sensitive and permits the mapping of the binding site of the 7.9 kDa DNA aptamer to the adenine of ATP.

MicroScale Thermophoresis (MST) is a sensitive technology to characterize aptamer-target interactions. This manuscript describes an MST protocol to characterize aptamer-small molecule interactions.

Characterization of molecular interactions in terms of basic binding parameters such as binding affinity, stoichiometry, and thermodynamics is an ...

Differential Scanning Calorimetry &#8212; A Method for Assessing the Thermal Stability and Conformation of Protein Antigen

Differential scanning calorimetry (DSC) is an analytical technique that measures the molar heat capacity of samples as a function of temperature. In the case of protein samples, DSC profiles provide information about thermal stability, and to some extent serves as a structural &#8220;fingerprint&#8221; that can be used to assess structural conformation. It is performed using a differential scanning calorimeter that measures the thermal transition temperature (melting temperature; Tm) and the energy required to disrupt the interactions stabilizing the tertiary structure (enthalpy; &#8710;H) of proteins. Comparisons are made between formulations as well as production lots, and differences in derived values indicate differences in thermal stability and structural conformation. Data illustrating the use of DSC in an industrial setting for stability studies as well as monitoring key manufacturing steps are provided as proof of the effectiveness of this protocol. In comparison to other methods for assessing the thermal stability of protein conformations, DSC is cost-effective, requires few sample preparation steps, and also provides a complete thermodynamic profile of the protein unfolding process.

Differential scanning calorimetry measures the thermal transition temperature(s) and total heat energy required to denature a protein. Results obtained are used to assess the thermal stability of protein antigens in vaccine formulations.

Differential scanning calorimetry (DSC) is an analytical technique that measures the molar heat capacity of samples as a function of temperature. In the ...

Hot Biological Catalysis: Isothermal Titration Calorimetry to Characterize Enzymatic Reactions

Isothermal titration calorimetry (ITC) is a well-described technique that measures the heat released or absorbed during a chemical reaction, using it as an intrinsic probe to characterize virtually every chemical process. Nowadays, this technique is extensively applied to determine thermodynamic parameters of biomolecular binding equilibria. In addition, ITC has been demonstrated to be able of directly measuring kinetics and thermodynamic parameters (kcat, KM, &#916;H) of enzymatic reactions, even though this application is still underexploited. As heat changes spontaneously occur during enzymatic catalysis, ITC does not require any modification or labeling of the system under analysis and can be performed in solution. Moreover, the method needs little amount of material. These properties make ITC an invaluable, powerful and unique tool to study enzyme kinetics in several applications, such as, for example, drug discovery.
In this work an experimental ITC-based method to quantify kinetics and thermodynamics of enzymatic reactions is thoroughly described. This method is applied to determine kcat and KM of the enzymatic hydrolysis of urea by Canavalia ensiformis (jack bean) urease. Calculation of intrinsic molar enthalpy (&#916;Hint) of the reaction is performed. The values thus obtained are consistent with previous data reported in literature, demonstrating the reliability of the methodology.

Isothermal titration calorimetry measures heat flow released or absorbed in chemical reactions. This method can be used to quantify enzyme-catalysis. In this paper, the protocol for instrumental setup, experiment running, and data analysis is generally described, and applied to the characterization of enzymatic urea hydrolysis by jack bean urease.

Isothermal titration calorimetry (ITC) is a well-described technique that measures the heat released or absorbed during a chemical reaction, using it as ...

Chemistry

High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing approaches suffer from significant limitations, we have developed a new method for determining TF-DNA binding affinities with high sensitivity on a large scale. The assay relies on the established fluorescence anisotropy (FA) principle but introduces important technical improvements. First, we measure a full FA competitive titration curve in a single well by incorporating TF and a fluorescently labeled reference DNA in a porous agarose gel matrix. Unlabeled DNA oligomer is loaded on the top as a competitor and, through diffusion, forms a spatio-temporal gradient. The resulting FA gradient is then read out using a customized epifluorescence microscope setup. This improved setup greatly increases the sensitivity of FA signal detection, allowing both weak and strong binding to be reliably quantified, even for molecules of similar molecular weights. In this fashion, we can measure one titration curve per well of a multi-well plate, and through a fitting procedure, we can extract both the absolute dissociation constant (KD) and active protein concentration. By testing all single-point mutation variants of a given consensus binding sequence, we can survey the entire binding specificity landscape of a TF, typically on a single plate. The resulting position weight matrices (PWMs) outperform those derived from other methods in predicting in vivo TF occupancy. Here, we present a detailed guide for implementing HiP-FA on a conventional automated fluorescent microscope and the data analysis pipeline.

Here we present a novel method for determining binding affinities at equilibrium and in solution with high sensitivity on a large scale. This improves the quantitative analysis of transcription factor-DNA binding. The method is based on automated fluorescence anisotropy measurements in a controlled delivery system.

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing ...

Measuring Enzymatic Stability by Isothermal Titration Calorimetry

This work demonstrates a new method for measuring the stability of enzyme activity by isothermal titration calorimetry (ITC). The peak heat rate observed after a single injection of the substrate solution into an enzyme solution is correlated with enzyme activity. Multiple injections of the substrate into the same enzyme solution over time show the loss of enzyme activity. The assay is autonomous, requiring very little personnel time, and is applicable to most media and enzymes.&#160; &#160;

The thermal stability of enzyme activity is readily measured by isothermal titration calorimetry (ITC). Most protein stability assays currently used measure protein unfolding, but do not provide information about enzymatic activity. ITC enables direct determination of the effect of enzyme modifications on the stability of enzyme activity.

This work demonstrates a new method for measuring the stability of enzyme activity by isothermal titration calorimetry (ITC). The peak heat rate observed ...

Environment

Determination of In Vitro and Cellular Turn-on Kinetics for Fluorogenic RNA Aptamers

Fluorogenic RNA aptamers have been applied in live cells to tag and visualize RNAs, report on gene expression, and activate fluorescent biosensors that detect levels of metabolites and signaling molecules. In order to study dynamic changes in each of these systems, it is desirable to obtain real-time measurements, but the accuracy of the measurements depends on the kinetics of the fluorogenic reaction being faster than the sampling frequency. Here, we describe methods to determine the in vitro and cellular turn-on kinetics for fluorogenic RNA aptamers using a plate reader equipped with a sample injector and a flow cytometer, respectively. We show that the in vitro kinetics for the fluorescence activation of the Spinach2 and Broccoli aptamers can be modeled as two-phase association reactions and have differing fast phase rate constants of 0.56 s&#8722;1 and 0.35 s&#8722;1, respectively. In addition, we show that the cellular kinetics for the fluorescence activation of Spinach2 in Escherichia coli, which is further limited by dye diffusion into the Gram-negative bacteria, is still sufficiently rapid to enable accurate sampling frequency on the minute timescale. These methods to analyze fluorescence activation kinetics are applicable to other fluorogenic RNA aptamers that have been developed.

Determination of In Vitro and Cellular Turn-on Kinetics for Fluorogenic RNA Aptamers

The protocol presents two methods to determine the kinetics of the fluorogenic RNA aptamers Spinach2 and Broccoli. The first method describes how to measure fluorogenic aptamer kinetics in vitro with a plate reader, while the second method details the measurement of fluorogenic aptamer kinetics in cells by flow cytometry.

Fluorogenic RNA aptamers have been applied in live cells to tag and visualize RNAs, report on gene expression, and activate fluorescent biosensors that ...

Collecting Variable-concentration Isothermal Titration Calorimetry Datasets in Order to Determine Binding Mechanisms

Isothermal titration calorimetry (ITC) is commonly used to determine the thermodynamic parameters associated with the binding of a ligand to a host macromolecule. ITC has some advantages over common spectroscopic approaches for studying host/ligand interactions. For example, the heat released or absorbed when the two components interact is directly measured and does not require any exogenous reporters. Thus the binding enthalpy and the association constant (Ka) are directly obtained from ITC data, and can be used to compute the entropic contribution. Moreover, the shape of the isotherm is dependent on the c-value and the mechanistic model involved. The c-value is defined as c = n[P]tKa, where [P]t is the protein concentration, and n is the number of ligand binding sites within the host. In many cases, multiple binding sites for a given ligand are non-equivalent and ITC allows the characterization of the thermodynamic binding parameters for each individual binding site. This however requires that the correct binding model be used. This choice can be problematic if different models can fit the same experimental data. We have previously shown that this problem can be circumvented by performing experiments at several c-values. The multiple isotherms obtained at different c-values are fit simultaneously to separate models. The correct model is next identified based on the goodness of fit across the entire variable-c dataset. This process is applied here to the aminoglycoside resistance-causing enzyme aminoglycoside N-6'-acetyltransferase-Ii (AAC(6')-Ii). Although our methodology is applicable to any system, the necessity of this strategy is better demonstrated with a macromolecule-ligand system showing allostery or cooperativity, and when different binding models provide essentially identical fits to the same data. To our knowledge, there are no such systems commercially available. AAC(6')-Ii, is a homo-dimer containing two active sites, showing cooperativity between the two subunits. However ITC data obtained at a single c-value can be fit equally well to at least two different models a two-sets-of-sites independent model and a two-site sequential (cooperative) model. Through varying the c-value as explained above, it was established that the correct binding model for AAC(6')-Ii is a two-site sequential binding model. Herein, we describe the steps that must be taken when performing ITC experiments in order to obtain datasets suitable for variable-c analyses.

ITC is a powerful tool for studying the binding of a ligand to its host. In complex systems however, several models may fit the data equally well. The method described here provides a means to elucidate the appropriate binding model for complex systems and extract the corresponding thermodynamic parameters.

Isothermal titration calorimetry (ITC) is commonly used to determine the thermodynamic parameters associated with the binding of a ligand to a host ...

Biology

Isothermal Titration Calorimetry for Measuring Macromolecule-Ligand Affinity

Isothermal titration calorimetry (ITC) is a useful tool for understanding the complete thermodynamic picture of a binding reaction. In biological sciences, macromolecular interactions are essential in understanding the machinery of the cell. Experimental conditions, such as buffer and temperature, can be tailored to the particular binding system being studied. However, careful planning is needed since certain ligand and macromolecule concentration ranges are necessary to obtain useful data. Concentrations of the macromolecule and ligand need to be accurately determined for reliable results. Care also needs to be taken when preparing the samples as impurities can significantly affect the experiment. When ITC experiments, along with controls, are performed properly, useful binding information, such as the stoichiometry, affinity and enthalpy, are obtained. By running additional experiments under different buffer or temperature conditions, more detailed information can be obtained about the system. A protocol for the basic setup of an ITC experiment is given.

A general protocol for the use of isothermal titration calorimetry to monitor the binding thermodynamics for biological systems with moderate binding affinities is presented.

Isothermal titration calorimetry (ITC) is a useful tool for understanding the complete thermodynamic picture of a binding reaction.  In biological ...

Fluorescence Anisotropy to Determine Transcription Factor-DNA Binding Affinity

Source: Jung, C. et al., <a href="https://app.jove.com/v/58763">High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy.</a> J. Vis. Exp. (2019).
This video describes high-performance fluorescence anisotropy that helps to monitor the interaction between transcription factors and DNA. The assay monitors the interactions of a fluorophore-labeled DNA molecule with its specific transcription factor by measuring the degree of polarization due to molecular rotation or anisotropy of the fluorophore-labeled DNA.

Anizotropia fluorescencyjna w celu określenia powinowactwa wiązania czynnika transkrypcyjnego i DNA

Source: Jung, C. et al., High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence ...

JoVE Encyclopedia of Experiments

Biological Techniques

Biomolecular Interaction Detection Techniques

Protein-nucleic acid interactions

Differential Scanning Calorimetry to Study DNA Aptamer-Thermolabile Ligand Interaction

Source: Mittermaier, A. K., et al. <a href="https://app.jove.com/v/55959">Measuring Biomolecular DSC Profiles with Thermolabile Ligands to Rapidly Characterize Folding and Binding Interactions.</a> J. Vis. Exp. (2017)
This video demonstrates differential scanning calorimetry &#8212; a technique to study the interaction between a biomolecule and a ligand. The binding of a DNA aptamer and a thermolabile ligand is studied by applying repeated heating and cooling cycles to the sample and obtaining scans for thermodynamic analysis.

Różnicowa kalorymetria skaningowa do badania interakcji DNA aptamer-termolabilny ligand

Source: Mittermaier, A. K., et al. Measuring Biomolecular DSC Profiles with Thermolabile Ligands to Rapidly Characterize Folding and Binding Interactions. ...

Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Mapping the Binding Site of an Aptamer on ATP Using MicroScale Thermophoresis

Differential Scanning Calorimetry — A Method for Assessing the Thermal Stability and Conformation of Protein Antigen

Hot Biological Catalysis: Isothermal Titration Calorimetry to Characterize Enzymatic Reactions

High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy

Measuring Enzymatic Stability by Isothermal Titration Calorimetry

Determination of In Vitro and Cellular Turn-on Kinetics for Fluorogenic RNA Aptamers

Collecting Variable-concentration Isothermal Titration Calorimetry Datasets in Order to Determine Binding Mechanisms

Isothermal Titration Calorimetry for Measuring Macromolecule-Ligand Affinity

Anizotropia fluorescencyjna w celu określenia powinowactwa wiązania czynnika transkrypcyjnego i DNA

Różnicowa kalorymetria skaningowa do badania interakcji DNA aptamer-termolabilny ligand