Research reported in this manuscript was supported by the National Institute of General Medical Sciences of the National Institutes of Health (P20GM130448) (NAW and RP); National Cancer Institute of the National Institutes of Health (NCI R15 CA242057 01A1); Johnson Cancer Research Center in Kansas State University; and the U.S. Department of Defense (CMDRP PRCRP CA160224 (NAW)). We appreciate KSU-CVM Confocal Core and Joel Sanneman for our immunofluorescence microscopy. The content is solely the responsibility of the authors and does not necessarily represent the official views of these funding agencies.

1. Cell plating
<ol>
	<li>Grow HFK LXSN and HFK 8E6 cells in 10 cm plates in keratinocyte culture media (10 mL/plate) with human keratinocyte growth supplement (HKGS) and 1% penicillin/streptomycin. Grow cells to about 80% confluence at 37 &#176;C in a jacket incubator with 5% CO2.</li>
	<li>Replace culture media with 3 mL of trypsin-EDTA (0.05%, ethylenediamine tetraacetic acid). Incubate at 37 &#176;C for 3 min. Neutralize trypsin with equal volume of fetal bovine serum (FBS) supplemented ...

<ol>
	<li>V&#237;tor, A. C., Huertas, P., Legube, G., de Almeida, S. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+DNA+double-strand+break+repair:+an+ever-growing+toolbox.">Studying DNA double-strand break repair: an ever-growing toolbox.</a> Frontiers in Molecular Biosciences. 7, (2020).</li><li>Giglia-Mari, G., Zotter, A., Vermeulen, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+damage+response.">DNA damage response.</a> Cold Spring Harbor Perspectives in Biology. 3 (1), 000745 (2011).</li><li>Khanna, K. K., Jackson, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+double-strand+breaks:+Signaling,+repair+and+the+cancer+connection.">DNA double-strand breaks: Signaling, repair and the cancer connection.</a> Nature Genetics. 27 (3), 247-254 (2001).</li><li>vanden Berg, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+limited+number+of+double-strand+DNA+breaks+is+sufficient+to+delay+cell+cycle+progression.">A limited number of double-strand DNA breaks is sufficient to delay cell cycle progression.</a> Nucleic Acids Research. 46 (19), 10132-10144 (2018).</li><li>Chang, H. H. Y., Pannunzio, N. R., Adachi, N., Lieber, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-homologous+DNA+end+joining+and+alternative+pathways+to+double-strand+break+repair.">Non-homologous DNA end joining and alternative pathways to double-strand break repair.</a> Nature Reviews Molecular Cell Biology. 18 (8), 495-506 (2017).</li><li>Daley, J. M., Sung, P. 5. 3. B. P. 1. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA1,+and+the+choice+between+recombination+and+end+joining+at+DNA+double-strand+breaks.">BRCA1, and the choice between recombination and end joining at DNA double-strand breaks.</a> Molecular and Cellular Biology. 34 (8), 1380-1388 (2014).</li><li>Godin, S. K., Sullivan, M. R., Bernstein, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+insights+into+RAD51+activity+and+regulation+during+homologous+recombination+and+DNA+replication.">Novel insights into RAD51 activity and regulation during homologous recombination and DNA replication.</a> Biochemistry and Cell Biology = Biochimie et Biologie Cellulaire. 94 (5), 407-418 (2016).</li><li>Jette, N., Lees-Miller, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-dependent+protein+kinase:+a+multifunctional+protein+kinase+with+roles+in+DNA+double+strand+break+repair+and+mitosis.">The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis.</a> Progress in Biophysics and Molecular Biology. 117, 194-205 (2015).</li><li>Weterings, E., van Gent, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+non-homologous+end-joining:+A+synopsis+of+synapsis.">The mechanism of non-homologous end-joining: A synopsis of synapsis.</a> DNA Repair. 3 (11), 1425-1435 (2004).</li><li>Bhargava, R., Lopezcolorado, F. W., Tsai, L. J., Stark, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+canonical+non-homologous+end+joining+factor+XLF+promotes+chromosomal+deletion+rearrangements+in+human+cells.">The canonical non-homologous end joining factor XLF promotes chromosomal deletion rearrangements in human cells.</a> Journal of Biological Chemistry. 295 (1), 125-137 (2020).</li><li>Gunn, A., Bennardo, N., Cheng, A., Stark, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+end+use+during+end+joining+of+multiple+chromosomal+double+strand+breaks+is+influenced+by+repair+protein+RAD50,+DNA-dependent+protein+kinase+DNA-PKcs,+and+transcription+context.">Correct end use during end joining of multiple chromosomal double strand breaks is influenced by repair protein RAD50, DNA-dependent protein kinase DNA-PKcs, and transcription context.</a> Journal of Biological Chemistry. 286 (49), 42470-42482 (2011).</li><li>Simsek, D., Jasin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+end-joining+is+suppressed+by+the+canonical+NHEJ+component+Xrcc4-ligase+IV+during+chromosomal+translocation+formation.">Alternative end-joining is suppressed by the canonical NHEJ component Xrcc4-ligase IV during chromosomal translocation formation.</a> Nature Structural &amp; Molecular Biology. 17 (4), 410-416 (2010).</li><li>Certo, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+genome+engineering+outcome+at+individual+DNA+breakpoints.">Tracking genome engineering outcome at individual DNA breakpoints.</a> Nature Methods. 8 (8), 671-676 (2011).</li><li>Murthy, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterizing+DNA+repair+processes+at+transient+and+long-lasting+double-strand+DNA+breaks+by+immunofluorescence+microscopy.">Characterizing DNA repair processes at transient and long-lasting double-strand DNA breaks by immunofluorescence microscopy.</a> JoVE Journal of Visualized Experiments. (136), e57653 (2018).</li><li>Wang, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+DNA+double-strand-break+repair+using+novel+single-molecule+forceps.">Dissection of DNA double-strand-break repair using novel single-molecule forceps.</a> Nature Structural &amp; Molecular Biology. , (2018).</li><li>Azzam, E. I., Jay-Gerin, J. -. P., Pain, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ionizing+radiation-induced+metabolic+oxidative+stress+and+prolonged+cell+injury.">Ionizing radiation-induced metabolic oxidative stress and prolonged cell injury.</a> Cancer Letters. 327, 48-60 (2012).</li><li>Kuo, L. J., Yang, L. -. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#947;-H2AX+-+A+novel+biomarker+for+DNA+double-strand+breaks.">&#947;-H2AX - A novel biomarker for DNA double-strand breaks.</a> In Vivo. 5, (2008).</li><li>Sanders, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radiation-induced+DNA+damage+and+repair+effects+on+3D+genome+organization.">Radiation-induced DNA damage and repair effects on 3D genome organization.</a> Nature Communications. 11 (1), 6178 (2020).</li><li>Bellaiche, Y., Mogila, V., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=I-SceI+endonuclease,+a+new+tool+for+studying+DNA+double-strand+break+repair+mechanisms+in+Drosophila.">I-SceI endonuclease, a new tool for studying DNA double-strand break repair mechanisms in Drosophila.</a> Genetics. 152 (3), 1037-1044 (1999).</li><li>Wallace, N. A., Robinson, K., Howie, H. L., Galloway, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#946;-HPV+5+and+8+E6+disrupt+homology+dependent+double+strand+break+repair+by+attenuating+BRCA1+and+BRCA2+expression+and+foci+formation.">&#946;-HPV 5 and 8 E6 disrupt homology dependent double strand break repair by attenuating BRCA1 and BRCA2 expression and foci formation.</a> PLOS Pathogens. 11 (3), 1004687 (2015).</li><li>Hu, C., Bugbee, T., Gamez, M., Wallace, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beta+human+papillomavirus+8E6+attenuates+non-homologous+end+joining+by+hindering+DNA-PKcs+activity.">Beta human papillomavirus 8E6 attenuates non-homologous end joining by hindering DNA-PKcs activity.</a> Cancers. 12 (9), 2356 (2020).</li><li>Hu, C., Bugbee, T., Dacus, D., Palinski, R., Wallace, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beta+human+papillomavirus+8+E6+allows+colocalization+of+non-homologous+end+joining+and+homologous+recombination+repair+factors.">Beta human papillomavirus 8 E6 allows colocalization of non-homologous end joining and homologous recombination repair factors.</a> PLOS Pathogens. 18 (3), 1010275 (2022).</li><li>Butler, T. A. J., Paul, J. W., Chan, E. -. C., Smith, R., Tolosa, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misleading+westerns:+Common+quantification+mistakes+in+western+blot+densitometry+and+proposed+corrective+measures.">Misleading westerns: Common quantification mistakes in western blot densitometry and proposed corrective measures.</a> BioMed Research International. 2019, 5214821 (2019).</li><li>Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S., Bonner, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+double-stranded+breaks+induce+histone+H2AX+Phosphorylation+on+serine+139.">DNA double-stranded breaks induce histone H2AX Phosphorylation on serine 139.</a> Journal of Biological Chemistry. 273 (10), 5858-5868 (1998).</li><li>Taning, C. N. T., Van Eynde, B., Yu, N., Ma, S., Smagghe, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+in+insects:+Applications,+best+practices+and+biosafety+concerns.">CRISPR/Cas9 in insects: Applications, best practices and biosafety concerns.</a> Journal of Insect Physiology. 98, 245-257 (2017).</li><li>Ghezraoui, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+translocations+in+human+cells+are+generated+by+canonical+nonhomologous+end-joining.">Chromosomal translocations in human cells are generated by canonical nonhomologous end-joining.</a> Molecular Cell. 55 (6), 829-842 (2014).</li></ol>

The authors have nothing to disclose.

In addition to the depth of information provided, there are several advantages to this method. First, DSB repair, in theory, can be assessed at any genomic loci without modifying the genome of the cell of interest. Second, access to NGS analysis of repair is increased by the reduced cost and computational effort afforded by making and analyzing a single DSB targeted to a defined area. Finally, with the genomes of additional organisms routinely becoming available and multiple publications demonstrating successful transfec...

Maintaining genomic stability is critical for all living organisms. Accurate DNA replication and a robust DNA damage response (DDR) are necessary to faithfully propagate the genetic material1,2. DNA damages occur regularly in most cells2,3. When these damages are sensed, cell cycle progression is halted, and DNA repair mechanisms are activated. Double strand breaks in DNA or DSBs are the most toxic and mutagenic type of DNA damage3,4.
While several DDR signaling pathways can repair these lesions, the most thoroughly studied DSB repair pathways are homologous recombination (HR) and non-homologous end joining (NHEJ). HR is a largely error-free pathway that repairs a DSB using a sister chromatid as a homologous template. This tends to happen in the S phase and G2 phase of a cell cycle5,6,7. NHEJ is more error-prone, but it can happen throughout the cell cycle8,9. Various reporter assays have been developed to measure the efficiency of specific repair mechanisms10,11,12. These assays tend to rely on flow cytometry for a high throughput measurement of DSB repair pathway activity using GFP or mCherry as a readout11,13. While highly efficient, they rely on canonical repair occurring at an artificially introduced DSB.
There are a variety of other methods used to study DSB repair. Many of these rely on immunofluorescence (IF) microscopy1,14. IF microscopy detects discrete nuclear foci representative of repair complexes after DSBs are induced by exposure to genotoxic chemicals or ionizing radiation15,16. Tracking the formation and resolution of these foci provides an indication of repair initiation and completion, respectively14,17. However, these methods of DSB induction (i.e., chemicals or ionizing radiation) do not cause DSBs at defined locations in the genome. It is also functionally impossible to use them to consistently induce only a small number (e.g., 2-4) of DSBs. As a result, the most commonly used methods of inducing DSBs cause a multitude of lesions randomly distributed throughout the genome18. A small number of DSBs can be introduced by inserting the recognition site for a rare-cutting endonuclease and expressing the pertinent endonuclease, such as I-Sce119. Unfortunately, the required integration of a target site prevents the examination of DSB at endogenous genomic loci.
This manuscript describes a method to detect mutations associated with the repair of a DSB generated at a user-defined locus. We provide a representative example of the approach applied to assess the ability of a viral protein to increase the number of mutations associated with a DSB. Specifically, this manuscript describes the use of a single guide RNA (sgRNA) to direct a CAS9 endonuclease to induce a DSB at human CD4 open reading frame in human foreskin keratinocytes expressing vector control (HFK LXSN) and HFK that expresses the E6 protein of human papilloma virus type 8 (HFK 8E6). Targeted next-generation sequencing (NGS) of the region surrounding the break allows mutations associated with the repair of the lesion to be rigorously defined. These data demonstrate that the viral protein causes an approximately 20-fold increase in mutations during DSB repair. It also provides an unbiased characterization of the mutagenic consequences of DSBs at a single locus without the need for whole-genome sequencing. In principle, the protocol could be readily adapted to compare the relative risk of mutations between genome loci or cell lines.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>6 Well Tissue Culture Plate</td>
			<td>Celltreat</td>
			<td>229106</td>
			<td>Cell culture plate</td>
		</tr>
		<tr>
			<td>BCA Kit</td>
			<td>VWR</td>
			<td>89167-794</td>
			<td>BCA assay kit</td>
		</tr>
		<tr>
			<td>Centrifuge 5910 R</td>
			<td>Eppendorf</td>
			<td>2231000772</td>
			<td>Tabletop Centrifuge</td>
		</tr>
		<tr>
			<td>CLC Genomic Workbench</td>
			<td>Qiagen</td>
			<td>832001</td>
			<td>deep sequence data analysis software/indel caller/variant caller</td>
		</tr>
		<tr>
			<td>Digital Microplate Genie pulse</td>
			<td>Scientific industries</td>
			<td>SI-400A</td>
			<td>Plate shaker</td>
		</tr>
		<tr>
			<td>DYKDDDDK Tag Monoclonal Antibody (FG4R)</td>
			<td>ThermoFisher Scientific</td>
			<td>MA191878</td>
			<td>Anti-FLAG antibody</td>
		</tr>
		<tr>
			<td>Epilife CF Kit</td>
			<td>ThermoFisher Scientific</td>
			<td>MEPICF500</td>
			<td>Cell cultrue media and supplements</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>VWR</td>
			<td>89510-194</td>
			<td>Cell culture supplement</td>
		</tr>
		<tr>
			<td>Goat anti-Rabbit IgG</td>
			<td>ThermoFisher Scientific</td>
			<td>A-11012</td>
			<td>Secondary antibody</td>
		</tr>
		<tr>
			<td>HighPrep PCR Clean-up system</td>
			<td>MagBio</td>
			<td>AC-60005</td>
			<td>Bead-based PCR cleanup kit</td>
		</tr>
		<tr>
			<td>KAPA HiFi HotStart ReadyMix PCR Kit</td>
			<td>KAPA Biosystems</td>
			<td>KK2600</td>
			<td>PCR mastermix/PCR assay</td>
		</tr>
		<tr>
			<td>MagAttract HMW DNA kit</td>
			<td>Qiagen</td>
			<td>67563</td>
			<td>High Molecular Weight DNA extraction kit</td>
		</tr>
		<tr>
			<td>Magnetic Stand-96</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM10027</td>
			<td>96-Well Magnetic Rack</td>
		</tr>
		<tr>
			<td>MiniAmp Thermal Cycler</td>
			<td>Applied Biosystems</td>
			<td>A37834</td>
			<td>Thermal Cycler</td>
		</tr>
		<tr>
			<td>Miseq</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td>Sequencer</td>
		</tr>
		<tr>
			<td>Miseq v2 300 cycle reagent kit</td>
			<td>Illumina</td>
			<td>MS-102-2002</td>
			<td>300-cycle cartridge/sequencing reagents</td>
		</tr>
		<tr>
			<td>Nextera XT DNA Library Prep kit</td>
			<td>Illumina</td>
			<td>FC-131-1024</td>
			<td>Library preparation kit</td>
		</tr>
		<tr>
			<td>Nextera XT Kit v2 Set A</td>
			<td>Illumina</td>
			<td>20027215</td>
			<td>Indexes</td>
		</tr>
		<tr>
			<td>Nunc 96-well polypropylene DeepWell Stroage plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>260251</td>
			<td>deep well 96-well plates</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin Solution (100X)</td>
			<td>Calsson Labs</td>
			<td>PSL02-6X100ML</td>
			<td>Antibiotics for cell culture</td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (PBS)</td>
			<td>Bio Basic</td>
			<td>PD8117</td>
			<td>PBS</td>
		</tr>
		<tr>
			<td>px330-CD4</td>
			<td>Addgen</td>
			<td>136938</td>
			<td>SgRNA/CAS9 plasmids targeting 5&#8217;- GGCGTATCTGTGTGAGGACT</td>
		</tr>
		<tr>
			<td>QIAxcel Advanced System</td>
			<td>Qiagen</td>
			<td>9001941</td>
			<td>capillary electrophersis machine</td>
		</tr>
		<tr>
			<td>QIAxcel DNA screening kit</td>
			<td>Qiagen</td>
			<td>929004</td>
			<td>DNA buffer/ capillary electrophersis tubes</td>
		</tr>
		<tr>
			<td>Qubit 1x ds HS Assay Kit</td>
			<td>ThermoFisher Scientific</td>
			<td>Q23851</td>
			<td>Fluorometer reagents/1x dsDNA solution</td>
		</tr>
		<tr>
			<td>Qubit 4 Fluorometer</td>
			<td>ThermoFisher Scientific</td>
			<td>Q33238</td>
			<td>Fluorometer</td>
		</tr>
		<tr>
			<td>Qubit Assay Tubes</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q32856</td>
			<td>Fluorometer assay tubes</td>
		</tr>
		<tr>
			<td>RIPA Lysis Buffer</td>
			<td>VWR</td>
			<td>VWRVN653-100ML</td>
			<td>Lysis buffer for protein extraction</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA (0.05%), phenol red</td>
			<td>ThermoFisher Scientific</td>
			<td>25300054</td>
			<td>Trypsin</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2</td>
			<td>Scientific industries</td>
			<td>SI-0236</td>
			<td>Vortex</td>
		</tr>
		<tr>
			<td>Xfect Transfection Reagent</td>
			<td>Takara Bio</td>
			<td>631318</td>
			<td>Transfection reagent</td>
		</tr>
		<tr>
			<td>genomic data analysis software</td>
			<td>QIAGEN</td>
			<td>CLC Workbench v21.0.</td>
			<td>Data analysis software</td>
		</tr>
	</tbody>
</table>

using next generation sequencing to identify mutations associated with repair of a cas9-induced double strand break near the cd4 promoter

Double strand breaks (DSBs) in DNA are the most cytotoxic type of DNA damage. Because a myriad of insults can result in these lesions (e.g., replication stress, ionizing radiation, unrepaired UV damage), DSBs occur in most cells each day. In addition to cell death, unrepaired DSBs reduce genome integrity and the resulting mutations can drive tumorigenesis. These risks and the prevalence of DSBs motivate investigations into the mechanisms by which cells repair these lesions. Next generation sequencing can be paired with the induction of DSBs by ionizing radiation to provide a powerful tool to precisely define the mutations associated with DSB repair defects. However, this approach requires computationally challenging and cost prohibitive whole genome sequencing to detect the repair of the randomly occurring DSBs associated with ionizing radiation. Rare cutting endonucleases, such as I-Sce1, provide the ability to generate a single DSB, but their recognition sites must be inserted into the genome of interest. As a result, the site of repair is inherently artificial. Recent advances allow guide RNA (sgRNA) to direct a Cas9 endonuclease to any genome locus of interest. This could be applied to the study of DSB repair making next generation sequencing more cost effective by allowing it to be focused on the DNA flanking the Cas9-induced DSB. The goal of the manuscript is to demonstrate the feasibility of this approach by presenting a protocol that can define mutations that stem from the repair of a DSB upstream of the CD4 gene. The protocol can be adapted to determine changes in the mutagenic potential of DSB associated with exogenous factors, such as repair inhibitors, viral protein expression, mutations, and environmental exposures with relatively limited computation requirements. Once an organism's genome has been sequenced, this method can be theoretically employed at any genomic locus and in any cell culture model of that organism that can be transfected. Similar adaptations of the approach could allow comparisons of repair fidelity between different loci in the same genetic background.

Three representative results are presented for this protocol. Figure 1 is an immunoblot confirming expression of CAS9 in HFK control (LXSN) and HFK expressing beta-HPV 8E6 (8E6). 48 h after transfection, whole cell lysates were harvested and subsequently probed with an anti-CAS9 antibody (or GAPDH as a loading control). The result shows that HFK LXSN and HFK 8E6 are expressing similar amount of CAS9 indicating that transfection efficiency is similar between t...

Watch this Scientific Journal Video about Using Next Generation Sequencing to Identify Mutations Associated with Repair of a CAS9-induced Double Strand Break Near the CD4 Promoter at JoVE.com

Using Next Generation Sequencing to Identify Mutations Associated with Repair of a CAS9-induced Double Strand Break Near the CD4 Promoter

Presented here is sgRNA/CAS9 endonuclease and next-generation sequencing protocol that can be used to identify the mutations associated with double strand break repair near the CD4 promoter.

Double strand breaks (DSBs) in DNA are the most cytotoxic type of DNA damage. Because a myriad of insults can result in these lesions (e.g., replication ...

This protocol helps you to identify mutations that occur during the repair of a double-strand break induced by single-guide RNA and CAS9. The main advantage of this technique is that it is a cost-effective and robust way to detect mutations at a specific genomic locus. We use human keratinocyte as an example, but this protocol can be adapted to any transfectable cell lines.Demonstrating this protocol will be Taylor Bugbee, an undergraduate assistant from our laboratory. To begin, culture HFK LXSN and HFK 8E6 cells in 10-centimeter plates at 37 degrees Celsius with 5%carbon dioxide in a jacket incubator containing keratinocyte culture media with human keratinocyte growth supplement and 1%penicillin streptomycin. Replace the culture media with three milliliters of trypsin-EDTA and incubate at 37 degrees Celsius for three minutes.Then, neutralize the trypsin with an equal volume of FBS-supplemented media. Now, transfer the cells to a 15-milliliter centrifuge tube and centrifuge at 300 times G for five minutes. Re-suspend cells with 10 milliliters of keratinocyte culture media with human keratinocyte growth supplement and determine the concentration of cells with a hemocytometer.Afterward, seed two plates each for HFK LXSN and HFK 8E6 cells in four milliliters of keratinocyte culture media with human keratinocyte growth supplement and 1%penicillin streptomycin. Following seeding, incubate the cells at 37 degrees Celsius and 5%carbon dioxide in a jacket incubator. On the day of transfection, replace media with three milliliters of antibiotic-free supplemented media and incubate for two hours at 37 degrees Celsius in a jacket incubator.To transfect the cells, warm transfection reagents to room temperature and pipette them gently before using. Place an appropriate amount of transfection buffer in two sterile 1.5-milliliter centrifuge tubes for each cell line and label them as tube one and mock transfection, or tube two. Then, add two micrograms of plasmid DNA-expressing, CAS9, single-guide, RNA-targeting human CD4 to tube one and pipette gently to mix completely.Add an equal volume of sterile water to tube two. Add an appropriate amount of the transfection reagent to tube one with DNA mixture and the mock transfection or tube two. Using a pipette, gently mix them completely and incubate at room temperature for 15 to 30 minutes to form the complexes.Add the transfection mixture drop-wise to the plate and gently shake the culture plate for one minute to evenly distribute the transfection mixture. To harvest the cells by trypsinization, replace culture media with one milliliter of trypsin EDTA and incubate at 37 degrees Celsius for three minutes. Then, neutralize trypsin with an equal volume of FBS-supplemented media.For each plate of cells, transfer the cell suspension to two microcentrifuge tubes with equal aliquots and centrifuge at 300 times G for five minutes. After centrifugation, re-suspend the cell pellet from one tube in one milliliter of PBS for sequencing, and in another tube, with ice cold PBS for immunoblot. Immunoblot assay was performed to compare the CAS9 expression in untransfected and transected HFK cells.The results show that untransfected and transected HFK cells expressed a similar amount of CAS9, indicating that transfection efficiency is similar between two cell lines. Immunofluorescence microscopy images of phosphorylated histone H2AX S139 in SgRNA/CAS9 transfected cells and untransfected control were obtained. The results indicated that two double-strand breaks were induced by CAS9 SgRNA.Genomic variations were grouped by types of mutational events in HFK LXSN and HFK 8E6, where each group of genomic variations and the total number of variations were compared between HFK LXSN and HFK 8E6. The results showed that 8E6 increases genomic variations within 200 kilobase around the CAS9-induced double-strand breaks, indicating that HPV 8E6 deregulates double-strand break repair and increases genomic instability. The purpose of immunoblot is to measure transfection efficiency, which should be considered during data analysis.In addition to transfection efficiency, immunofluorescence microscopy could be used to confirm double-strand break induction using phospho-H2AX as a marker. We use the beta HPV 8E6 as an example. This technique can be used to detect changes in mutation frequency or type caused by other reagents such as small molecule inhibitors.

using-next-generation-sequencing-to-identify-mutations-associated

Research

JoVE Journal

Genetics

2.3K visualizações.  Kansas State University. Este protocolo ajuda a identificar mutações que ocorrem durante o reparo de uma quebra de dois fios induzida pelo RNA de guia único e CAS9. A principal vantagem desta técnica é que é uma maneira econômica e robusta de detectar mutações em um lócus genômico específico. Usamos a queratinócito humana como exemplo, mas este protocolo pode ser adaptado a qualquer linha celular transfectável.Demonstrando este protocolo estará Taylor Bugbee, um assistente de graduação do noss...