We thank James Waters, Gable Wadsworth and Bo Broadwater for critically reading the manuscript. We also thank four anonymous reviewers for providing useful comments. We acknowledge financial support from Georgia Institute of Technology, the Burroughs Wellcome Fund Career Award at the Scientific Interface, and the student research network grant from NSF Physics of Living Systems.

1. dsDNA Sample Preparation
<ol>
	<li>Design globally curved DNAs by repeating a 10-mer sequence. For example, 5&#8217;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCCX)7 - TTTCATTCGAGCTCGTTGTTG-3&#8217; is a 186-bp curved DNA where X is a random extra base and the sequence flanking the repeating 10-mer sequence are adapter sequences. 
	NOTE: In this example two 10-mers with opposite preferences to nucleosome formation based on a large-scale nucleosome occupancy study by Kap...

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

A simple single-molecule assay based on FRET was used to study looping kinetics of DNAs of different intrinsic shapes. Curved DNAs can be prepared by repeating a 10-mer sequence in phase with the helical period of 10.5 bp, and their curvatures can be estimated using PAGE. These dsDNAs are designed with sticky ends to allow transient loop stabilization. We extracted the looping rate from the exponential rise in the number of looped molecules over time. The annealing rate constant between the disconnected sticky end segmen...

Understanding the mechanical properties of dsDNA is of fundamental importance in basic sciences and engineering applications. The structure of dsDNA is more complicated than a straight helical ladder because roll, tilt, and twist angles between successive base pairs can vary with sequence. Thermal fluctuations can cause dsDNA to undergo diverse modes of conformational fluctuations such as bending, twisting and stretching. Transitions such as melting and kinking can also occur in extreme conditions.
Among these motions, dsDNA bending has the most noticeable biological impact1. dsDNA bending is associated with gene repression or activation by bringing two distant sites close to each other. It also plays an important role in DNA packaging inside the cell nucleus or a viral capsid. Bending deformation of dsDNA can be visualized experimentally by high-resolution microscopy (AFM2 and TEM3), and the thermodynamics and kinetics can be studied by looping assays, which chemically link juxtaposed sites of the dsDNA.
One such assay is ligase-dependent cyclization4. In this assay, dsDNA molecules with &#8216;sticky&#8217; (cohesive) ends are circularized or dimerized by DNA ligase. By comparing the rates of circle and dimer formation, one can obtain an effective molar concentration of one end of the DNA in the vicinity of the other end, which is known as the J factor. This J factor is dimensionally equivalent to the probability density of finding one end of the DNA at a short distance from the other end, and thus reflects the flexibility of the DNA. Measuring the J factor as a function of DNA length reveals many characteristics about DNA mechanics including the persistence length4,5.
The worm-like chain (WLC) model has been widely regarded as the canonical polymer model for dsDNA mechanics based on its success in explaining the force-extension curves obtained in DNA pulling experiments6, and correctly predicting the J factors of dsDNAs longer than 200 bp7. However, using the cyclization assay on dsDNA molecules as short as 100 bp, Cloutier and Widom measured the J factors to be several orders of magnitude higher than the WLC model prediction8. A year later, Du et al. produced J factors in agreement with the WLC model using the cyclization assay with lower concentrations of ligase and attributed the anomalous result from the Widom group to high ligase concentrations used9. This controversy exemplifies the unavoidable influence of DNA ligase on cyclization kinetics when using the conventional assay9. Moreover, DNA ligase can also affect DNA structure and stiffness through nonspecific binding10,11.
To eliminate the technical concerns of protein-dependent looping assays, we recently demonstrated a protein-free looping assay based on Fluorescence Resonance Energy Transfer (FRET)12. In this method, looped conformations are detected by FRET between the donor and acceptor attached near the sticky ends of a DNA molecule. An objective-type total internal reflection fluorescence microscope (TIRFM) is used to record trajectories of reversible looping and unlooping events from surface-immobilized single DNA molecules for a prolonged period of time. This method features PCR-based assembly of DNA molecules to generate mismatch-free DNA molecules, which is a crucial improvement over a similar method by Vafabakhsh and Ha13. The single-molecule aspect of this protocol allows measurement of distributions in addition to ensemble averages while the FRET aspect allows one to measure DNA looping dynamics repeatedly from the same molecule, even in conditions that can impair ligase activity.
The TIRFM setup is shown in Figure 1. A custom-designed specimen stage is placed over an Olympus IX61 microscope body. 532 nm and 640 nm lasers are introduced from the side and are reflected by tiny elliptical mirrors14 into the high NA objective to achieve critical angle of incidence at the coverslip-water interface. We note that more widespread through-objective TIR using dichroic mirrors or prism-based TIR setups can also be used for this FRET application. The fluorescence image formed by the microscope is split into donor and acceptor images by a dichroic mirror. They are then re-imaged onto two halves of an EMCCD. Additional long-pass emission filters are used to reduce background signal.
Temperature control is essential for acquiring reproducible kinetic data. For temperature control, the objective is separated from the nosepiece of the microscope body to minimize heat transfer, and water from a temperature controlled chiller/heater is circulated through a brass collar that tightly fits around the interior metal beneath the objective jacket. This setup is able to achieve robust temperature control at the coverslip surface between 15 and 50 &#176;C (Figure 2). In this work, the sample temperature was maintained at 24 &#176;C.
The following protocol presents the step-by-step procedure for DNA construction, estimation of DNA shape, single-molecule experiment, and J factor determination.

<table border="0" cellpadding="0" cellspacing="0" width="793">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Small DNA FRAG Extract Kit-100PR</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97060-558</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Acrylamide 40% solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97064-522</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Bis-acrylamide 2% (w/v) solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97063-948</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">GeneRuler 100 bp DNA Ladder, 100-1000 bp</td>
			<td style="width:124px;">Fermentas</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Mini Vertical PAGE System</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">89032-300</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Syringe filter 0.2um CS50</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Trolox</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">238813-1G</td>
			<td>triplet state quencher</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuic acid (PCA)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">08992-50MG</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuate 3,4-Dioxygenase (PCD)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">P8279-25UN</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">mPEG-silane, MW 2000 1g</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">MPEG-SIL-2000-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Biotin-PEG-Silane, MW 3400</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">Biotin-PEG-SIL-3400-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Avidin, NeutrAvidin Biotin-binding Protein</td>
			<td style="width:124px;">Invitrogen</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Phusion Hot Start High-Fidelity DNA Polymerase</td>
			<td style="width:124px;">New England Biolabs</td>
			<td style="width:135px;">F-540L</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Gel/PCR DNA Fragments Extraction Kit</td>
			<td>IBI Scientific</td>
			<td>IB47020</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Premium plain glass microscope slides</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;">12-544-1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">VWR micro cover glass, rectangular, no. 1</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">48404-456</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fisher Scientific Isotemp 1006s Recirculating Chiller/Heater</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;"></td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective Cooling Collar</td>
			<td style="width:124px;">Bioptechs</td>
			<td style="width:135px;">150303</td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">KMI53 Biological Micrometer Measuring Stage</td>
			<td style="width:124px;">Semprex</td>
			<td style="width:135px;">KMI53</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">High Performance DPSS Laser 532nm 50mW&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">NT66-968</td>
			<td>Cy3 excitation</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:351px;">CUBE Fiber Pigtailed 640 nm, 30mW, Fiber, FC/APC Connector</td>
			<td style="width:124px;">Coherent</td>
			<td style="width:135px;">1139604</td>
			<td>Cy5 excitation</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">650 nm BrightLine Dichroic Beamsplitter</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">FF650-Di01-25x36</td>
			<td>splitting dichroic</td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:351px;">LaserMUX Beam Combiner, reflects 514.5, 532, &#38; 543.5 nm lasers, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">LM01-552-25</td>
			<td>combining dichroic</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Brightline Fluorescence Filter 593/40</td>
			<td style="width:124px;">Semrock</td>
			<td>FF01-593/40-25</td>
			<td>Cy3 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">635 nm EdgeBasic LWP longpass Filter, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">BLP01-635R-25</td>
			<td>Cy5 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">EMCCD iXon+</td>
			<td style="width:124px;">Andor Technology</td>
			<td style="width:135px;">DU-897E-CS0-#BV</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">IX51 inverted microscope frame</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective UApo N 100x/1.49 Oil TIRF</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Immersion oil type-F for fluorescence microscopy</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;">IMMOIL-F30CC</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">2mm Diameter 45&#176; Rod Lens Aluminum Coated&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">54-092</td>
			<td>miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">1/4&#34; Travel Single-Axis Translation Stage</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">MS-1</td>
			<td>translation of miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">&#216;1&#34; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-200-A</td>
			<td>focusing lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Adjustable Mechanical Slit</td>
			<td style="width:124px;">Thorlabs</td>
			<td>VA100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dielectric Mirror</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">BB1-E02</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">&#216;1&#34; Achromatic Doublet, f = 100 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-100-A</td>
			<td>relay lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Lens Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LMR1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dichroic Filter Mount</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">FFM1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fixed Cage Cube Platform</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">B3C</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Kinematic Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">KM100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lens, &#216;1&#34;, f = 40 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1422-A</td>
			<td>collimating lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 15 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1222-A</td>
			<td>telescope lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 150 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1433-A</td>
			<td>telescope lens</td>
		</tr>
	</tbody>
</table>

studying dna looping by single-molecule fret

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

DNA molecules used for the looping study consist of a duplex region of variable sequence and length and single-stranded overhangs that are complementary to each other. The overhangs, which are 7-base long, can anneal to each other to capture the looped state. Each overhang contains either Cy3 or Cy5 that is linked in the DNA backbone through amidite chemistry. The Cy5-overhang is also linked with biotin-TEG (15-atom Tetra-Ethylene Glycol spacer) for surface immobilization (see Figure 4A). All these modif...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

This study presents a detailed experimental procedure to measure looping dynamics of double-stranded DNA using single-molecule Fluorescence Resonance Energy Transfer (FRET). The protocol also describes how to extract the looping probability density called the J factor.

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Research

JoVE Journal

Biology

15.3K visualizações.  Georgia Institute of Technology.  Este estudo apresenta um procedimento experimental detalhado para medir a dinâmica de loop de DNA de cadeia dupla usando uma única molécula de fluorescência Resonance Energy Transfer (FRET). O protocolo também descreve como extrair a densidade de probabilidade looping chamado o factor de J. 