Name: using next generation sequencing to identify mutations associated with repair of a cas9-induced double strand break near the cd4 promoter
Uploaded: 2022-03-31T12:40:00
Description: Watch this Scientific Journal Video about Using Next Generation Sequencing to Identify Mutations Associated with Repair of a CAS9-induced Double Strand Break Near the CD4 Promoter at JoVE.com

Research reported in this manuscript was supported by the National Institute of General Medical Sciences of the National Institutes of Health (P20GM130448) (NAW and RP); National Cancer Institute of the National Institutes of Health (NCI R15 CA242057 01A1); Johnson Cancer Research Center in Kansas State University; and the U.S. Department of Defense (CMDRP PRCRP CA160224 (NAW)). We appreciate KSU-CVM Confocal Core and Joel Sanneman for our immunofluorescence microscopy. The content is solely the responsibility of the authors and does not necessarily represent the official views of these funding agencies.

1. Cell plating
<ol>
	<li>Grow HFK LXSN and HFK 8E6 cells in 10 cm plates in keratinocyte culture media (10 mL/plate) with human keratinocyte growth supplement (HKGS) and 1% penicillin/streptomycin. Grow cells to about 80% confluence at 37 &#176;C in a jacket incubator with 5% CO2.</li>
	<li>Replace culture media with 3 mL of trypsin-EDTA (0.05%, ethylenediamine tetraacetic acid). Incubate at 37 &#176;C for 3 min. Neutralize trypsin with equal volume of fetal bovine serum (FBS) supplemented ...

<ol>
	<li>V&#237;tor, A. C., Huertas, P., Legube, G., de Almeida, S. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+DNA+double-strand+break+repair:+an+ever-growing+toolbox.">Studying DNA double-strand break repair: an ever-growing toolbox.</a> Frontiers in Molecular Biosciences. 7, (2020).</li><li>Giglia-Mari, G., Zotter, A., Vermeulen, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+damage+response.">DNA damage response.</a> Cold Spring Harbor Perspectives in Biology. 3 (1), 000745 (2011).</li><li>Khanna, K. K., Jackson, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+double-strand+breaks:+Signaling,+repair+and+the+cancer+connection.">DNA double-strand breaks: Signaling, repair and the cancer connection.</a> Nature Genetics. 27 (3), 247-254 (2001).</li><li>vanden Berg, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+limited+number+of+double-strand+DNA+breaks+is+sufficient+to+delay+cell+cycle+progression.">A limited number of double-strand DNA breaks is sufficient to delay cell cycle progression.</a> Nucleic Acids Research. 46 (19), 10132-10144 (2018).</li><li>Chang, H. H. Y., Pannunzio, N. R., Adachi, N., Lieber, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-homologous+DNA+end+joining+and+alternative+pathways+to+double-strand+break+repair.">Non-homologous DNA end joining and alternative pathways to double-strand break repair.</a> Nature Reviews Molecular Cell Biology. 18 (8), 495-506 (2017).</li><li>Daley, J. M., Sung, P. 5. 3. B. P. 1. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA1,+and+the+choice+between+recombination+and+end+joining+at+DNA+double-strand+breaks.">BRCA1, and the choice between recombination and end joining at DNA double-strand breaks.</a> Molecular and Cellular Biology. 34 (8), 1380-1388 (2014).</li><li>Godin, S. K., Sullivan, M. R., Bernstein, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+insights+into+RAD51+activity+and+regulation+during+homologous+recombination+and+DNA+replication.">Novel insights into RAD51 activity and regulation during homologous recombination and DNA replication.</a> Biochemistry and Cell Biology = Biochimie et Biologie Cellulaire. 94 (5), 407-418 (2016).</li><li>Jette, N., Lees-Miller, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-dependent+protein+kinase:+a+multifunctional+protein+kinase+with+roles+in+DNA+double+strand+break+repair+and+mitosis.">The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis.</a> Progress in Biophysics and Molecular Biology. 117, 194-205 (2015).</li><li>Weterings, E., van Gent, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+non-homologous+end-joining:+A+synopsis+of+synapsis.">The mechanism of non-homologous end-joining: A synopsis of synapsis.</a> DNA Repair. 3 (11), 1425-1435 (2004).</li><li>Bhargava, R., Lopezcolorado, F. W., Tsai, L. J., Stark, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+canonical+non-homologous+end+joining+factor+XLF+promotes+chromosomal+deletion+rearrangements+in+human+cells.">The canonical non-homologous end joining factor XLF promotes chromosomal deletion rearrangements in human cells.</a> Journal of Biological Chemistry. 295 (1), 125-137 (2020).</li><li>Gunn, A., Bennardo, N., Cheng, A., Stark, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+end+use+during+end+joining+of+multiple+chromosomal+double+strand+breaks+is+influenced+by+repair+protein+RAD50,+DNA-dependent+protein+kinase+DNA-PKcs,+and+transcription+context.">Correct end use during end joining of multiple chromosomal double strand breaks is influenced by repair protein RAD50, DNA-dependent protein kinase DNA-PKcs, and transcription context.</a> Journal of Biological Chemistry. 286 (49), 42470-42482 (2011).</li><li>Simsek, D., Jasin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+end-joining+is+suppressed+by+the+canonical+NHEJ+component+Xrcc4-ligase+IV+during+chromosomal+translocation+formation.">Alternative end-joining is suppressed by the canonical NHEJ component Xrcc4-ligase IV during chromosomal translocation formation.</a> Nature Structural &amp; Molecular Biology. 17 (4), 410-416 (2010).</li><li>Certo, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+genome+engineering+outcome+at+individual+DNA+breakpoints.">Tracking genome engineering outcome at individual DNA breakpoints.</a> Nature Methods. 8 (8), 671-676 (2011).</li><li>Murthy, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterizing+DNA+repair+processes+at+transient+and+long-lasting+double-strand+DNA+breaks+by+immunofluorescence+microscopy.">Characterizing DNA repair processes at transient and long-lasting double-strand DNA breaks by immunofluorescence microscopy.</a> JoVE Journal of Visualized Experiments. (136), e57653 (2018).</li><li>Wang, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+DNA+double-strand-break+repair+using+novel+single-molecule+forceps.">Dissection of DNA double-strand-break repair using novel single-molecule forceps.</a> Nature Structural &amp; Molecular Biology. , (2018).</li><li>Azzam, E. I., Jay-Gerin, J. -. P., Pain, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ionizing+radiation-induced+metabolic+oxidative+stress+and+prolonged+cell+injury.">Ionizing radiation-induced metabolic oxidative stress and prolonged cell injury.</a> Cancer Letters. 327, 48-60 (2012).</li><li>Kuo, L. J., Yang, L. -. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#947;-H2AX+-+A+novel+biomarker+for+DNA+double-strand+breaks.">&#947;-H2AX - A novel biomarker for DNA double-strand breaks.</a> In Vivo. 5, (2008).</li><li>Sanders, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radiation-induced+DNA+damage+and+repair+effects+on+3D+genome+organization.">Radiation-induced DNA damage and repair effects on 3D genome organization.</a> Nature Communications. 11 (1), 6178 (2020).</li><li>Bellaiche, Y., Mogila, V., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=I-SceI+endonuclease,+a+new+tool+for+studying+DNA+double-strand+break+repair+mechanisms+in+Drosophila.">I-SceI endonuclease, a new tool for studying DNA double-strand break repair mechanisms in Drosophila.</a> Genetics. 152 (3), 1037-1044 (1999).</li><li>Wallace, N. A., Robinson, K., Howie, H. L., Galloway, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#946;-HPV+5+and+8+E6+disrupt+homology+dependent+double+strand+break+repair+by+attenuating+BRCA1+and+BRCA2+expression+and+foci+formation.">&#946;-HPV 5 and 8 E6 disrupt homology dependent double strand break repair by attenuating BRCA1 and BRCA2 expression and foci formation.</a> PLOS Pathogens. 11 (3), 1004687 (2015).</li><li>Hu, C., Bugbee, T., Gamez, M., Wallace, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beta+human+papillomavirus+8E6+attenuates+non-homologous+end+joining+by+hindering+DNA-PKcs+activity.">Beta human papillomavirus 8E6 attenuates non-homologous end joining by hindering DNA-PKcs activity.</a> Cancers. 12 (9), 2356 (2020).</li><li>Hu, C., Bugbee, T., Dacus, D., Palinski, R., Wallace, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beta+human+papillomavirus+8+E6+allows+colocalization+of+non-homologous+end+joining+and+homologous+recombination+repair+factors.">Beta human papillomavirus 8 E6 allows colocalization of non-homologous end joining and homologous recombination repair factors.</a> PLOS Pathogens. 18 (3), 1010275 (2022).</li><li>Butler, T. A. J., Paul, J. W., Chan, E. -. C., Smith, R., Tolosa, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misleading+westerns:+Common+quantification+mistakes+in+western+blot+densitometry+and+proposed+corrective+measures.">Misleading westerns: Common quantification mistakes in western blot densitometry and proposed corrective measures.</a> BioMed Research International. 2019, 5214821 (2019).</li><li>Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S., Bonner, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+double-stranded+breaks+induce+histone+H2AX+Phosphorylation+on+serine+139.">DNA double-stranded breaks induce histone H2AX Phosphorylation on serine 139.</a> Journal of Biological Chemistry. 273 (10), 5858-5868 (1998).</li><li>Taning, C. N. T., Van Eynde, B., Yu, N., Ma, S., Smagghe, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+in+insects:+Applications,+best+practices+and+biosafety+concerns.">CRISPR/Cas9 in insects: Applications, best practices and biosafety concerns.</a> Journal of Insect Physiology. 98, 245-257 (2017).</li><li>Ghezraoui, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+translocations+in+human+cells+are+generated+by+canonical+nonhomologous+end-joining.">Chromosomal translocations in human cells are generated by canonical nonhomologous end-joining.</a> Molecular Cell. 55 (6), 829-842 (2014).</li></ol>

In addition to the depth of information provided, there are several advantages to this method. First, DSB repair, in theory, can be assessed at any genomic loci without modifying the genome of the cell of interest. Second, access to NGS analysis of repair is increased by the reduced cost and computational effort afforded by making and analyzing a single DSB targeted to a defined area. Finally, with the genomes of additional organisms routinely becoming available and multiple publications demonstrating successful transfec...

Maintaining genomic stability is critical for all living organisms. Accurate DNA replication and a robust DNA damage response (DDR) are necessary to faithfully propagate the genetic material1,2. DNA damages occur regularly in most cells2,3. When these damages are sensed, cell cycle progression is halted, and DNA repair mechanisms are activated. Double strand breaks in DNA or DSBs are the most toxic and mutagenic type of DNA damage3,4.
While several DDR signaling pathways can repair these lesions, the most thoroughly studied DSB repair pathways are homologous recombination (HR) and non-homologous end joining (NHEJ). HR is a largely error-free pathway that repairs a DSB using a sister chromatid as a homologous template. This tends to happen in the S phase and G2 phase of a cell cycle5,6,7. NHEJ is more error-prone, but it can happen throughout the cell cycle8,9. Various reporter assays have been developed to measure the efficiency of specific repair mechanisms10,11,12. These assays tend to rely on flow cytometry for a high throughput measurement of DSB repair pathway activity using GFP or mCherry as a readout11,13. While highly efficient, they rely on canonical repair occurring at an artificially introduced DSB.
There are a variety of other methods used to study DSB repair. Many of these rely on immunofluorescence (IF) microscopy1,14. IF microscopy detects discrete nuclear foci representative of repair complexes after DSBs are induced by exposure to genotoxic chemicals or ionizing radiation15,16. Tracking the formation and resolution of these foci provides an indication of repair initiation and completion, respectively14,17. However, these methods of DSB induction (i.e., chemicals or ionizing radiation) do not cause DSBs at defined locations in the genome. It is also functionally impossible to use them to consistently induce only a small number (e.g., 2-4) of DSBs. As a result, the most commonly used methods of inducing DSBs cause a multitude of lesions randomly distributed throughout the genome18. A small number of DSBs can be introduced by inserting the recognition site for a rare-cutting endonuclease and expressing the pertinent endonuclease, such as I-Sce119. Unfortunately, the required integration of a target site prevents the examination of DSB at endogenous genomic loci.
This manuscript describes a method to detect mutations associated with the repair of a DSB generated at a user-defined locus. We provide a representative example of the approach applied to assess the ability of a viral protein to increase the number of mutations associated with a DSB. Specifically, this manuscript describes the use of a single guide RNA (sgRNA) to direct a CAS9 endonuclease to induce a DSB at human CD4 open reading frame in human foreskin keratinocytes expressing vector control (HFK LXSN) and HFK that expresses the E6 protein of human papilloma virus type 8 (HFK 8E6). Targeted next-generation sequencing (NGS) of the region surrounding the break allows mutations associated with the repair of the lesion to be rigorously defined. These data demonstrate that the viral protein causes an approximately 20-fold increase in mutations during DSB repair. It also provides an unbiased characterization of the mutagenic consequences of DSBs at a single locus without the need for whole-genome sequencing. In principle, the protocol could be readily adapted to compare the relative risk of mutations between genome loci or cell lines.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>6 Well Tissue Culture Plate</td>
			<td>Celltreat</td>
			<td>229106</td>
			<td>Cell culture plate</td>
		</tr>
		<tr>
			<td>BCA Kit</td>
			<td>VWR</td>
			<td>89167-794</td>
			<td>BCA assay kit</td>
		</tr>
		<tr>
			<td>Centrifuge 5910 R</td>
			<td>Eppendorf</td>
			<td>2231000772</td>
			<td>Tabletop Centrifuge</td>
		</tr>
		<tr>
			<td>CLC Genomic Workbench</td>
			<td>Qiagen</td>
			<td>832001</td>
			<td>deep sequence data analysis software/indel caller/variant caller</td>
		</tr>
		<tr>
			<td>Digital Microplate Genie pulse</td>
			<td>Scientific industries</td>
			<td>SI-400A</td>
			<td>Plate shaker</td>
		</tr>
		<tr>
			<td>DYKDDDDK Tag Monoclonal Antibody (FG4R)</td>
			<td>ThermoFisher Scientific</td>
			<td>MA191878</td>
			<td>Anti-FLAG antibody</td>
		</tr>
		<tr>
			<td>Epilife CF Kit</td>
			<td>ThermoFisher Scientific</td>
			<td>MEPICF500</td>
			<td>Cell cultrue media and supplements</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>VWR</td>
			<td>89510-194</td>
			<td>Cell culture supplement</td>
		</tr>
		<tr>
			<td>Goat anti-Rabbit IgG</td>
			<td>ThermoFisher Scientific</td>
			<td>A-11012</td>
			<td>Secondary antibody</td>
		</tr>
		<tr>
			<td>HighPrep PCR Clean-up system</td>
			<td>MagBio</td>
			<td>AC-60005</td>
			<td>Bead-based PCR cleanup kit</td>
		</tr>
		<tr>
			<td>KAPA HiFi HotStart ReadyMix PCR Kit</td>
			<td>KAPA Biosystems</td>
			<td>KK2600</td>
			<td>PCR mastermix/PCR assay</td>
		</tr>
		<tr>
			<td>MagAttract HMW DNA kit</td>
			<td>Qiagen</td>
			<td>67563</td>
			<td>High Molecular Weight DNA extraction kit</td>
		</tr>
		<tr>
			<td>Magnetic Stand-96</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM10027</td>
			<td>96-Well Magnetic Rack</td>
		</tr>
		<tr>
			<td>MiniAmp Thermal Cycler</td>
			<td>Applied Biosystems</td>
			<td>A37834</td>
			<td>Thermal Cycler</td>
		</tr>
		<tr>
			<td>Miseq</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td>Sequencer</td>
		</tr>
		<tr>
			<td>Miseq v2 300 cycle reagent kit</td>
			<td>Illumina</td>
			<td>MS-102-2002</td>
			<td>300-cycle cartridge/sequencing reagents</td>
		</tr>
		<tr>
			<td>Nextera XT DNA Library Prep kit</td>
			<td>Illumina</td>
			<td>FC-131-1024</td>
			<td>Library preparation kit</td>
		</tr>
		<tr>
			<td>Nextera XT Kit v2 Set A</td>
			<td>Illumina</td>
			<td>20027215</td>
			<td>Indexes</td>
		</tr>
		<tr>
			<td>Nunc 96-well polypropylene DeepWell Stroage plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>260251</td>
			<td>deep well 96-well plates</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin Solution (100X)</td>
			<td>Calsson Labs</td>
			<td>PSL02-6X100ML</td>
			<td>Antibiotics for cell culture</td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (PBS)</td>
			<td>Bio Basic</td>
			<td>PD8117</td>
			<td>PBS</td>
		</tr>
		<tr>
			<td>px330-CD4</td>
			<td>Addgen</td>
			<td>136938</td>
			<td>SgRNA/CAS9 plasmids targeting 5&#8217;- GGCGTATCTGTGTGAGGACT</td>
		</tr>
		<tr>
			<td>QIAxcel Advanced System</td>
			<td>Qiagen</td>
			<td>9001941</td>
			<td>capillary electrophersis machine</td>
		</tr>
		<tr>
			<td>QIAxcel DNA screening kit</td>
			<td>Qiagen</td>
			<td>929004</td>
			<td>DNA buffer/ capillary electrophersis tubes</td>
		</tr>
		<tr>
			<td>Qubit 1x ds HS Assay Kit</td>
			<td>ThermoFisher Scientific</td>
			<td>Q23851</td>
			<td>Fluorometer reagents/1x dsDNA solution</td>
		</tr>
		<tr>
			<td>Qubit 4 Fluorometer</td>
			<td>ThermoFisher Scientific</td>
			<td>Q33238</td>
			<td>Fluorometer</td>
		</tr>
		<tr>
			<td>Qubit Assay Tubes</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q32856</td>
			<td>Fluorometer assay tubes</td>
		</tr>
		<tr>
			<td>RIPA Lysis Buffer</td>
			<td>VWR</td>
			<td>VWRVN653-100ML</td>
			<td>Lysis buffer for protein extraction</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA (0.05%), phenol red</td>
			<td>ThermoFisher Scientific</td>
			<td>25300054</td>
			<td>Trypsin</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2</td>
			<td>Scientific industries</td>
			<td>SI-0236</td>
			<td>Vortex</td>
		</tr>
		<tr>
			<td>Xfect Transfection Reagent</td>
			<td>Takara Bio</td>
			<td>631318</td>
			<td>Transfection reagent</td>
		</tr>
		<tr>
			<td>genomic data analysis software</td>
			<td>QIAGEN</td>
			<td>CLC Workbench v21.0.</td>
			<td>Data analysis software</td>
		</tr>
	</tbody>
</table>

using next generation sequencing to identify mutations associated with repair of a cas9-induced double strand break near the cd4 promoter

Double strand breaks (DSBs) in DNA are the most cytotoxic type of DNA damage. Because a myriad of insults can result in these lesions (e.g., replication stress, ionizing radiation, unrepaired UV damage), DSBs occur in most cells each day. In addition to cell death, unrepaired DSBs reduce genome integrity and the resulting mutations can drive tumorigenesis. These risks and the prevalence of DSBs motivate investigations into the mechanisms by which cells repair these lesions. Next generation sequencing can be paired with the induction of DSBs by ionizing radiation to provide a powerful tool to precisely define the mutations associated with DSB repair defects. However, this approach requires computationally challenging and cost prohibitive whole genome sequencing to detect the repair of the randomly occurring DSBs associated with ionizing radiation. Rare cutting endonucleases, such as I-Sce1, provide the ability to generate a single DSB, but their recognition sites must be inserted into the genome of interest. As a result, the site of repair is inherently artificial. Recent advances allow guide RNA (sgRNA) to direct a Cas9 endonuclease to any genome locus of interest. This could be applied to the study of DSB repair making next generation sequencing more cost effective by allowing it to be focused on the DNA flanking the Cas9-induced DSB. The goal of the manuscript is to demonstrate the feasibility of this approach by presenting a protocol that can define mutations that stem from the repair of a DSB upstream of the CD4 gene. The protocol can be adapted to determine changes in the mutagenic potential of DSB associated with exogenous factors, such as repair inhibitors, viral protein expression, mutations, and environmental exposures with relatively limited computation requirements. Once an organism's genome has been sequenced, this method can be theoretically employed at any genomic locus and in any cell culture model of that organism that can be transfected. Similar adaptations of the approach could allow comparisons of repair fidelity between different loci in the same genetic background.

Three representative results are presented for this protocol. Figure 1 is an immunoblot confirming expression of CAS9 in HFK control (LXSN) and HFK expressing beta-HPV 8E6 (8E6). 48 h after transfection, whole cell lysates were harvested and subsequently probed with an anti-CAS9 antibody (or GAPDH as a loading control). The result shows that HFK LXSN and HFK 8E6 are expressing similar amount of CAS9 indicating that transfection efficiency is similar between t...

Watch this Scientific Journal Video about Using Next Generation Sequencing to Identify Mutations Associated with Repair of a CAS9-induced Double Strand Break Near the CD4 Promoter at JoVE.com

Using Next Generation Sequencing to Identify Mutations Associated with Repair of a CAS9-induced Double Strand Break Near the CD4 Promoter

Presented here is sgRNA/CAS9 endonuclease and next-generation sequencing protocol that can be used to identify the mutations associated with double strand break repair near the CD4 promoter.

Double strand breaks (DSBs) in DNA are the most cytotoxic type of DNA damage. Because a myriad of insults can result in these lesions (e.g., replication ...

This protocol helps you to identify mutations that occur during the repair of a double-strand break induced by single-guide RNA and CAS9. The main advantage of this technique is that it is a cost-effective and robust way to detect mutations at a specific genomic locus. We use human keratinocyte as an example, but this protocol can be adapted to any transfectable cell lines.Demonstrating this protocol will be Taylor Bugbee, an undergraduate assistant from our laboratory. To begin, culture HFK LXSN and HFK 8E6 cells in 10-centimeter plates at 37 degrees Celsius with 5%carbon dioxide in a jacket incubator containing keratinocyte culture media with human keratinocyte growth supplement and 1%penicillin streptomycin. Replace the culture media with three milliliters of trypsin-EDTA and incubate at 37 degrees Celsius for three minutes.Then, neutralize the trypsin with an equal volume of FBS-supplemented media. Now, transfer the cells to a 15-milliliter centrifuge tube and centrifuge at 300 times G for five minutes. Re-suspend cells with 10 milliliters of keratinocyte culture media with human keratinocyte growth supplement and determine the concentration of cells with a hemocytometer.Afterward, seed two plates each for HFK LXSN and HFK 8E6 cells in four milliliters of keratinocyte culture media with human keratinocyte growth supplement and 1%penicillin streptomycin. Following seeding, incubate the cells at 37 degrees Celsius and 5%carbon dioxide in a jacket incubator. On the day of transfection, replace media with three milliliters of antibiotic-free supplemented media and incubate for two hours at 37 degrees Celsius in a jacket incubator.To transfect the cells, warm transfection reagents to room temperature and pipette them gently before using. Place an appropriate amount of transfection buffer in two sterile 1.5-milliliter centrifuge tubes for each cell line and label them as tube one and mock transfection, or tube two. Then, add two micrograms of plasmid DNA-expressing, CAS9, single-guide, RNA-targeting human CD4 to tube one and pipette gently to mix completely.Add an equal volume of sterile water to tube two. Add an appropriate amount of the transfection reagent to tube one with DNA mixture and the mock transfection or tube two. Using a pipette, gently mix them completely and incubate at room temperature for 15 to 30 minutes to form the complexes.Add the transfection mixture drop-wise to the plate and gently shake the culture plate for one minute to evenly distribute the transfection mixture. To harvest the cells by trypsinization, replace culture media with one milliliter of trypsin EDTA and incubate at 37 degrees Celsius for three minutes. Then, neutralize trypsin with an equal volume of FBS-supplemented media.For each plate of cells, transfer the cell suspension to two microcentrifuge tubes with equal aliquots and centrifuge at 300 times G for five minutes. After centrifugation, re-suspend the cell pellet from one tube in one milliliter of PBS for sequencing, and in another tube, with ice cold PBS for immunoblot. Immunoblot assay was performed to compare the CAS9 expression in untransfected and transected HFK cells.The results show that untransfected and transected HFK cells expressed a similar amount of CAS9, indicating that transfection efficiency is similar between two cell lines. Immunofluorescence microscopy images of phosphorylated histone H2AX S139 in SgRNA/CAS9 transfected cells and untransfected control were obtained. The results indicated that two double-strand breaks were induced by CAS9 SgRNA.Genomic variations were grouped by types of mutational events in HFK LXSN and HFK 8E6, where each group of genomic variations and the total number of variations were compared between HFK LXSN and HFK 8E6. The results showed that 8E6 increases genomic variations within 200 kilobase around the CAS9-induced double-strand breaks, indicating that HPV 8E6 deregulates double-strand break repair and increases genomic instability. The purpose of immunoblot is to measure transfection efficiency, which should be considered during data analysis.In addition to transfection efficiency, immunofluorescence microscopy could be used to confirm double-strand break induction using phospho-H2AX as a marker. We use the beta HPV 8E6 as an example. This technique can be used to detect changes in mutation frequency or type caused by other reagents such as small molecule inhibitors.

using-next-generation-sequencing-to-identify-mutations-associated

Research

JoVE Journal

Genetics

Wild-type Blocking PCR Combined with Direct Sequencing as a Highly Sensitive Method for Detection of Low-Frequency Somatic Mutations

Accurate detection and identification of low frequency mutations can be problematic when assessing residual disease after therapy, screening for emerging resistance mutations during therapy, or when patients have few circulating tumor cells. Wild-type blocking PCR followed by sequencing analysis offers high sensitivity, flexibility, and simplicity as a methodology for detecting these low frequency mutations. By adding a custom designed locked nucleic acid oligonucleotide to a new or previously established conventional PCR based sequencing assay, sensitivities of approximately 1 mutant allele in a background of 1,000 WT alleles can be achieved (1:1,000). Sequencing artifacts associated with deamination events commonly found in formalin fixed paraffin embedded tissues can be partially remedied by the use of uracil DNA glycosylase during extraction steps. The optimized protocol here is specific for detecting MYD88 mutation, but can serve as a template to design any WTB-PCR assay. Advantages of the WTB-PCR assay over other commonly utilized assays for the detection of low frequency mutations including allele specific PCR and real-time quantitative PCR include fewer occurrences of false positives, greater flexibility and ease of implementation, and the ability to detect both known and unknown mutations.

Wild-type blocking PCR followed by direct sequencing offers a highly sensitive method of detection for low frequency somatic mutations in a variety of sample types.

Accurate detection and identification of low frequency mutations can be problematic when assessing residual disease after therapy, screening for emerging ...

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Optimization and Comparative Analysis of Plant Organellar DNA Enrichment Methods Suitable for Next-generation Sequencing

Plant organellar genomes contain large, repetitive elements that may undergo pairing or recombination to form complex structures and/or sub-genomic fragments. Organellar genomes also exist in admixtures within a given cell or tissue type (heteroplasmy), and an abundance of subtypes may change throughout development or when under stress (sub-stoichiometric shifting). Next-generation sequencing (NGS) technologies are required to obtain deeper understanding of organellar genome structure and function. Traditional sequencing studies use several methods to obtain organellar DNA: (1) If a large amount of starting tissue is used, it is homogenized and subjected to differential centrifugation and/or gradient purification. (2) If a smaller amount of tissue is used (i.e., if seeds, material, or space is limited), the same process is performed as in (1), followed by whole-genome amplification to obtain sufficient DNA. (3) Bioinformatics analysis can be used to sequence the total genomic DNA and to parse out organellar reads. All these methods have inherent challenges and tradeoffs. In (1), it may be difficult to obtain such a large amount of starting tissue; in (2), whole-genome amplification could introduce a sequencing bias; and in (3), homology between nuclear and organellar genomes could interfere with assembly and analysis. In plants with large nuclear genomes, it is advantageous to enrich for organellar DNA to reduce sequencing costs and sequence complexity for bioinformatics analyses. Here, we compare a traditional differential centrifugation method with a fourth method, an adapted CpG-methyl pulldown approach, to separate the total genomic DNA into nuclear and organellar fractions. Both methods yield sufficient DNA for NGS, DNA that is highly enriched for organellar sequences, albeit at different ratios in mitochondria and chloroplasts. We present the optimization of these methods for wheat leaf tissue and discuss major advantages and disadvantages of each approach in the context of sample input, protocol ease, and downstream application.

The comparison and optimization of two plant organellar DNA enrichment methods are presented: traditional differential centrifugation and fractionation of the total gDNA based on methylation status. We assess the resulting DNA quantity and quality, demonstrate performance in short-read next-generation sequencing, and discuss the potential for use in long-read single-molecule sequencing.

Plant organellar genomes contain large, repetitive elements that may undergo pairing or recombination to form complex structures and/or sub-genomic ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution based analysis methodology (nucleosome density ChIP-seq; ndChIP-seq) that enables the generation of combined measurements of micrococcal nuclease (MNase) accessibility with histone modification genome-wide. Nucleosome position and local density, and the posttranslational modification of their histone subunits, act in concert to regulate local transcription states. Combinatorial measurements of nucleosome accessibility with histone modification generated by ndChIP-seq allows for the simultaneous interrogation of these features. The ndChIP-seq methodology is applicable to small numbers of primary cells inaccessible to cross-linking based ChIP-seq protocols. Taken together, ndChIP-seq enables the measurement of histone modification in combination with local nucleosome density to obtain new insights into shared mechanisms that regulate RNA transcription within rare primary cell populations.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) methodology for the generation of sequence datasets suitable for a nucleosome density ChIP-seq analytical framework integrating micrococcal nuclease (MNase) accessibility with histone modification measurements.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Targeted Next-generation Sequencing and Bioinformatics Pipeline to Evaluate Genetic Determinants of Constitutional Disease

Next-generation sequencing (NGS) is quickly revolutionizing how research into the genetic determinants of constitutional disease is performed. The technique is highly efficient with millions of sequencing reads being produced in a short time span and at relatively low cost. Specifically, targeted NGS is able to focus investigations to genomic regions of particular interest based on the disease of study. Not only does this further reduce costs and increase the speed of the process, but it lessens the computational burden that often accompanies NGS. Although targeted NGS is restricted to certain regions of the genome, preventing identification of potential novel loci of interest, it can be an excellent technique when faced with a phenotypically and genetically heterogeneous disease, for which there are previously known genetic associations. Because of the complex nature of the sequencing technique, it is important to closely adhere to protocols and methodologies in order to achieve sequencing reads of high coverage and quality. Further, once sequencing reads are obtained, a sophisticated bioinformatics workflow is utilized to accurately map reads to a reference genome, to call variants, and to ensure the variants pass quality metrics. Variants must also be annotated and curated based on their clinical significance, which can be standardized by applying the American College of Medical Genetics and Genomics Pathogenicity Guidelines. The methods presented herein will display the steps involved in generating and analyzing NGS data from a targeted sequencing panel, using the ONDRISeq neurodegenerative disease panel as a model, to identify variants that may be of clinical significance.

Targeted next-generation sequencing is a time- and cost-efficient approach that is becoming increasingly popular in both disease research and clinical diagnostics. The protocol described here presents the complex workflow required for sequencing and the bioinformatics process used to identify genetic variants that contribute to disease.

Next-generation sequencing (NGS) is quickly revolutionizing how research into the genetic determinants of constitutional disease is performed. The ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the spatio-temporal expression of their target genes through physical contact, often bridging considerable (in some cases hundreds of kilobases) genomic distances and bypassing nearby genes. The human genome harbors an estimated one million enhancers, the vast majority of which have unknown gene targets. Assigning distal regulatory regions to their target genes is thus crucial to understand gene expression control. We developed Promoter Capture Hi-C (PCHi-C) to enable the genome-wide detection of distal promoter-interacting regions (PIRs), for all promoters in a single experiment. In PCHi-C, highly complex Hi-C libraries are specifically enriched for promoter sequences through in-solution hybrid selection with thousands of biotinylated RNA baits complementary to the ends of all promoter-containing restriction fragments. The aim is to then pull-down promoter sequences and their frequent interaction partners such as enhancers and other potential regulatory elements. After high-throughput paired-end sequencing, a statistical test is applied to each promoter-ligated restriction fragment to identify significant PIRs at the restriction fragment level. We have used PCHi-C to generate an atlas of long-range promoter interactions in dozens of human and mouse cell types. These promoter interactome maps have contributed to a greater understanding of mammalian gene expression control by assigning putative regulatory regions to their target genes and revealing preferential spatial promoter-promoter interaction networks. This information also has high relevance to understanding human genetic disease and the identification of potential disease genes, by linking non-coding disease-associated sequence variants in or near control sequences to their target genes.

DNA regulatory elements, such as enhancers, control gene expression by physically contacting target gene promoters, often through long-range chromosomal interactions spanning large genomic distances. Promoter Capture Hi-C (PCHi-C) identifies significant interactions between promoters and distal regions, enabling the assignment of potential regulatory sequences to their target genes.

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near full-length (intact and defective), HIV-1 proviruses. FLIPS allows determination of the genetic composition of integrated HIV-1 within a cell population. Through identifying defects within HIV-1 proviral sequences that arise during reverse transcription, such as large internal deletions, deleterious stop codons/hypermutation, frameshift mutations, and mutations/deletions in cis acting elements required for virion maturation, FLIPS can identify integrated proviruses incapable of replication. The FLIPS assay can be utilized to identify HIV-1 proviruses that lack these defects and are&#160;therefore potentially replication-competent. The FLIPS protocol involves: lysis of HIV-1 infected cells, nested PCR of near full-length HIV-1 proviruses (using primers targeted to the HIV-1 5&#39; and 3&#39; LTR), DNA purification and quantification, library preparation for Next-generation Sequencing (NGS), NGS, de novo assembly of proviral contigs, and a simple process of elimination for identifying replication-competent proviruses. FLIPS provides advantages over traditional methods designed to sequence integrated HIV-1 proviruses, such as single-proviral sequencing. FLIPS amplifies and sequences near full-length proviruses enabling replication competency to be determined, and also uses fewer amplification primers, preventing the consequences of primer mismatches. FLIPS is a useful tool for understanding the genetic landscape of integrated HIV-1 proviruses, especially within the latent reservoir, however, its utilization can extend to any application in which the genetic composition of integrated HIV-1 is required.

Full-length individual proviral sequencing (FLIPS) provides an efficient and high-throughput method for the amplification and sequencing of single, near full-length (intact and defective) HIV-1 proviruses and allows for determination of their potential replication-competency. FLIPS overcomes limitations of previous assays designed to sequence the latent HIV-1 reservoir.

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and effect sizes of regulatory elements to a target gene. Some progress has been made with the bioinformatic prediction of the existence and function of proximal epigenetic modifications associated with activated gene expression using conserved transcription factor binding sites. Chromatin conformation capture studies have revolutionized our ability to discover physical chromatin contacts between sequences and even within an entire genome. Circular chromatin conformation capture coupled with next-generation sequencing (4C-seq), in particular, is designed to discover all possible physical chromatin interactions for a given sequence of interest (viewpoint), such as a target gene or a regulatory enhancer. Current 4C-seq strategies directly sequence from within the viewpoint but require numerous and diverse viewpoints to be simultaneously sequenced to avoid the technical challenges of uniform base calling (imaging) with next generation sequencing platforms. This volume of experiments may not be practical for many laboratories. Here, we report a modified approach to the 4C-seq protocol that incorporates both an additional restriction enzyme digest and qPCR-based amplification steps that are designed to facilitate a greater capture of diverse sequence reads and mitigate the potential for PCR bias, respectively. Our modified 4C method is amenable to the standard molecular biology lab for assessing chromatin architecture.

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

The identification of physical interactions between genes and regulatory elements is challenging but has been facilitated by chromosome conformation capture methods. This modification to the 4C-seq protocol mitigates PCR bias by minimizing over-amplification of PCR templates and maximizes the mappability of reads by incorporating an addition restriction enzyme digest step.

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...