Os autores são financiados pelo Corus, entrada de célula MedSys, CADEIA e projetos de Resina.

O protocolo está resumida na fig. 4. 1. Coleta de amostras de sangue <ol><li> Recolher, pelo menos, 3 ml de sangue em tubos de EDTA no local da clínica. </li><li> As amostras podem ser armazenadas até uma semana a 4 ° C. </li><li> Encaminhar as amostras de sangue EDTA-o mais rapidamente possível para o laboratório por correio normal. </li></ol> 2. O isolamento de RNA do HIV e / ou DNA <ol><li> Obter o RNA viral e / ou de ADN a partir de 1000 uL de sangue total, soro ou plasma, utilizando-se o isolamento do ácido Magna Pure Compact Nucleic I kit I e do Sistema Pure Magna Compacto. </li><li> Eluir o RNA ou DNA obtido em 50 ul de tampão TE. Alternativamente, outros processos de ácidos nucleicos de purificação podem ser usados. </li></ol> 3. A amplificação da região env Amplificação da região env (Figs. 2 e 4) a partir de plasma ou de ARN ou ADN proviral. Um produto de 1245 pb de comprimento, que compreende a maior parte da proteína Env (nt 6556-7811 according de HXB2) é gerado. <ol><li> As amostras de RNA: RT-PCR da reacção <ol><li> RNA viral apresenta uma estrutura muito complexa secundária (Fig. 4) que podem impedir a reacção de RT. Para evitar este problema, incubar 10 ul de RNA a 65 ° C durante 10 minutos (já no tubo de PCR e na máquina de PCR) e em seguida reduzir a temperatura a 50 ° C. </li><li> Adicionar 40 ul da PCR Master Mix incluindo os iniciadores Env-F e Env-R. Mix Master para RT-PCR In-House System: <table border="1"><tbody><tr><td></td><td> volume / reacção (ul) </td><td> concentração final </td></tr><tr><td> RNase H 2 O </td><td> 14,4 </td><td></td></tr><tr><td> Tampão de 5x (Qiagen OneStep RT-PCR Kit) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x solução de Q- </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM cada) </td> &lt;td&gt; 2 </td><td> 400 uM de cada dNTP </td></tr><tr><td> Enzym-Mix (Qiagen OneStep RT-PCR Kit) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> Primer Env-R (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> Inibidor de RNase (RNasin) </td><td> 1 </td><td> 5 unidades / reação </td></tr></tbody></table> Env-F: 5&#39;-CAAAGCCTAAAGCCATGTGTAAA -3 &#39;(nt 6556 → 6586 de acordo com HXB2) Env-R: 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(nt 7785 ← 7811) </li><li> Executar a reacção de RT a 50 ° C durante 30 minutos. </li><li> Executar a primeira PCR como se segue: <table border="1"><tbody><tr><td> 95 ° C, 15 min </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 seg 50 ° C, 30 seg 72 ° C, 2 min </td&gt; <td> 1 x </td></tr><tr><td> 95 ° C, 30 seg 56 ° C, 30 seg 72 ° C, 2 min </td><td> 38 x </td></tr><tr><td> 72 ° C, 10 min 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol></li><li> As amostras de DNA: reacção de PCR Para as amostras de ADN proviral, nenhuma reacção de RT inicial é necessária, e a reacção de PCR pode iniciar directamente. <ol><li> Adicionar 40 ul de PCR Master Mix para 10 ul de DNA provial. Mix Master para PCR In-House System: <table border="1"><tbody><tr><td></td><td> volume / reacção (ul) </td><td> concentração final </td></tr><tr><td> RNase H 2 O </td><td> 15,4 </td><td></td></tr><tr><td> Tampão de 5x (HotStarTaq ADN Polimerase) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x solução de Q- </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM cada) </td><td> 2 </td><td> 400 uM de cada dNTP </td></tr><tr><td> Enzym-Mix (HotStarTaq ADN Polimerase) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> Primer Env-R (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr></tbody></table> Env-F: 5&#39;-CAAAGCCTAAAGCCATGTGTAAA -3 &#39;(nt 6556 → 6586) Env-R: 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(nt 7785 ← 7811) </li><li> Executar as condições de PCR como descrito anteriormente para as amostras de ARN (Passo 3.1.4). </li></ol></li></ol> 4. A amplificação da região V3: PCR aninhada <ol><li> Para a PCR aninhada, usar 5 ul a partir da primeira reacção de PCR (sem análise anterior, em gel de agarose) como modelo e adicionar 95 ul de PCR MasMisture ter. Mix Master de Nested-PCR In-House <table border="1"><tbody><tr><td></td><td> volume / reacção (ul) </td><td> concentração final </td></tr><tr><td> H 2 O </td><td> 61,9 </td><td></td></tr><tr><td> Tampão de PCR 10x </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x solução de Q- </td><td> 20 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM cada) </td><td> 2 </td><td> 200 uM de cada dNTP </td></tr><tr><td> Primer Env-2F (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> Primer Env-2R (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> HotStarTaq ADN Polimerase </td><td> 0,5 </td><td> 2,5 unidades / reacção </td></tr></tbody></table> Env-2F: 5&#39;-GTCCAAAGGTATCCTTTGAGCCAATTC -3 &#39;(nt 6838 → 6864) <strong&gt; Env-2R: 5&#39;-CACCACTCTTCTCTTTGCCTTGGTGGGTGC -3 &#39;(nt 7712 ← 7742) </li><li> Executar a PCR como se segue: <table border="0"><tbody><tr><td> 93 ° C, 15 min </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 seg 50 ° C, 30 seg 72 ° C, 90 seg </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 seg 56 ° C, 30 seg 72 ° C, 90 seg </td><td> 43 x </td></tr><tr><td> 72 ° C, 10 min 4 ° C ∞ </td><td></td></tr></tbody></table></li><li> Analisar o produto de PCR num gel de agarose a 1% (Fig. 4). O produto esperado é 902 bp de comprimento. </li><li> A purificação das amostras de sequenciação. <ol><li> Purifica-se o produto de PCR com o kit Qiagen PCR Purification, utilizando-se o protocolo, soluções e micro-colunas fornecidas pelo fornecedor. Eluir em 30-100 ul de tampão PE, dependendo da intensidade da banda. </li><li> Alternativamente, as amostras podem ser purificados utilizando ExonucleaseI e Fast AP (Thermo fosfatase alcalina). Para este fim, adicionar 6 Mix Exo-AP a 15 uL do produto de PCR e incubar 15 minutos a 37 ° C. <table border="1"><tbody><tr><td> 580 ul de H2O </td></tr><tr><td> 66 ul AP rápido </td></tr><tr><td> 13,4 Exo ul eu </td></tr></tbody></table></li></ol></li></ol> 5. Reação seqüência do amplicon V3 <ol><li> A reacção consiste em uma sequência de reacção de PCR, utilizando um dos seguintes iniciadores: Env-2: 5&#39;-GTACAATGYACACATGGAATTAGGC -3 (nt 6959 → 6980) Env-5: 5 &#39;-AAAATTCCCCTCCACAATTA - 3&#39; (nt 7352 ← 7371) Env-6: 5&#39;-GGCCAGTAGTATCAACTCAAC - 3 &#39;(nt 6979 → 7000) Env-7: 5&#39;-TGTCCACTGATGGGAGGGGC - 3 &#39;(nt 7530 ← 7549) Env-10: 5 &#39;- GCAGAATAAAACAAATTATAAACATGTGGC - 3&#39; (nt 7478 ← 7507) Env-11: 5 &#39;- TACATTGCTTTTCCTACTTTCTGCCAC - 3&#39; (nt 7638 ← 7664) Iniciadores de primeira escolha são: Env-2, 6 ou Env-Env-7, Env-11 </li><li> Use 1 ul do fragmento amplificado V3 purificado como modelo e adicionar 9 ul de PCR mestre de mistura. Sequenciamento Mix Master: <table border="1"><tbody><tr><td> 4 ul mistura de sequência (HIV-Genotipagem Kit) </td></tr><tr><td> 4 ul de H2O </td></tr><tr><td> Um Primer ul (100 pmol / pL) </td></tr></tbody></table></li><li> Executar a sequência de reacção como se segue: <table border="0"><tbody><tr><td> 96 ° C, 10 seg </td><td></td></tr><tr><td> 50 ° C, 10 seg </td><td> 36 x </td></tr><tr><td> 60 ° C, 45 seg </td><td></td></tr><tr><td> 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol> 6. A purificação das amostras de sequenciação Purificar seqüências using Sephadex G-50 superfina. <ol><li> Encher o número adequado de poços no &quot;carregador coluna&quot; com Sephadex G-50 superfina. Transfira o Sephadex ao MAHVN4510 placa de filtro virando. </li><li> Adicionar 300 ul de água Milli-Q H 2 O a cada poço na placa de filtro, e incubar-lo durante pelo menos 3 horas a 2-8 ° C. </li><li> Centrifugar as placas durante 5 min a 910Xg e 4-15 ° C. Descartar o fluxo através. </li><li> Adicionar 10 ul de H 2 O para o produto de sequência e, em seguida, a sequência da pipeta na placa de Sephadex incharam. </li><li> Para obter o produto purificado, centrifugar a placa durante 5 min. em 910Xg e 4-15 ° C e recolher o fluxo através. </li></ol> 7. A sequenciação das amostras purificadas no sequenciador ABI Prism 3130 XL <ol><li> Antes de cada corrida, mudar o tampão e verificar o volume do polímero (POP7). Se necessário, substituir o polímero frasco velho por um novo. </li><li> Use as condições de execução salvas, incluindo um tempo de injeção de 18 segundos. </li><li> Nesta máquina, a recolha de dados de sinal de uma experiência com 16 amostras de sequências leva cerca de 60 minutos (36 cm capilar) ou 150 minutos (50 cm capilar). </li></ol> 8. Edição seqüência <ol><li> Usar o programa Lasergene (DNA-Star) para alinhar e editar as sequências (Fig. 5). Outros programas de edição de sequências pode ser utilizado. Utilizar um &quot;B-V3 Consenso&quot; e a sequência de consenso env como referências. </li><li> Lasergene cria uma sequência de consenso da amostra analisada utilizando todos os dados em bruto disponíveis, e armazená-lo como um ficheiro FASTA. O ficheiro FASTA é um ficheiro de texto que inclui um cabeçalho com o nome da amostra e da sequência de nucleótidos. </li></ol> 9. Sequenciamento interpretação de dados e previsão tropismo <ol><li> Sequenciação de interpretação dos dados é realizada pelo sistema de interpretação com base na web geno2pheno [coreceptor] ( <a href="http://coreceptor.bioinf.mpi-inf.mpg.de/index.php">http://coreceptor.bioinf.mpi-inf.mpg.de/</a>index.php). Para a predição tropismo, configurações de FPR diferentes podem ser seleccionados. A configuração padrão é de acordo com as diretrizes germano-austríaca de terapia. Para FPR ≥ 20%, o vírus é classificado como R5 quando FPR ≥ 20% e X4 para FPR &lt;12,5%. </li><li> Carregar o arquivo FASTA no servidor. Este servidor traduz a sequência de nucleótidos em aminoácidos, alinha-o com a sequência de consenso V3-B e produz uma classificação de subtipo. Além disso, ele gera uma previsão da utilização co-receptor (Fig. 4), expresso como a taxa de falso positivo (FPR). </li></ol> 10. Resultados representativos O geno2pheno [coreceptor] saída mostra uma interpretação graduada do tropismo. Dependendo da probabilidade de o uso co-receptor, a interpretação de texto e a cor do fundo que varia do verde (&lt;20% FPR), sugerindo uma administração segura de MVC, a amarela, sugerindo um risco, baixa possível e, finalmente, para o vermelho. Vermelho é a cor sugeremção não prescrever MVC. Além disso, o servidor gera um relatório pdf que pode ser impresso, preenchido com o paciente e os dados de amostra, e enviada para o médico. Exemplos de saída geno2pheno [coreceptor] estão representados na Fig. 6. <img alt="Figura 1" src="/files/ftp_upload/3264/3264fig1.jpg" /> Figura. 1. Replicação esquemática de HIV. O virião deve ligar-se às células CD4 como receptor celular e tanto ao CCR5 ou CXCR4 como co-receptor. O co-receptor CCR5 pode ser bloqueado com os antagonistas do CCR5 como Maraviroc (MVC, Celsentri, Selzentry). Após a fusão das membranas viral e celular, o nucleocapsídeo viral é libertado no citoplasma. A nucleocápside desmonta e do complexo de RNA viral é libertado para dentro do citoplasma. A transcriptase reversa virai (RT) transcreve o ARN genómico em ADN proviral, que é, então, transportado para o núcleo e integrado no genoma do hospedeiro pela integrase HIV. Cellular RNA polimerases transcribe genoma viral e RNA mensageiro a partir do genoma proviral. As proteínas virais são produzidas no citoplasma e transportada para a superfície celular. O vírus bud partículas como imaturas, não infecciosas viriões a partir das células. A protease de HIV cliva as proteínas produtoras de partículas infecciosas. A inibição de um dos passos leva a uma interrupção do ciclo de replicação. As drogas anti-retrovirais e o passo que eles inibem a replicação são marcados a vermelho. O RNA viral e DNA proviral (material utilizado para a análise tropismo ou resistência) estão marcados a verde. <img alt="Figura 2" src="/files/ftp_upload/3264/3264fig2.jpg" /> A Figura 2. HIV genoma proviral. A partícula de HIV é construído com diferentes proteínas estruturais e enzimas diversas casas e proteínas, tanto de origem viral e celular. O show figuraé a localização dos genes dentro do genoma viral. A superfície de proteínas gp120 e gp41 constituem pontas sobre a superfície do virião e contactar a célula humana para realizar a fusão da membrana. Na parte inferior da figura, os produtos de amplificação por PCR e os iniciadores utilizados no nosso protocolo são mostrados. <img alt="Figura 3" src="/files/ftp_upload/3264/3264fig3.jpg" /> Figura 3. Proporção de pacientes com carga viral baixa (VL) medidas analisadas para resistência a drogas ou determinação do tropismo no Instituto de Virologia da Universidade de Colônia (Alemanha). <img alt="Figura 4" src="/files/ftp_upload/3264/3264fig4.jpg" /> Figura 4. Esquema geral do experimento .. Por favor <a href="http://www.jove.com/files/ftp_upload/3264/3264fig4_lg.jpg">clique aqui</a> para ver uma versão maior desta figura. <img alt="Figura 5" src="/files/ftp_upload/3264/3264fig5.jpg" /> Figura 5. Sequência de edição com Lasergene. O amplicon V3 é sequenciado com, pelo menos, um para a frente e um iniciador inverso. Lasergene alignes os &quot;ABI&quot;. Arquivos obtidos no seqüenciador com a referência de seqüências &quot;Consenso V3-B&quot; e env. Lasergene cria uma seqüência consenso com todos os dados da linha disponíveis. As sequências de referência podem ser marcados (e, em seguida, são apresentados a cinzento), de modo que não contribuem para a sequência de consenso da amostra. <img alt="Figura 6" src="/files/ftp_upload/3264/3264fig6.jpg" /> Figura 6. Tropismo relatórios de previsão gerados pelo geno2pheno [co-receptor] relatórios tool.The são gerados como arquivos PDF que podem ser salvos e preenchidos no computador. Dados adicionais nome do paciente nos tal, a data de extração de sangue, etc, podem ser incluídos manualmente usando um programa de escritor pdf. Comentários específicos também podem ser adicionados. Tsdados electrónicos são exclusivamente no computador do utilizador, e não sobre a [coreceptor] geno2pheno servidor. Por favor <a href="http://www.jove.com/files/ftp_upload/3264/3264fig6_lg.jpg">clique aqui</a> para ver uma versão maior desta figura.

<ol>
	<li>Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+coreceptor+proficiency+panel+test.">European coreceptor proficiency panel test.</a> , (2011).</li><li>Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatic+prediction+of+HIV+coreceptor+usage.">Bioinformatic prediction of HIV coreceptor usage.</a> Nature Biotech. 25 (12), 1407-1410 (2007).</li><li>McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+Sequencing+of+the+V3-loop+Is+Comparable+to+the+Enhanced+Sensitivity+Trofile+Assay+in+Predicting+Virologic+Response+to+Maraviroc+of+Treatment-na+ve+Patients+in+the+MERIT+Trial.">Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial.</a> , (2010).</li><li>Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maraviroc+in+treatment-experienced+patients+with+HIV-1+infection+-+experience+from+routine+clinical+practice.">Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice.</a> Eur. J. Med. Res. 15 (6), 231-237 (2010).</li><li>Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+genotypic+prediction+of+HIV-1+coreceptor+use+versus+a+phenotypic+assay+and+correlation+with+the+virological+response+to+maraviroc:+the+ANRS+GenoTropism+study.">Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study.</a> Antimicrob. Agents. Chemother. 54 (8), 3335-3340 (2010).</li><li>Swenson, L. C., Knapp, D., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+and+accuracy+of+the+geno2pheno+co-receptor+algorithm+for+predicting+HIV+tropism+for+single+and+triplicate+measurements+of+V3+genotype.">Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype.</a> , (2010).</li><li>Macartney, M. J., Cameron, J., Strang, A., Garc&#237;a, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+a+genotypic+assay+for+the+prediction+of+HIV-1+coreceptor+tropism+and+guiding+the+use+of+CCR5+antagonists+in+clinical+practice.">Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice.</a> , (2010).</li><li>Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., F&#228;tkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+determination+and+clinical+outcome+of+61+patients+under+MVC+treatment.">Tropism determination and clinical outcome of 61 patients under MVC treatment.</a> , (2010).</li><li>Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., K&#246;ppe, S., &#252;&#252;nsche, T., Berg, T., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+testing+from+proviral+DNA+-+analysis+of+a+subgroup+from+the+Berlin+Maraviroc+cohort.">Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort.</a> , (2010).</li><li>Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+guidelines+on+the+clinical+management+of+HIV-1+tropism+testing.">European guidelines on the clinical management of HIV-1 tropism testing.</a> Lancet Infect Dis. 11 (5), 394-407 (2011).</li><li>Walter, H., Eberle, J., M&#246;ller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empfehlung+zur+Bestimmung+des+HIV-1-Korezeptor-Gebrauchs+(DAIG+Recommendations+for+the+HIV-1+tropism+testing).">Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing).</a> , (2011).</li><li>Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., K&#246;ppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+application+of+genotypic+co-receptor+tropism+testing+from+viral+RNA+and+proviral+DNA:+week+24+analysis+of+the+Berlin+maraviroc+cohort.">Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort.</a> Journal of the International AIDS Society. 13, 129-129 (2010).</li><li>Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+HIV-1+Co-receptor+Tropism+Using+PBMC+Proviral+DNA+Derived+from+Aviremic+Blood+Samples.">Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples.</a> , (2010).</li></ol>

Este artigo de vídeo é patrocinado pela ViiV Healthcare e GlaxoSmithKline.

A sequência V3 permite uma previsão fiável do tropismo viral, como demonstrado em estudos clínicos 3-9. Na verdade, a determinação genotípica é contemplada nas diretrizes atuais europeus e germano-austríaca 10. Em comparação com testes fenotípicos, não só é o mais curto tempo de giro (equivalente ao teste de resistência), mas também os custos. Além disso, uma grande vantagem do teste de genotipagem é que os resultados são classificados como FPR e, portanto, pode ser adaptado às necessidades do paciente. Trofile resultados, por outro lado, são simplesmente relatórios R5 ou X4, e o acesso aos dados em bruto não é dada. Atualmente, as orientações europeias sugerem um FPR de corte de 20 a 10%, enquanto as diretrizes austríaco-alemãs permitem adaptar o FPR de corte especificamente para as necessidades de cada paciente 11. Nesta linha, para pacientes com uma ampla gama de opções de medicamentos anti-retrovirais, maior FPR cut-offs (&gt; 20%) são Recomterminou. Por outro lado, para pesadamente pré-tratados pacientes com poucas opções terapêuticas, inferior FPR pontos de corte (&gt; 5%) pode ser usado. Este tipo de terapia é a orientação actualmente em curso, o teste de resistência de NRTIs, NNRTIs, PIs e inis, onde a droga parcialmente activos podem ser incluídos no tratamento de pacientes com reduzidas opções terapêuticas. Além disso, com um número crescente de mudanças terapia genotipicamente-guiadas, o clinicamente relevante FPR cut-offs estão constantemente a ser ajustado por um painel de bioinformáticos, virologistas e clínicos. Outra importante vantagem do teste de tropismo genotípica é a possibilidade de analisar amostras clínicas com muito baixa ou mesmo não detectável de carga viral (VL). Nestes casos, quando o plasma RNA não é amplif icável, o ADN proviral pode ser sequenciado e usado para previsões confiáveis ​​9,12. Digno de nota, o número de pacientes com baixos ou indetectáveis ​​de carga viral aumentou acentuadamente nos últimos anos. Até à data, o TERFIL ensaio só permite a análise de amostras de pacientes com VL &lt;1000 cópias / ml. No entanto, estudos preliminares mostraram que o ADN proviral pode ser também adecuate a ser testado por Trofile 13.

<table border="1"><tbody><tr><td> Nome do reagente </td><td> Companhia </td><td> Número de catálogo </td><td> Comentários </td></tr><tr><td> Magna Pure Isolation Kit Compacto de Ácido Nucleico I </td><td> Roche Diagnostics </td><td> 04 802 993 001 </td><td></td></tr><tr><td> Sistema Pure Magna Compact </td><td> Roche Diagnostics </td><td> 03731146001 </td><td></td></tr><tr><td> T3000 Termociclador </td><td> Biometra </td><td> 050-723 </td><td></td></tr><tr><td> One Step RT-PCR Kit </td><td> Qiagen </td><td> 210215 </td><td></td></tr><tr><td> HotStarTaq Mix Master Kit </td><td> Qiagen </td><td> 203445 </td><td></td></tr><tr><td> QIAquick PCR Purification Kit </td><td> Qiagen </td><td> 28106 </td><td></td></tr><tr><td> Exonuclease I (Exo I) </td><td> Fermentas </td><td> EN0582 </td><td></td></tr><tr><td> Fastap Fosfatase Alcalina termossensível </td><td> Fermentas </td><td> EF0651 </td> &lt;td&gt; </td></tr><tr><td> Big Dye Terminator v3.1 Cycle Sequencing Kit </td><td> Applied Biosystems </td><td> 4337457 </td><td></td></tr><tr><td> Sephadex G-50 Superfine </td><td> GE Healthcare </td><td> 17-0041-01 </td><td></td></tr><tr><td> Seqüenciador ABI Prism 3130 XL capilar </td><td> Applied Biosystems </td><td> 3130XL </td><td></td></tr></tbody></table>

prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach

Maraviroc (MVC) é o fármaco anti-retroviral licenciada primeiro da classe dos antagonistas do co-receptor. Ele liga-se ao hospedeiro co-receptor CCR5, que é utilizado pela maioria das estirpes de HIV para infectar células humanas imunes (Fig. 1). Outros isolados de HIV usar um co-receptor diferente, o CXCR4. Receptor que é utilizado, é determinada no vírus pela proteína Env (Fig. 2). Dependendo do co-receptor utilizado, os vírus são classificados como R5 ou X4, respectivamente. MVC se liga ao receptor CCR5 inibir a entrada de vírus R5 na célula-alvo. Durante o curso da doença, os vírus X4 pode emergir e superar os vírus R5. Determinação do co-receptor usage (também chamado tropismo) é, portanto, obrigatório, antes da administração de MVC, como exigido pela FDA e EMA. Os estudos para MVC eficiência MOTIVATE, mérito e 1029 foram realizados com o ensaio Trofile de monograma, San Francisco, EUA Este é um ensaio de alta qualidade baseado sophisticated testes recombinantes. A aceitação para este teste para a rotina diária é bastante baixo fora dos EUA, já que os médicos europeus e não tendem a trabalhar com laboratórios especializados descentralizadas, que também oferecem testes de resistência concomitante. Esses laboratórios foram submetidos a avaliações de qualidade de garantia de vários, o último a ser apresentado em 2011 1. Há vários anos, temos realizado determinações tropismo com base em análise da seqüência da região HIV gene env-V3 (V3) 2. Esta região contém informação suficiente para executar uma previsão fiável. A determinação genotípica de uso co-receptor apresenta vantagens como: menor tempo de volume de negócios (equivalente ao teste de resistência), custos mais baixos, possibilidade de adaptar os resultados para as necessidades dos pacientes e possibilidade de analisar amostras clínicas com muito baixo ou mesmo indetectáveis ​​de carga viral (CV ), particularmente desde que o número de amostras analisadas com VL &lt;1000 cópias / mLaproximadamente aumentou nos últimos anos (Fig. 3). Os passos principais para os testes de tropismo (Fig. 4) demonstrado neste vídeo: 1. Coleta de uma amostra de sangue 2. O isolamento do RNA do HIV no plasma e / ou de ADN proviral de VIH a partir de células mononucleares de sangue 3. A amplificação da região env 4. A amplificação da região V3 5. Reação seqüência do amplicon V3 6. A purificação das amostras de sequenciação 7. A sequenciação das amostras purificadas 8. Edição seqüência 9. Sequenciamento interpretação de dados e previsão tropismo

Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

A predição do uso de co-receptor de HIV-1 é necessário para a administração de uma nova classe de fármacos anti-retrovirais co-receptor, ou seja, os antagonistas. Ela pode ser realizada por análise da sequência do<em&gt; Env</em&gt; Gene e posterior interpretação através de um sistema de interpretação baseado na Internet (geno2pheno<sub&gt; [Coreceptor]</sub&gt;).

Previsão do HIV-1 de uso co-receptor (tropismo) por análise de seqüência usando uma abordagem genotípica

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by ...

<a class="grey_button" href="http://www.jove.com/video/4153"> Espa&ntilde;ol </a>

prediction-hiv-1-coreceptor-usage-tropism-sequence-analysis-using

Research

JoVE Journal

Immunology and Infection

Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach

13.1K visualizações.  University of Cologne.  Español 

Vídeo: Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' surface envelope glycoprotein. We previously proposed that the crown of the V3 loop, although dynamic and sequence variable, is constrained throughout the population of HIV-1 viruses to an immunologically relevant &beta;-hairpin tertiary structure. Importantly, there are thousands of different V3 loop crown sequences in circulating HIV-1 viruses, making 3D structural characterization of trends across the diversity of viruses difficult or impossible by crystallography or NMR. Our previous successful studies with folding of the V3 crown1, 2 used the ab initio algorithm 3 accessible in the ICM-Pro molecular modeling software package (Molsoft LLC, La Jolla, CA) and suggested that the crown of the V3 loop, specifically from positions 10 to 22, benefits sufficiently from the flexibility and length of its flanking stems to behave to a large degree as if it were an unconstrained peptide freely folding in solution. As such, rapid ab initio folding of just this portion of the V3 loop of any individual strain of the 60,000+ circulating HIV-1 strains can be informative. Here, we folded the V3 loop of the R2 strain to gain insight into the structural basis of its unique properties. R2 bears a rare V3 loop sequence thought to be responsible for the exquisite sensitivity of this strain to neutralization by patient sera and monoclonal antibodies4, 5. The strain mediates CD4-independent infection and appears to elicit broadly neutralizing antibodies. We demonstrate how evaluation of the results of the folding can be informative for associating observed structures in the folding with the immunological activities observed for R2.

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The crown region of different V3 loop sequences of the surface envelope glycoprotein (gp120) of HIV-1 can be structurally characterized in many cases by in silico folding of positions 10 to 22 of the loop using a state-of-the-art ab initio folding algorithm. Here we demonstrate the folding and evaluation of this region of the V3 loop from the R2 strain of HIV-1, a uniquely neutralization sensitive strain with puzzling functional properties.

Avaliação da dinâmica imunologicamente relevantes Terciário características estruturais do HIV 1-V3 loop Sequence R2 Crown por Ab initio Folding

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' ...

Imunologia e Infecção

Specific Marking of HIV-1 Positive Cells using a Rev-dependent Lentiviral Vector Expressing the Green Fluorescent Protein

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, the LTR is also responsive to cellular activation states and to the local chromatin activity where the integration has occurred. This can result in high HIV-independent activity, and has restricted the usefulness of LTR-based reporter to mark HIV positive cells 1,2,3. Here, we constructed an expression lentiviral vector that possesses, in addition to the Tat-responsive LTR, numerous HIV DNA sequences that include the Rev-response element and HIV splicing sites 4,5,6. The vector was incorporated into a lentiviral reporter virus, permitting highly specific detection of replicating HIV in living cell populations. The activity of the vector was measured by expression of the green fluorescence protein (GFP). The application of this vector as reported here offers a novel alternative approach to existing methods, such as in situ PCR or HIV antigen staining, to identify HIV-positive cells. The vector can also express therapeutic genes for basic or clinical experimentation to target HIV-positive cells.

We have developed a lentiviral vector that possesses, in addition to the Tat-responsive LTR, the Rev-response element (RRE) that can regulate reporter gene expression in an HIV-1 Tat- and Rev-dependent fashion. The vector permits the specific detection of replicating HIV in living cells via the expression of GFP.

Marcação específica de HIV-1 células positivas utilizando um Vector Rev-dependente Lentivirus Expressando a Proteína Verde Fluorescente

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Inferência genotípica do HIV-1 Tropismo Usando de base populacional de Seqüenciamento V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein complexes and assemblies. In fact, single particle electron microscopy1 and two-dimensional (2D) electron crystallography2 have become relatively routine methodologies and a large number of structures have been solved using these methods. At the same time, image processing and three-dimensional (3D) reconstruction of helical objects has rapidly developed, especially, the iterative helical real-space reconstruction (IHRSR) method3, which uses single particle analysis tools in conjunction with helical symmetry. Many biological entities function in filamentous or helical forms, including actin filaments4, microtubules5, amyloid fibers6, tobacco mosaic viruses7, and bacteria flagella8, and, because a 3D density map of a helical entity can be attained from a single projection image, compared to the many images required for 3D reconstruction of a non-helical object, with the IHRSR method, structural analysis of such flexible and disordered helical assemblies is now attainable.
In this video article, we provide detailed protocols for obtaining a 3D density map of a helical protein assembly (HIV-1 capsid9 is our example), including protocols for cryo-EM specimen preparation, low dose data collection by cryo-EM, indexing of helical diffraction patterns, and image processing and 3D reconstruction using IHRSR. Compared to other techniques, cryo-EM offers optimal specimen preservation under near native conditions. Samples are embedded in a thin layer of vitreous ice, by rapid freezing, and imaged in electron microscopes at liquid nitrogen temperature, under low dose conditions to minimize the radiation damage. Sample images are obtained under near native conditions at the expense of low signal and low contrast in the recorded micrographs. Fortunately, the process of helical reconstruction has largely been automated, with the exception of indexing the helical diffraction pattern. Here, we describe an approach to index helical structure and determine helical symmetries (helical parameters) from digitized micrographs, an essential step for 3D helical reconstruction. Briefly, we obtain an initial 3D density map by applying the IHRSR method. This initial map is then iteratively refined by introducing constraints for the alignment parameters of each segment, thus controlling their degrees of freedom. Further improvement is achieved by correcting for the contrast transfer function (CTF) of the electron microscope (amplitude and phase correction) and by optimizing the helical symmetry of the assembly.

This article describes a method to obtain a three-dimensional (3D) structure of helically assembled molecules using cryo-electron microscopy. In this protocol, we use HIV-1 capsid assemblies to illustrate the detailed 3D reconstruction procedure for achieving a density map by the iterative helical real-space reconstruction method.

Estrutura do HIV-1 Assembléias Cápside por Cryo-Microscopia eletrônica e reconstrução iterativa helicoidal espaço-Real

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

Em desencapsulamento vitro do HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the protocols described here use freshly isolated human peripheral blood mononuclear cells (PBMCs) or plasmacytoid dendritic cells (pDCs) to sense infections in either T cell line (MT4) or heterologous primary CD4+ T cells. In order to ensure proper sensing, it is essential that PBMC are isolated immediately after blood collection and that optimal percentage of infected T cells are used. Furthermore, multi-parametric flow cytometric staining can be used to confirm that PBMC samples contain the different cell lineages at physiological ratios. A number of controls can also be included to evaluate viability and functionality of pDCs. These include, the presence of specific surface markers, assessing cellular responses to known agonist of Toll-Like Receptors (TLR) pathways, and confirming a lack of spontaneous type-I interferon (IFN) production. In this system, freshly isolated PBMCs or pDCs are co-cultured with HIV-1 infected cells in 96 well plates for 18-22 hr. Supernatants from these co-cultures are then used to determine the levels of bioactive type-I IFNs by monitoring the activation of the ISGF3 pathway in HEK-Blue IFN-&#945;/&#946; cells. Prior and during co-culture conditions, target cells can be subjected to flow cytometric analysis to determine a number of parameters, including the percentage of infected cells, levels of specific surface markers, and differential killing of infected cells. Although, these protocols were initially developed to follow type-I IFN production, they could potentially be used to study other imuno-modulatory molecules released from pDCs and to gain further insight into the molecular mechanisms governing HIV-1 innate sensing.

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Unlike cell-free HIV-1 particles, infected CD4+ T cells are effectively sensed by plasmacytoid dendritic cells (pDCs). This manuscript describes a method where peripheral blood mononuclear cells (PBMCs) or isolated pDCs are co-cultured with HIV-1 infected T cells to evaluate innate sensing by pDCs as assessed by release of type-I IFN.

Avaliando a inata Sensing de HIV-1 CD4 Infected<sup&gt; +</sup&gt; As células T por células dendríticas plasmocitóides Usando um<em&gt; Ex vivo</em&gt; Co-cultura do sistema.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

Avaliação conformacional do HIV-1 trimérico glicoproteínas do envelope Usando um ELISA Ensaio Celular

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

Isolamento de exossomas a partir do plasma de indivíduos HIV-1 positivos

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

Medição de<em&gt; In Vitro</em&gt; Actividade integração do HIV-1 de pré-integração Complexos

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.