Este trabalho foi possível graças a subvenções a JK dos Centros de Excelência de Ontário e do Fundo de Investigação Ontario. Gostaríamos de agradecer a Siddika Pardhan e Dr. Peter Ferguson para a assistência técnica durante as filmagens.

NOTA: O protocolo seguinte foi desenvolvido para utilização com células aderentes. As modificações são necessárias para aplicar o método com as células não-aderentes cultivadas em suspensão. Os ensaios de CAM descritas no protocolo são concebidos para utilização com células que expressam um marcador fluorescente (por exemplo, GFP, RFP, etc.). Nove dias de idade embriões de galinha são necessários no dia 2 do protocolo experimental para os experimentos CAM. 1. Preparação e transfecção de células de tumor com oligonucleótidos anti-sentido (ASOs) <ol><li> Aspirar o meio do frasco (s) contendo as células T75 de interesse, lavagem com PBS 1 X, e adicionar 2 ml de 0,25% de tripsina / EDTA. Adicionar 10 ml de meio de crescimento completo a cada balão e transferir as células em solução para um tubo de 50 ml. Contar as células e ajustar o volume para que a concentração final é de 1,0x10 células por 5 ml. </li><li> Etiqueta de dois grupos de frascos T25: um grupo conterá oito frascos rotulados, 1-8, e irá ser used para o tempo real experiência de medição metabolismo; e o segundo grupo também conterá 8 frascos e irá ser utilizado para a experiência de CAM de embrião de galinha. Adicionar 2 ml de solução de células em cada balão e para lugar na incubadora (37 ° C, 5% de CO 2 O / N). </li><li> Na manhã seguinte (Dia 0, Tempo 0), etiqueta três 5 ml tubos da seguinte forma: controle (não-alvo ASO ou siRNA), &quot;alvo de interesse&quot; (ou seja, visando ASO ou siRNA), e Lipofectamine 2000 (ou um semelhante o reagente de transfecção). Dilui-se as soluções de estoque de ASO a uma concentração adequada por meio isento de soro no tubo apropriado. <ol><li> Adicionar a quantidade necessária de reagente de transfecção para o tubo apropriado e incubar em meio isento de soro, durante 5 min. Adicionar a solução de reagente de transfecção para os tubos de ASO e incubar durante 20 min. </li></ol></li><li> Adicionar 250 uL de solução de reagente de transfecção controlo ASO para cada um dos frascos de 1-4 em cada grupo, e 250ul da solução de reagente de transfecção &quot;alvo de interesse&quot; ASO para cada um dos frascos de 5-8 em cada grupo. Incubar durante 4 horas (37 ᵒC, 5% de CO 2). <ol><li> Durante a incubação, siga os passos descritos na secção 2.1. Após a incubação, adicionar 3 ml de meio completo a cada frasco no grupo experimental CAM e retornar à incubadora S / N (37 ᵒC, 5% de CO 2). Processe o grupo experimento metabolismo de acordo com a descrição na seção 2.2. Processe o experimento CAM definido de acordo com a descrição na seção 4. </li></ol></li></ol> 2. Biosensor Chip Preparação e semeadura de células <ol><li> Em um ambiente estéril, lavar cuidadosamente seis chips biossensores com 400 ul de PBS. Esterilizar os chips com 400 mL de etanol a 70% para 20 min. Lavar três vezes com 400 ul de PBS. <ol><li> Coloque os chips dentro cultur tecido estérile pratos para evitar a contaminação. Coloque três chips em um prato chamado &#39;control&#39;, e três em um prato chamado &#39;alvo de interesse &quot;. </li></ol></li><li> Rotular dois tubos de 50 ml como &quot;controle&quot; e &quot;alvo de interesse&quot;. Lavar as células com PBS e adicionar um volume apropriado de 0,25% de tripsina / EDTA. Aguarde até que o separa de monocamada e recolher as células de cada frasco. Depositar a solução no tubo apropriado. <ol><li> Contar as células e ajustar o volume para que a concentração final é de 6.0x10 5 células / mL. Centrifuga-se e voltar a suspender as células se a concentração inicial é demasiado baixo. </li></ol></li><li> Adicionar 250 ul da solução de células para cada chip biossensor em que o grupo apropriado (para um total de 1.25x10 5 células por chip). Execute esta tarefa um grupo de cada vez para minimizar o risco de confundir os chips. Coloque os pratos estéreis contendo os chips dentro de uma câmara de umidade para evitar a evaporação, e colocar os cha umidadember na incubadora S / N (37 ᵒC, 5% de CO 2). </li><li> Na manhã seguinte (Dia 1), aspirar cuidadosamente o meio de cada chip e substituí-la com 250 ul de meio de crescimento suplementado com soro 0,2% de bovino fetal (FBS) e 1x penicilina e estreptomicina (P / S). Incubar durante 4 horas (37 ᵒC, 5% de CO 2). </li></ol> 3. Metabolismo Sistema de Medição Preparação e Solution Preparação <ol><li> Durante a incubação, preparar as soluções de drogas necessárias e o sistema de medição de metabolismo para o próximo ensaio. NOTA: O sistema de medição metabolismo contém um total de seis módulos. Cada módulo acomoda um único chip a cada ensaio. <ol><li> Subdividir o ensaio nos seguintes grupos experimentais: um chip da cada um dos &quot;controlo&quot; e &quot;alvo de interesse&quot; grupos para receber veículo para a duração do ensaio; dois chips de cada grupo a receber tratamento droga durante um período de tempo definido durante o umssay, seguido pelo veículo durante o período de lavagem. </li><li> Para estudos de sensibilização de drogas, modificar o comprimento, tempo e concentração de tratamento de drogas para se adequar a droga particular em questão. NOTA: Para cisplatina, as seguintes etapas foram determinados empiricamente com células A549, e pode variar dependendo da linha celular. Executar todas as etapas, com a taxa de fluxo padrão de 4 l / min. 6 hr de crescimento médio + 0,2% de FBS e 1x P / S 24 hr de 6 mM cisplatina em meio + 0,2% FBS 1x P / S 24 h de crescimento médio + 0,2% de FBS e 1x P / S 18 horas de crescimento médio + 0,2% de FBS e 1x P / S 4 h de 0,1% de Triton-X NOTA: Os desvios estes passos exigirá cálculo para determinar o volume necessário de soluções a médio e drogas com base na vazão desejada e duração do experimento. As secções que se seguem baseiam-se os passos descritos acima. </li></ol></li><li> Etiqueta e preencher catorze 50 ml tubos com 50 ml de meio de crescimento + 0,2% de FBS umd 1x P / S. Coloque seis em um suporte para tubos de medição do metabolismo do sistema, de seis em outro, e os dois restantes de um terceiro suporte de tubos que também contém tubos com cisplatina. Selar as duas primeiras cremalheiras com uma membrana permeável ao ar para prevenir a evaporação. </li><li> Prepara-se uma solução de 6 pM de cisplatina (do volume apropriado) em meio + 0,2% de FBS com 1x P / S. Repartir o volume necessário de uma solução de cisplatina em quatro tubos de 50 ml marcados. <ol><li> Colocar os tubos nas restantes quatro slots no terceiro metabolismo suporte de tubos de medição. Certifique-se de que os tubos são colocados nas respectivas aberturas que correspondem aos biomodules desejados. Selar os tubos com uma membrana permeável ao ar. </li></ol></li><li> Preparar e rotular seis tubos de 50 ml e enchê-los com 20 ml cada uma solução 0,1% Triton-X no meio. A solução Triton-X vai lisar as células restantes e fornecer um valor &quot;zero&quot; para cada chip. Colocar os tubos em uma quarta medida metabolismo suporte para tubos de unidade e selar with uma membrana permable ar para evitar uma evaporação excessiva. </li><li> Coloque as fichas no biomodules e iniciar o experimento. </li></ol> 4. CAM Experiment tratamento medicamentoso e Injeção NOTA: As etapas e os procedimentos para a preparação embriões de galinha para um experimento CAM são descritos em outros lugares 19 <ol><li> Começar a processar o hr pós-transfecção CAM experimento 48 (Dia 2). Sub-dividir o &quot;controle&quot; e &quot;alvo de interesse&quot; grupos em dois frascos para o veículo, e dois para a cisplatina. Aspirar o meio dos frascos e reconstituir ou com 3 ml de meio fresco, ou 6? M cisplatina. Incubar durante 6 horas (37 ᵒC, 5% de CO 2). </li><li> Aspirar o meio e, em seguida lavar e trypsinize as células; recolher as células tripsinizadas em solução em quatro rotulados apropriadamente tubos de 15 ml. <ol><li> Centrifugar e lavar as células três vezes com PBS. Re-suspender o sedimento de células em 5 ml de PBS umad contar as células. </li><li> Ajustar o volume de forma a que a concentração celular final é 1,0x10 6 células / ml. Transferir a solução de células marcadas em tubos de 5 ml por injecção, e colocar em gelo. Inverta os tubos suavemente antes da injecção para assegurar que as células são bem misturados. </li></ol></li><li> Separe um total de 24 embriões de galinha (9 dias de idade) para injeção (6 por grupo). Realizar a injecção utilizando uma agulha de vidro ligada a um tubo flexível ligado a uma seringa de 1 ml. O indivíduo que executa a injecção deve ser cegos ao grupo de tratamento. <ol><li> Usando um microscópio estéreo, injectar 1,0x10 5 células em um volume de 100 ul para a circulação venosa da CAM. Usar uma técnica lenta, pulsante para injectar o volume total das células. Passe suavemente o local da injecção com um wipe para conter o fluxo de sangue e absorver qualquer derrame. Escreva em cada recipiente embrião adequadamente após cada injecção. </li></ol></li><li> Confirme a presença e distribuição de células fluorescentes na vasculatura da CAM após a injecção, visualizando-os utilizando um microscópio de fluorescência. Tome nota de todos os embriões na qual o número de células tumorais parece baixo, ou a distribuição é pobre. </li><li> Coloque os embriões de galinha em uma câmara de umidade e armazená-los em uma incubadora (37 ° C, 60% de umidade). Aguarde 7-9 dias antes de enumerar focos metastáticos. </li></ol> 5. metastático Foco enumeração <ol><li> Durante o período de incubação de 7-9 dia, monitorar os embriões e descartar qualquer mortos. Certifique-se de que a câmara de umidade permanece úmido em todos os momentos durante o período de incubação. </li><li> Usando um microscópio estéreo fluorescente com ampliação de 20x, verificar toda a superfície superior da CAM de embriões em, um padrão tipo grelha regular. </li><li> Contar o número de focos de metástase em cada campo de visão, em seguida, contar o número para um total final por embrião. Se o fizer, para os seis embriões em cada grupo irá fornecer um número o médiof focos metastáticos por tratamento. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

Os autores não têm nada a revelar.

Devido ao custo inerente e os riscos associados com os ensaios clínicos, existe uma necessidade de desenvolver uma melhor e mais rigorosa metodologia de ensaio pré-clínico para avaliar adequadamente a novos regimes de tratamento anti-cancro. Atuais técnicas comumente usadas todas as fraquezas de exposição que podem limitar a sua capacidade de discriminar entre alvos terapêuticos potencialmente promissoras / agentes, e aqueles que podem ser menos eficaz. Eu inventei um protocolo para avaliar novas abordagens anti-...

A resistência adquirida ao alvo e / ou tratamento do cancro citotóxica é um problema clínico importante que pode levar ao fracasso do tratamento, recaída, e um aumento da mortalidade do paciente. Dado o elevado grau de heterogeneidade na maioria dos tumores, é uma certeza matemática que um tumor do número de células suficientemente elevado irá conter um subconjunto de células resistentes a terapias individuais ou combinadas de segmentação vias moleculares em que as referidas células dependem para a sobrevivência 2,3. Tais células tumorais podem ser seleccionadas positivamente por durante o tratamento, levando a recorrência da doença. O desenvolvimento de novas terapias que visam simultaneamente diferentes mecanismos de sobrevivência de células de cancro, quer antes ou depois da selecção mediada por tratamento, é, portanto, clinicamente importante. Um elevado nível de instabilidade do genoma e mutação no genoma de tumor é uma característica fundamental que distingue as células de cancro a partir de células hospedeiras não-tumorais 4. Consequentemente, uma useful estratégia para aumentar a eficácia da quimioterapia danos no DNA e para prevenir o desenvolvimento da resistência é inibir activamente a reparação do ADN em células tumorais 5. Este é um campo ativo de investigação e de uma variedade de alvos de reparo de DNA novos estão sendo exploradas em um cenário pré-clínica. Uma série de pequenas moléculas ou inibidores à base de anti-sentido de estas metas foram desenvolvidos e são submetidos a testes 6-8. O objectivo é o de identificar os candidatos pré-clínicos mais promissoras e avaliar a sua segurança e eficácia em ensaios clínicos. O alto custo dos ensaios clínicos e o risco de falha (para uma variedade de razões, incluindo a avaliação pré-clínica sub-ótima) são formidáveis ​​obstáculos ao progresso no desenvolvimento de novas terapias 9. A utilização de modelos adequados e rigorosos pré-clínico para avaliar adequadamente novos alvos terapêuticos e medicamentos candidatos podem diminuir a elevada taxa de insucesso de 10 ensaios clínicos </sup&gt;. Alguns métodos pré-clínicos comumente usados ​​para avaliar a eficácia de novos regimes anti-cancro são: a) medição da capacidade para reduzir a proliferação de células tumorais in vitro (ensaios de proliferação celular), b) redução induzida pela terapia da capacidade de as células tumorais colónias de cultura de tecidos de forma (ensaios de formação de colónias), c) redução induzida pela terapia da actividade metabólica das células tumorais in vitro (conversão de corante redox), d) induzida por terapia de indução de morte in vitro de células de tumor (por apoptose, necrótica, autophagic, associado com a mitose e outros) 11, e e) a redução in vivo de crescimento ou ablação de xenoenxertos humanos e de rato induzida por terapia 12-14. A principal deficiência dos métodos in vitro listados é que nenhum deles fornecer avaliação contínua em tempo real do efeito das terapias candidatos. Em vez disso, eles fornecem informações somente em pontos de tempo selecionado, amplamente separadosdurante o curso do tratamento. Tais medidas têm diminuído a capacidade para refletir com precisão a magnitude e tempo de respostas das células tumorais. In vivo modelos rato xenograft também são limitadas pelo alto custo, duração de tempo para ser concluído, e risco de dosagem e tratamento calendário abaixo do ideal (agendamento). Além disso, há evidências de que os modelos de xenoenxerto de roedor são preditores limitadas de eficácia clínica em seres humanos, em comparação com uma avaliação in vitro das respostas de células de tumores humanos primários e linhas celulares de tumores humanos estabelecidos a intervenções terapêuticas candidatos 15,16. Eu inventei um protocolo combinação novela para avaliar novas combinações de medicamentos pré-clínica, de forma que aborda os pontos fracos dos procedimentos mais comuns listados acima. Em lugar de proliferação, a formação de colónias, ou ensaios de conversão de corante redox, utilizou-se uma unidade de medição de metabolismo para analisar a adesão celular, a respiração, a acidificação e em tempo realdurante todo o período de tratamento de 17. Simultaneamente, foram investigados os efeitos da combinação de tratamento in vivo usando um modelo de membrana corioalantóica (CAM) de invasão e metástase 18,19 embrião de galinha. Utilizou-se estes métodos para avaliar a capacidade de um oligonucleótido anti-sentido (ASO) BRCA2 direccionamento para potenciar a eficácia da cisplatina utilizada fármaco quimioterapêutico.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

Devido ao elevado nível de heterogeneidade e inerentes mutações em cancros humanos, as terapias de agente único, ou combinações de drogas que têm como alvo a mesma via, são propensos a falhar. Ênfase deve ser colocada sobre a inibição de vias, que são responsáveis ​​pela resistência intrínseca e / ou à terapia adaptativa. Um campo ativo de investigação é o desenvolvimento e teste de inibidores de reparo de DNA que promovem a ação de, e prevenir a resistência a, comumente usado quimioterapia e radioterapia. Utilizou-se um novo protocolo para avaliar a eficácia de inibição BRCA2 como um meio para sensibilizar células tumorais ao ADN prejudiciais cisplatina droga. O metabolismo das células do tumor (acidificação e respiração) foi monitorada em tempo real por um período de 72 h, para delinear a eficácia do tratamento em um minuto a minuto. Em combinação, foi realizada uma avaliação da freqüência metastático utilizando uma membrana corioalantóide embrião de galinha (CAM) modelo de extravasamento e invasão. Esteprotocolo aborda alguns dos pontos fracos dos comumente usados ​​in vitro e in vivo para avaliar métodos novos esquemas de terapia do câncer. Ele pode ser usado em adição aos métodos comuns, tais como ensaios de proliferação celular, ensaios de morte celular, e os estudos in vivo de xenoenxertos de murina, para discriminar entre alvos mais de perto e de agentes candidatos, e seleccionar apenas os candidatos mais promissores para posterior desenvolvimento.

Resultados e figuras adaptado com permissão de trabalho publicado em 22. Inibição BRCA2 induz uma diminuição na respiração cisplatina em células tumorais tratadas Células de câncer de pulmão humano A549 tratados com BRCA2-targeting ASO e cisplatina apresentaram uma diminuição precoce e irreversível na respiração, em comparação com as células que receberam o controlo ASO e cisplatina isolada; após 24 horas de tratamento com ...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

Avaliar a eficácia do Cancer Drogas Sensibilização<em&gt; In Vitro</em&gt; E<em&gt; In Vivo</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.2K visualizações.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Vídeo: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent until many years after removal of the primary tumor and adjuvant therapy. A likely explanation of this phenomenon is that tumor cells have seeded metastatic sites, are resistant to conventional therapies, and remain dormant for long periods of time 1-4.
The existence of dormant cancer cells at secondary sites has been described previously as quiescent solitary cells that neither proliferate nor undergo apoptosis 5-7. Moreover, these solitary cells has been shown to disseminate from the primary tumor at an early stage of disease progression 8-10 and reside growth-arrested in the patients' bone marrow, blood and lymph nodes 1,4,11. Therefore, understanding mechanisms that regulate dormancy or the switch to a proliferative state is critical for discovering novel targets and interventions to prevent disease recurrence. However, unraveling the mechanisms regulating the switch from tumor dormancy to metastatic growth has been hampered by the lack of available model systems.
in vivo and ex vivo model systems to study metastatic progression of tumor cells have been described previously 1,12-14. However these model systems have not provided in real time and in a high throughput manner mechanistic insights into what triggers the emergence of solitary dormant tumor cells to proliferate as metastatic disease. We have recently developed a 3D in vitro system to model the in vivo growth characteristics of cells that exhibit either dormant (D2.OR, MCF7, K7M2-AS.46) or proliferative (D2A1, MDA-MB-231, K7M2) metastatic behavior in vivo . We demonstrated that tumor cells that exhibit dormancy in vivo at a metastatic site remain quiescent when cultured in a 3-dimension (3D) basement membrane extract (BME), whereas cells highly metastatic in vivo readily proliferate in 3D culture after variable, but relatively short periods of quiescence. Importantly by utilizing the 3D in vitro model system we demonstrated for the first time that the ECM composition plays an important role in regulating whether dormant tumor cells will switch to a proliferative state and have confirmed this in in vivo studies15-17. Hence, the model system described in this report provides an in vitro method to model tumor dormancy and study the transition to proliferative growth induced by the microenvironment.

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

A modified 3-D in vitro system is presented in which growth characteristics of several tumor cell lines in reconstituted basement membrane correlate with the dormant or proliferative behavior of the tumor cells at a metastatic secondary site in vivo.

Um In Vitro Sistema para Estudo de dormência Tumor ea Mude para o crescimento metastático

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

Medicina

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional co-culture systems are frequently used to explicate tumor-stroma interactions, including their role in drug responses. However, many of the interactions that occur in vivo in the intact microenvironment cannot be completely replicated in these in vitro settings. Thus, direct visualization of these processes in real-time has become an important tool in understanding tumor responses to therapies and identifying the interactions between cancer cells and the stroma that can influence these responses. Here we provide a method for using spinning disk confocal microscopy of live, anesthetized mice to directly observe drug distribution, cancer cell responses and changes in tumor-stroma interactions following administration of systemic therapy in breast cancer models. We describe procedures for labeling different tumor components, treatment of animals for observing therapeutic responses, and the surgical procedure for exposing tumor tissues for imaging up to 40 hours. The results obtained from this protocol are time-lapse movies, in which such processes as drug infiltration, cancer cell death and stromal cell migration can be evaluated using image analysis software.

We describe a method for imaging response to anti-cancer treatment in vivo and at single cell resolution.

Viver de imagem de Respostas de drogas no microambiente tumoral em modelos do rato do cancro da mama

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these diseases. Chronic retinal diseases such as retinal oedema or neovascularization usually require multiple intraocular injections to effectively treat the condition. However, the risks associated with these injections increase with repeated delivery of the drug. Therefore, alternative delivery methods need to be established in order to minimize the risks of reinjection. Several other investigations have developed methods to deliver drugs over extended time, through materials capable of releasing chemicals slowly into the eye. In this investigation, we outline the use of Elvax 40W, a copolymer resin, to act as a vehicle for drug delivery to the adult rat retina. The resin is made and loaded with the drug. The drug-resin complex is then implanted into the vitreous cavity, where it will slowly release the drug over time. This method was tested using 2-amino-4-phosphonobutyrate (APB), a glutamate analogue that blocks the light response of the retina. It was demonstrated that the APB was slowly released from the resin, and was able to block the retinal response by 7 days after implantation. This indicates that slow-release drug delivery using this copolymer resin is effective for treating the retina, and could be used therapeutically with further testing.

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

De liberação lenta Drug Delivery através Elvax 40W para o Rat Retina: implicações para o tratamento de condições crônicas

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study model. As the use of mouse models are often a vital step in preclinical drug discovery and drug development1-8, it is necessary to design a system to introduce drugs into mice in a uniform, reproducible manner. Ideally, the system should permit the collection of blood samples at regular intervals over a set time course. The ability to measure drug concentrations by mass-spectrometry, has allowed investigators to follow the changes in plasma drug levels over time in individual mice1, 9, 10. In this study, paclitaxel was introduced into transgenic mice as a continuous arterial infusion over three hours, while blood samples were simultaneously taken by retro-orbital bleeds at set time points. Carotid artery infusions are a potential alternative to jugular vein infusions, when factors such as mammary tumors or other obstructions make jugular infusions impractical. Using this technique, paclitaxel concentrations in plasma and tissue achieved similar levels as compared to jugular infusion. In this tutorial, we will demonstrate how to successfully catheterize the carotid artery by preparing an optimized catheter for the individual mouse model, then show how to insert and secure the catheter into the mouse carotid artery, thread the end of the catheter out through the back of the mouse&#8217;s neck, and hook the mouse to a pump to deliver a controlled rate of drug influx. Multiple low volume retro-orbital bleeds allow for analysis of plasma drug concentrations over time.

This method was developed with the goal of delivering a steady drug solution via the carotid artery, to assess the pharmacokinetics of novel drugs in mouse models.

Infusões artéria carótida para farmacocinéticas e farmacodinâmicas Análise de taxanos em Ratos

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of women are alive 5 years after diagnosis. The omentum is a preferred site of HGSC metastasis formation. Despite the clinical importance of this microenvironment, the contribution of omental adipose tissue to ovarian cancer progression remains understudied. Omental adipose is unusual in that it contains structures known as milky spots, which are comprised of B, T, and NK cells, macrophages, and progenitor cells surrounding dense nests of vasculature. Milky spots play a key role in the physiologic functions of the omentum, which are required for peritoneal homeostasis. We have shown that milky spots also promote ovarian cancer metastatic colonization of peritoneal adipose, a key step in the development of peritoneal metastases. Here we describe the approaches we developed to evaluate and quantify milky spots in peritoneal adipose and study their functional contribution to ovarian cancer cell metastatic colonization of omental tissues both in vivo and ex vivo. These approaches are generalizable to additional mouse models and cell lines, thus enabling the study of ovarian cancer metastasis formation from initial localization of cells to milky spot structures to the development of widespread peritoneal metastases.

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

We outline a protocol that implements both in vivo and ex vivo approaches to study ovarian cancer colonization of peritoneal adipose tissues, particularly the omentum. Furthermore, we present a protocol to quantitate and analyze immune cell-structures in the omentum known as milky spots, which promote metastases of peritoneal adipose.

In Vivo e Ex Vivo Abordagens para o Estudo do cancro do ovário metastático Colonização de Estruturas Láctea natural em Peritoneal adiposo

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Estudar o cancro do pâncreas Stem características celulares para desenvolver estratégias Novo tratamento

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic patient tumors in different assays1. Human tumor xenografts represent the gold standard with respect to tumor biology, drug discovery, and metastasis research 2-4. Tumor xenografts can be derived from different types of material like tumor cell lines, tumor tissue from primary patient tumors4 or serially transplanted tumors. When propagated in vivo, xenografted tissue is infiltrated and vascularized by cells of mouse origin. Multiple factors such as the tumor entity, the origin of xenografted material, growth rate and region of transplantation influence the composition and the amount of mouse cells present in tumor xenografts. However, even when these factors are kept constant, the degree of mouse cell contamination is highly variable.
Contaminating mouse cells significantly impair downstream analyses of human tumor xenografts. As mouse fibroblasts show high plating efficacies and proliferation rates, they tend to overgrow cultures of human tumor cells, especially slowly proliferating subpopulations. Mouse cell derived DNA, mRNA, and protein components can bias downstream gene expression analysis, next-generation sequencing, as well as proteome analysis 5. To overcome these limitations, we have developed a fast and easy method to isolate untouched human tumor cells from xenografted tumor tissue. This procedure is based on the comprehensive depletion of cells of mouse origin by combining automated tissue dissociation with the benchtop tissue dissociator and magnetic cell sorting. Here, we demonstrate that human target cells can be can be obtained with purities higher than 96% within less than 20 min independent of the tumor type.

Human tumor xenografts are vascularized and infiltrated by cells of mouse origin during the growth phase in vivo. To circumvent the bias caused by these contaminating cells during downstream analysis, we developed a method allowing for comprehensive depletion of all mouse cells by magnetic cell sorting.

Depleção de células do rato de xenoenxertos de tumor humano Melhora Significativamente Análise Downstream de células alvo

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Inchaço na Organóides intestinal induzida por forscolina: An<em&gt; In Vitro</em&gt; Ensaio para a Avaliação de Medicamentos Response na Fibrose Cística Os pacientes

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

Análise otimizada de<em&gt; In Vivo</em&gt; e<em&gt; In Vitro</em&gt; A esteatose hepática

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the body, an additional extraction procedure is commonly required to release the active constituents from raw herbs. Water decoction is a classical extraction procedure that is still broadly used in the clinical settings. Here, we propose a detailed protocol for er-xian decoction (EXD) in order to apply herbal decoctions to experimental studies. The calculation of an animal-appropriate dose is described, as well as the four main steps of EXD: soaking, water decoction, filtration, and concentration. In addition, serum-containing EXD is introduced to rats as a means of in vitro validation. Here, rats were orally administered EXD for three days. Blood samples were then collected, inactivated, centrifuged, and filtered. The serum, diluted with the culture medium, can be utilized to treat cells or tissues in vitro. For example, EXD was applied to both in vivo and in vitro studies and demonstrated that EXD enhances osteogenesis. This protocol can be used as a reference for the preparation and application of herbal medicines.

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Here, we present the preparation of an er-xian decoction (EXD) in four steps&#8212;soaking, decoction, filtration, and concentration&#8212;and demonstrate the administration of a prepared EXD-containing serum to rats. These methods are applicable to the in vivo and in vitro study of herbal decoctions such as traditional Chinese medicines.

Preparação de Fitoterapia: Decocção Er-Xian e Soro contendo Er-Xian para<em&gt; In Vivo</em&gt; E<em&gt; In Vitro</em&gt; Experimentos

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the ...